* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download 2.1.databases_intro - T
Survey
Document related concepts
Metagenomics wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Microevolution wikipedia , lookup
Gene expression profiling wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Point mutation wikipedia , lookup
Protein moonlighting wikipedia , lookup
Designer baby wikipedia , lookup
Helitron (biology) wikipedia , lookup
Gene nomenclature wikipedia , lookup
Transcript
Finding What you Need in Biological Databases Cédric Notredame Cédric Notredame (23/05/2017) Databases: Where is my Needle ? Cédric Notredame (23/05/2017) Cédric Notredame (23/05/2017) Our Scope Give you means to answer simple questions Databases are UNFRIENDLY INFORMATION DESKS Give you an idea of what is possible WHAT can you ask ? HOW can you ask it ? Cédric Notredame (23/05/2017) Outline - An Overall view - Asking a biological question to a database - Turning a question into a query - Bibliographic Databases: Medline, OMIM - Gene Databases: GenBank, LocusLink, ENSEMBL - Protein Databases: SwissProt, InterPro, Prodom - SRS Cédric Notredame (23/05/2017) Database: What is a Database ? Cédric Notredame (23/05/2017) DataBase Entries AGCTGTCGAGGGATAGGACA TATACATAAATTAATATAAT 1 entry = 1 Sequence SEQ 1 entry = 1 File = Sequence +Doc DOC SEQ DOC SEQ DOC = Flat File SEQ DOC SEQ DOC SEQ DOC Cédric Notredame (23/05/2017) SEQ DOC Database = Collection of Flat Files SEQ DOC DataBase Entries: Flat Files Accession number: 1 First Name: Amos Last Name: Bairoch Course: DEA=oct-nov-dec 2002 http://www.expasy.org/people/amos.html // Accession number: 2 First Name: Laurent Last name: Falquet Course: EMBnet=sept 2000, sept 2001;DEA=oct-nov-dec 2000; // Accession number 3: First Name: Marie-Claude Last name: Blatter Garin Course: EMBnet=sept 2000; sept 2001; DEA=oct-nov-dec 2000; http://www.expasy.org/people/Marie-Claude.Blatter-Garin.html // Cédric Notredame (23/05/2017) DataBase: Relational Databases Relational database (« table file »): Accession number Education Amos 1 Biochemistry Laurent 2 Biochemistry M-Claude 3 Biochemistry Teacher Date Involved teachers DEA Oct-nov-dec 2000 1,3 EMBnet Sept 2000, Sept 2001 2,3 Course Cédric Notredame (23/05/2017) To Summarize: What’s a database ? Collection of Data that is: •Structured Data •Searchable (index) •Updated periodically (release) •Cross-referenced (hyperlinks) -> table of contents -> new edition -> links with other db Collection of tools (software) necessary for: Searching –Updating -Releasing Data storage managment: flat files, relational databases… Cédric Notredame (23/05/2017) Database: What’s on the Menu? Cédric Notredame (23/05/2017) A large amount of information More than 1000 different databases Generally accessible through the web EBI: http://www.ebi.ac.uk/ NCBI: http://www.ncbi.nlm.nih.org Google: http://www.google.com Variable size: <100Kb to >10Gb DNA: > 10 Gb Protein: 1 Gb 3D structure: 5 Gb Other: smaller Update frequency: daily to annually Cédric Notredame (23/05/2017) A Non Exhaustive List AATDB, AceDb, ACUTS, ADB, AFDB, AGIS, AMSdb, ARR, AsDb, BIOMDB, BLOCKS, BovGBASE, BBDB, BCGD, Beanref, Biolmage,BioMagResBank, BOVMAP, BSORF, BTKbase, CANSITE, CarbBank, CARBHYD, CATH, CAZY, CCDC, CD4OLbase, CGAP, ChickGBASE, Colibri, COPE, CottonDB, CSNDB, CUTG, CyanoBase, dbCFC, dbEST, dbSTS, DDBJ, DGP, DictyDb, Picty_cDB, DIP, DOGS, DOMO, DPD, DPlnteract, ECDC, ECGC, EC02DBASE, EcoCyc, EcoGene, EMBL, EMD db, ENZYME, EPD, EpoDB, ESTHER, FlyBase, FlyView, GCRDB, GDB, GENATLAS, Genbank, GeneCards, Genline, GenLink, GENOTK, GenProtEC, GIFTS, GPCRDB, GRAP, GRBase, gRNAsdb, GRR, GSDB, HAEMB, HAMSTERS, HEART-2DPAGE, HEXAdb, HGMD, HIDB, HIDC, HlVdb, HotMolecBase, HOVERGEN, HPDB, HSC-2DPAGE, ICN, ICTVDB, IL2RGbase, IMGT, Kabat, KDNA, KEGG, Klotho, LGIC, MAD, MaizeDb, MDB, Medline, Mendel, MEROPS, MGDB, MGI, MHCPEP5 