* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Transcription/translation
History of biology wikipedia , lookup
Biochemistry wikipedia , lookup
DNA-encoded chemical library wikipedia , lookup
Chemical biology wikipedia , lookup
Synthetic biology wikipedia , lookup
Biomolecular engineering wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Symbiogenesis wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Molecular paleontology wikipedia , lookup
Non-coding DNA wikipedia , lookup
List of types of proteins wikipedia , lookup
History of RNA biology wikipedia , lookup
Introduction to genetics wikipedia , lookup
Non-coding RNA wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
RNA-binding protein wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Gene expression wikipedia , lookup
Messenger RNA wikipedia , lookup
Chapter 8: From DNA to Protein Section 8.4 - Transcription Regents Biology What do we know so far? DNA DNA is the genetic information Located in Nucleus (protected in vault) So the DNA molecule Proteins is the instructions making proteins!!! all living things made offor proteins Proteins made by ribosomes in cytoplasm I get it!!! proteins run living organisms example – enzymes DNA is like a blueprint!! Regents Biology But there is a problem………. Need to get the blueprint information (DNA message) from nucleus to cytoplasm We need a messenger Regents Biology We need mRNA!!!! Who is the mRNA messenger? messenger RNA DNA build proteins nucleus RNA mRNA cytoplasm Regents Biology The “Central Dogma” – information flows in one direction transcription DNA protein mRNA translation trait cell nucleus Regents Biology cell cytoplasm (phenotype) You have to know differences between DNA and RNA for my test and EOC!!!! RNA ribose sugar nitrogen bases G, C, A, U DNA deoxyribose sugar nitrogen bases U = uracil U:A C:G single stranded Regents Biology G, C, A, T T = thymine T:A C:G double stranded Transcription is making mRNA from DNA Double stranded DNA unzips by helicase enzyme T G G T A C A G C T A G T C A T CG T A C CG T Regents Biology Transcription is making mRNA from DNA Now that DNA is unzipped; enzyme RNA polymerase attaches base pairs T G G T A C A G C T A G T C A T CG T A C CG T Regents Biology Transcription is making mRNA from DNA A RNA polymerase will match RNA bases to DNA bases on one of the DNA strands Notice NO THYMINE!!!!!!! G U A G G U U C A AG C C G A U A C RNA A C C polymerase G A U T G G T A C A G C T A G T C A T CG T A C CG T Regents Biology U C Transcription is making mRNA from DNA U instead of T is matched to A in mRNA DNA TACGCACATTTACGTACGCGG mRNA AUGCGUGUAAAUGCAUGCGCC Once mRNA molecule is completed it leaves nucleus and goes to cell cytoplasm Regents Biology Chapter 8: From DNA to Protein Section 8.5 - Translation Regents Biology DNA instructions remain in nucleus and we have to send message out nucleus mRNA has the instructions for building proteins from DNA A C C A U G U C G A U C A G U A G C A U G GC A Regents Biology Proteins are built as chains of amino acids What reads RNA? need a mRNA reader! Regents Biology RNA to protein mRNA leaves nucleus mRNA goes to ribosomes in cytoplasm amino acids are linked bc of mRNA message proteins built from sequence of amino acids Now lets look at bigger picture!!! mRNA A C C A U G U C G A U C A GU A GC A U G GC A aa Regents Biology aa aa aa aa aa aa aa RNA to protein bigger picture Cell cytoplasm transcription DNA translation mRNA Cell nucleus Regents Biology a a protein a a mRNA leaves nucleus through nuclear pores a a a a a a a a a ribosome a A C C A U G U C G A U C A GU A GC A U GGC A proteins synthesized by ribosomes using instructions on mRNA trait How does mRNA code for proteins? DNA mRNA TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC ? protein How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? Regents Biology mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA codons AUGCGUGUAAAUGCAUGCGCC ribosome mRNA protein Met Arg Val Asn Cys Ala Ribosomes read mRNA in blocks of 3 nucleotides called a “Codon” Regents Biology Ala How are the codons matched to amino acids? DNA mRNA tRNA amino acid TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC UAC GCA CAU anti-codon Met Arg Val Regents Biology The mRNA code Start codon AUG Stop codons UGA, UAA, UAG codon for methionine (Met) Regents Biology codon for leucine (Leu) Summarize whole process of “DNA to Proteins” transcription DNA translation a a a a a a protein mRNA a a a a a a a ribosome a A C C A U G U C G A U C A GU A GC A U GGC A tRNA Cell nucleus Regents Biology a a Cell cytoplasm trait Different view of “DNA to Proteins” aa aa aa Cell cytoplasm transcription translation aa aa aa aa aa protein aa aa aa Cell nucleus trait Regents Biology DNA transcription amino acids mRNA ribosome protein tRNA translation Regents Biology Section 8.6: Gene Expression and Gene Regulation Regents Biology The BIG Questions… How are our traits turned “on” or “off”? Regents Biology How do cells control Gene Expression? Cells turn genes “on” & “off” by controlling transcription Remember what RNA Polymerase did? Regents Biology How do cells control Gene Expression? For RNA Polymerase to do its job it has to attach to the DNA molecule Promoter - area of DNA where RNA polymerase binds. Also area where the “Gene” sequence begins. Operator – area of DNA that turns gene “on” or “off”. It’s the switch Lets take a closer look at how this Regents Biology works! Gene regulation using “lac Operon Model” The lac Operon uses a repressor protein as a stop sign until gene is ready to be made Regents Biology Do you want all your genes turned on if you just need to make one trait? NO!!!!! Eukaryotic RNA is processed before leaving nucleus. “RNA Splicing” Introns – gene segments that are cut out before mRNA leaves nucleus Exons – gene segments that attach to each other that will code for mRNA Regents Biology http://www.pbslearningmedia.or g/resource/tdc02.sci.life.gen.pro teinsynth/from-dna-to-protein/ Regents Biology