Micado, MitoDat, MITOMAP, MJDB, MmtDB, Mol-R-Us, MPDB, MRR, MutBase, MycDB, NDB, NRSub, 0-lycBase, OMIA, OMIM, OPD, ORDB, OWL, PAHdb, PatBase, PDB, PDD, Pfam, PhosphoBase, PigBASE, PIR, PKR, PMD, PPDB, PRESAGE, PRINTS, ProDom, Prolysis, PROSITE, PROTOMAP, RatMAP, RDP, REBASE, RGP, SBASE, SCOP, SeqAnaiRef, SGD, SGP, SheepMap, Soybase, SPAD, SRNA db, SRPDB, STACK, StyGene,Sub2D,SubtiList, SWISS-2DPAGE, SWISS-3DIMAGE, SWISS-MODEL Repository, SWISS-PROT, TelDB, TGN, tmRDB, TOPS, TRANSFAC, TRR, UniGene, URNADB, V BASE, VDRR, VectorDB, WDCM, WIT, WormPep, YEPD, YPD, YPM, etc .................. !!!! There Exists A Specialized Database on Almost anything you can think of Cédric Notredame (23/05/2017) A database of databases Cédric Notredame (23/05/2017) What’s on the Menu: The Art of Eating Well Always Use Fresh Data: The Latest Update of your DataBase Make Sure The DataBase is Maintained: Many Databases are poorly maintained Treat DataBases like Publications: Some Journals are Better than Others Cédric Notredame (23/05/2017) Bio-Google: How Can I Search a Database ? Cédric Notredame (23/05/2017) Searching Databases There are 2 ways to search databases SEQ DOC AGCTGTCGAGGGATAGGACA TATACATAAATTAATATAAT Cédric Notredame (23/05/2017) Text based queries: Medline, Entrez Search For « Smith AND dUTPase> Similarity Searches: BLAST Searching Databases Each database is a little kingdom… Has its own query system Has its own information structure The main databases are well documented and this documentation is available online Most databases can be searched using SRS or Entrez Cédric Notredame (23/05/2017) Databases: Asking the right Question Databases ARE NOT meant for browsing When you search a Database you must have an idea of what your Needle-in-ahay-stack looks like Cédric Notredame (23/05/2017) Databases: Asking the right Question Browsing a database is like Using your phone book in place of a dating agency… Cédric Notredame (23/05/2017) Databases: Asking the right Question Finding Data: Database Search Finding Questions: Cédric Notredame (23/05/2017) Data Mining The Kind Of Questions We Can Ask: SEQUENCE Based InterPro Any Known Domain in my Protein ??? SwissProt Any Protein like mine ??? These ARE Predictions Cédric Notredame (23/05/2017) The Kind Of Questions We Can Ask: TEXT Based Medline Who Worked on my Protein ??? SwissProt Function of My Protein ??? PDB Structure of My Protein ??? These are NOT Predictions Cédric Notredame (23/05/2017) Just like When You Google up Specific Queries give Precise Answers Cédric Notredame (23/05/2017) Medline: Who worked on my Protein ? Cédric Notredame (23/05/2017) Medline (PubMed) Cédric Notredame (23/05/2017) What is in Medline ? MEDLINE covers the fields of medicine, nursing, dentistry, veterinary medicine, the health care system, and the preclinical sciences more than 4,000 biomedical journals and More than 10 million citations since 1966 until now Contains links to biological db and to some journals nMany papers not dealing with human are not in Medline nBefore 1970, keeps only the first 10 authors ! Cédric Notredame (23/05/2017) Using Medline: Asking a question During the last Lab Meeting, I heard the word dUTPase. What can it be ? What has been published on this ? Cédric Notredame (23/05/2017) Using Medline: Asking a question Cédric Notredame (23/05/2017) Using Medline: Asking a question Cédric Notredame (23/05/2017) Using Medline: Asking a question Cédric Notredame (23/05/2017) Using Medline: Asking a question By Default, Medline Assumes you mean: Abergel AND dUTPase Cédric Notredame (23/05/2017) Using Medline: Asking a question I have found the reference I wanted. Now I want to save it so that I can use it later, For instance to Import it in ENDnote my Reference Manager Save Your Data in the Proper DataBase format Cédric Notredame (23/05/2017) Using Medline: Storing your results Cédric Notredame (23/05/2017) Using Medline: Storing your results Cédric Notredame (23/05/2017) Retrieving EXACTLY the Information that you need [AB] [AD] Restricted fields Cédric Notredame (23/05/2017) Using Medline: Storing your results AB AD Cédric Notredame (23/05/2017) Using Medline: Looking for a Review I Want to Find the LATEST REVIEW on the dUTPase. Use The Limit Option of Medline Cédric Notredame (23/05/2017) Using Medline: Looking For a Review 1-Limits Title OR Abstract Article type Cédric Notredame (23/05/2017) Language Using Medline: A Few Tips •Quoted queries (e.g. «down syndrome» ) behave as a single word, and are great to improve the relevance of your search •Adding initials to names (e.g. “Abergel C” ) (if you can) also reduces your output •Write down the PubMed Identifier (the number in the PMID field) of that interesting paper you just find. It could be very useful in your subsequent search for related items such as associated gene and protein sequences Cédric Notredame (23/05/2017) Using Medline: A Few Tips •Spelling mistakes, wrong field restrictions or Limits setting can occur. These may be the problem. •Use abstracts to enlarge your vocabulary and look for synonyms: some papers on dUTPase might use dUTP pyrophosphatase instead! •The “related papers” button (on the extreme right of the PubMed output). Try it from time to time, to enlarge a search that is not giving you enough references Cédric Notredame (23/05/2017) Using Medline: A Few Tips •Storing your PDFs, •Memory is cheap, access is sometimes strange… •Storing your favourite PDF is a good idea •Which name on your disk? •THE MEDLINE ID NUMBER !!! •With a reference manager like EndNote Cédric Notredame (23/05/2017) Cédric Notredame (23/05/2017) GenBank: What is the Sequence of my Gene ? Cédric Notredame (23/05/2017) GenBank: an Overview Cédric Notredame (23/05/2017) GenBank: an Overview Cédric Notredame (23/05/2017) GenBank: an Overview EMBL, GenBank and DDBJ are the same database. They are synchronized every day. GenBank EMBL DDBJ Cédric Notredame (23/05/2017) GenBank: an Overview GenBank contains EVERY piece of DNA that has been sequenced and made publicly available. It contains GOOD and BAD data There is a Historical Aspect in the GenBank data: -Complex Genes are spread in many entries: Cédric Notredame (23/05/2017) GenBank Entries Are Complex because Genes are complex Prokaryotic Example Gene Promoter RBS ATG STOP mRNA ORF Protein Cédric Notredame (23/05/2017) GenBank Entries Are Complex because Genes are complex Gene Protein (form1) mRNA (form1) Promoter exon exon exon exon exon exon mRNA (form2) Protein (form2) Cédric Notredame (23/05/2017) Using GenBank: Asking a question What is the Sequence of the E. Coli dUTPase ? Cédric Notredame (23/05/2017) Using GenBank: Asking a question The Naive Way Escherichia coli dUTPase This search reports EVERY GenBank entry that contains these two words. Most Bacterial Genomes Entries (annotated by similarity) Contain these two words Cédric Notredame (23/05/2017) Using GenBank: Asking a question The Right Way Escherichia coli[organism] dUTPase[definition] Cédric Notredame (23/05/2017) Using GenBank: And There Is Plenty More where It comes from… GenBank Is Redundant: If a Gene is published more than once, Each publication gets its own entry This can mean MANY ENTRIES if you have SNPs or ESTs Cédric Notredame (23/05/2017) Header Contains all the practical Information Cédric Notredame (23/05/2017) Features Contains Experimental Information and Predictions Cédric Notredame (23/05/2017) Extra Gene This is common in GenBank entries Cédric Notredame (23/05/2017) Using GenBank: Asking a question What is the Sequence of the E. Coli dUTPase ? What is the Sequence of the Human dUTPase ? Cédric Notredame (23/05/2017) Using GenBank: Finding the Human dUTPase 1-Request Limits 2-Check box here to exclude ESTs Cédric Notredame (23/05/2017) Using GenBank: Finding the Human dUTPase The Gene does NOT appear in a single entry Cédric Notredame (23/05/2017) Using GenBank: Finding the Human dUTPase Cédric Notredame (23/05/2017) Using GenBank: Reconstructing your gene Cédric Notredame (23/05/2017) Some Good News… -This Information is complicated because it is RAW Information -It is necessary to keep UNINTERPRETED Experimental Information available -There are SIMPLER alternatives to using this RAW Information: -Gene Centric Databases -Protein Databases Cédric Notredame (23/05/2017) RefSeq/LocusLink: What Is There To know about This Gene? Cédric Notredame (23/05/2017) Using LocuLink Cédric Notredame (23/05/2017) Using LocusLink: Asking a question What Can I find about the DUT Gene ? Cédric Notredame (23/05/2017) Enter Gene name Select LocusLink Cédric Notredame (23/05/2017) Using LocusLink: Asking a question about a Gene Cédric Notredame (23/05/2017) Using LocusLink: Asking a question about a Gene Cédric Notredame (23/05/2017) OMIM: Is There A disease Associated to This Gene? Cédric Notredame (23/05/2017) OMIM: Finding Out About The Phenotype of a Gene Cédric Notredame (23/05/2017) OMIM: Finding Out About The Phenotype of a Gene OMIM™: Online Mendelian Inheritance in Man A catalog of human genes and genetic disorders Contains a summary of literature, pictures, and reference information. It also contains numerous links to articles and sequence information. Cédric Notredame (23/05/2017) OMIM: Finding Out About The Phenotype of a Gene Cédric Notredame (23/05/2017) NCBI-GENOME: What is the Context of my Gene In Its Genome? Cédric Notredame (23/05/2017) NCBI-GENOME Cédric Notredame (23/05/2017) NCBI-GENOME: The Virus Section Cédric Notredame (23/05/2017) NCBI-GENOME: The Virus Section Cédric Notredame (23/05/2017) NCBI-GENOME: The Bacteria Section Cédric Notredame (23/05/2017) NCBI-GENOME: The Bacteria Section Cédric Notredame (23/05/2017) ENSEMBL: Where is my Gene in the Human Genome (who are its neighbors) ? Cédric Notredame (23/05/2017) Using ENSEMBL Cédric Notredame (23/05/2017) My Gene: A Summary Cédric Notredame (23/05/2017) Gathering Everything you need on a gene GenBank: What is the Sequence ? LocusLink: What about this Gene? ENSEMBL: What is the Context? MEDLINE: Are There Papers? OMIME: Are There Illnesses? Cédric Notredame (23/05/2017) SwissProt: What Do We Know About My Protein ? Cédric Notredame (23/05/2017) The Protein Databases GenBank: A Big Bag of DNA PREDICTION + EXPERIMENT Generic Non Redundant Protein Databases NR trEMBL Specialized Protein Databases SwissProt PIR Cédric Notredame (23/05/2017) What Is SwissProt ? Cédric Notredame (23/05/2017) What Is SwissProt ? Fully-annotated (manually), non-redundant, crossreferenced, documented protein sequence database. ~100 ’000 sequences from more than 6’800 different species; 70 ’000 references (publications); 550 ’000 crossreferences (databases); ~200 Mb of annotations. Collaboration between the SIB (CH) and EMBL/EBI (UK) Cédric Notredame (23/05/2017) Using SwissProt: Asking a question We hear the word EPO quite often these days, but what exactly is known about it ? Cédric Notredame (23/05/2017) Using SwissProt: Asking a question A Simple SwissProt Text Query EPO HUMAN Cédric Notredame (23/05/2017) Using SwissProt: Reading an Entry Cédric Notredame (23/05/2017) Using SwissProt: Reading an Entry Cédric Notredame (23/05/2017) Using SwissProt: Reading an Entry Cédric Notredame (23/05/2017) Using SwissProt: Reading an Entry Cédric Notredame (23/05/2017) Using SwissProt: Reading an Entry Structure Information Cédric Notredame (23/05/2017) Using SwissProt: Reading an Entry Cédric Notredame (23/05/2017) The Protein Databases GenBank: A Big Bag of DNA PREDICTION + EXPERIMENT Generic Non Redundant Protein Databases NR trEMBL Specialized Protein Databases SwissProt PIR UniProt Cédric Notredame (23/05/2017) Cédric Notredame (23/05/2017) Cédric Notredame (23/05/2017) Cédric Notredame (23/05/2017) SwissProt How Good is Good ? Cédric Notredame (23/05/2017) Cédric Notredame (23/05/2017) Cédric Notredame (23/05/2017) PDB: What is the Structure of my Protein ? Cédric Notredame (23/05/2017) PDB: The Protein Database Cédric Notredame (23/05/2017) PDB: The Protein Database Managed by Research Collaboratory for Structural Bioinformatics (RCSB) (USA). Contains macromolecular structure data on proteins, nucleic acids, protein-nucleic acid complexes, and viruses. Currently there are ~16’000 structure data for about 4’000 different molecules, but far less protein families (highly redundant) ! Cédric Notredame (23/05/2017) Using PDB: Asking a question Does tolB have a known Structure? And If the answer is Yes, How can I look at it ? Cédric Notredame (23/05/2017) Using PDB: Asking a question Query: TolB Cédric Notredame (23/05/2017) Using PDB: Viewing a Structure View Structure Cédric Notredame (23/05/2017) Using PDB: Viewing a Structure Cédric Notredame (23/05/2017) Using PDB: Viewing a Structure Cédric Notredame (23/05/2017) Using PDB: Viewing a Structure Cédric Notredame (23/05/2017) Using PDB: Downloading Data Coordinates Cédric Notredame (23/05/2017) Interpro: Are There Domains In my Protein ? Cédric Notredame (23/05/2017) Interpro: The Idea of Domains Cédric Notredame (23/05/2017) Interpro: The Idea of Domains Cédric Notredame (23/05/2017) Interpro: A Federation of Databases Cédric Notredame (23/05/2017) Using InterPro: Asking a question Which Domains does the oncogene FosB contain? Cédric Notredame (23/05/2017) Using InterPro: Asking a question Cédric Notredame (23/05/2017) Using InterPro: Asking a question Cédric Notredame (23/05/2017) Using CDsearch: Asking a question Cédric Notredame (23/05/2017) Using CDsearch: Asking a question Cédric Notredame (23/05/2017) Using Domains: Some Statistics • 10 most common protein domains for H. sapiens Immunoglobulin and major histocompatibility complex domain Zinc finger, C2H2 type Eukaryotic protein kinase Rhodopsin-like GPCR superfamily Pleckstrin homology (PH) domain RING finger Src homology 3 (SH3) domain RNA-binding region RNP-1 (RNA recognition motif) EF-hand family Homeobox domain Cédric Notredame (23/05/2017) My Protein: A Summary Cédric Notredame (23/05/2017) Gathering Everything you need on a Protein trEMBL: What is the Sequence ? SwissProt:What about the Function INTERPRO: Which Domains? MEDLINE: Are There Papers? PDB: Which Structure? Cédric Notredame (23/05/2017) SRS: Can I search Many Databases Simultaneously ? Cédric Notredame (23/05/2017) Using SRS Cédric Notredame (23/05/2017) Using SRS Cédric Notredame (23/05/2017) A Few Databases in Bulk Cédric Notredame (23/05/2017) Cédric Notredame (23/05/2017) Cédric Notredame (23/05/2017) Cédric Notredame (23/05/2017) Cédric Notredame (23/05/2017) A Few Addresses Cédric Notredame (23/05/2017) A few Databases Cédric Notredame (23/05/2017)