Download Bio1100Ch20

CHAPTER 20
DNA TECHNOLOGY AND
GENOMICS
• Recombinant DNA - genes from two different
sources - are combined in vitro into the same
molecule.
• Genetic engineering- the direct manipulation of
genes for practical purposes.
• Biotechnology -the manipulation of organisms or
their components to make useful products.
• Pre 1970s-
• microbes to make wine and cheese
• selective breeding of livestock
• Post 1970s- Move individual genes into the organism
of choice.
• DNA technology ranges from agriculture to
criminal law, but its most important achievements
are in basic research.
• One basic cloning technique begins with the
insertion of a foreign gene into a bacterial plasmid.
Fig. 20.1
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
1. The human genome project
• Human Genome Project-begun in 1990.
• Determine complete nucleotide sequence of each human
chromosome.
• An international, publicly funded consortium has
proceeded in three phases: genetic (linkage) mapping,
physical mapping, and DNA sequencing.
• The genomes of several other organisms important
to biological research have also being mapped.
• These include E. coli, yeast, fruit fly, and mouse.
• J. Craig Venter decided in 1992 to try a one-step
whole-genome shotgun approach.
Consortium’s three
stage approach
Venter’s whole
genome approach
Fig. 20.13
1. Genetic map
2. Physical map
3. DNA sequence
DNA sequence
• 1995- Venter reports the complete sequence of a
bacterium.
• 2000- Venter’s private company, Celera Genomics,
finishes the sequence of Drosophila melanogaster
• 2001-Celera and the public consortium separately
announced sequencing over 90% of the human
genome.
• By mid-2001, the genomes of about 50 species had
been completely (or almost completely) sequenced.
•Include yeast, a nematode, a plant and many bacteria
2. DNA microarrays
• Automation has allowed scientists to detect and
measure the expression of thousands of genes at
one time using DNA microarray assays.
•1000s of copies of each
gene are fixed on glass
slide
•The fragments are tested
for hybridization with
various samples of
fluorescently-labeled
cDNA molecules.
Fig. 20.14a
• Spots where any of the cDNA hybridizes fluoresce
with an intensity indicating the relative amount of
the mRNA that was in the tissue.
Expression of 3,600
genes can be tested
using a single 0.5 inch
grid
Fig. 20.14b
• Proteomics- the systematic study of full protein
sets (proteomes) encoded by genomes.
• Genomics and proteomics are giving biologists an
increasingly global perspective on the study of life.
• Bioinformatics- the application of computer science
and mathematics to genetic and other biological
information
3. What is a “bad” gene??
Most of human diversity is in the form of single
nucleotide polymorphisms (SNPs), single basepair variations.
• In humans, SNPs occur about once in 1,000 bases,
meaning that any two humans are 99.9% identical.
• The locations of the human SNP sites will provide
useful for :
• studying human evolution
• identifying disease genes
• genes that affect susceptibility to diseases,
toxins or drugs
What is a single nucleotide polymorphism?
Person 1……AGACGTAGACAGATCGTCCCAGAGATTAG
AGGACATGGACAGAGATGGCAGAGCTCTCTCT
TTTAGAGTACATGATACGATACAGATCAGATCA
GATACGATACAGTACAGTAGATACGATATACAGF
AGACTAGCAGTAGACGATRGACGTCTCGCGCG
CGCGCGATCGTAGCTGATCGATGCAGTCAGT…..
Person 1……AGACGTAGACAGATCGTCCCAGAGATTAG
AGGACATGGACAGAGATGGCAGAGCTCTCTCT
TTTAGAGTACATGATACGAGACAGATCAGATCA
GATACGATACAGTACAGTAGATACGATATACAGF
AGACTAGCAGTAGACGATRGACGTCTCGCGCG
CGCGCGATCGTAGCTGATCGATGCAGTCAGT…..
Perhaps person , but not person 2 is predisposed to breast cancer
What is gene therapy?
How successful is gene therapy?
How was the constortium’s approach to human genome
sequencing different from Craig Venter’s approach?
10,000 bp of DNA
4. Gene Therapy
• Techniques for gene manipulation hold great
potential for treating disease by gene therapy.
• A normal allele is inserted into somatic cells of a tissue
affected by a genetic disorder.
• Despite “hype” in the news media over the past
decade, there has been very little scientifically
strong evidence of effective gene therapy.
• Even when genes are successfully and safely transferred
and expressed in their new host, their activity typically
diminishes after a short period.
• One death in 1999 completely halted US trials
• Gene therapy poses many technical questions.
• Right amount at right time
• What if transferred gene inserts into a required gene?
• Ethical and social questions.
• Some critics suggest that this tampering is wrong.
• Will it lead to eugenics?
• should we treat human germ-line cells to correct the
defect in future generations.
5. DNA technology in forensics
• Violent crimes- blood, semen, or traces of other
tissues may be left at the scene
• blood type or tissue type can only exclude a suspect.
• DNA fingerprints can be used forensically to
presence evidence to juries in murder trials.
Fig. 20.17
6. DNA technology in environmental applications
• Genetically engineered microbes that can extract
heavy metals from their environments - cleaning up
highly toxic mining wastes.
• New microbes that can degrade other harmful
compounds are being engineered.
7. DNA technology in agriculture
•Transgenic organisms with genes from
another species –to grow faster or larger
Pharmaceutical “factories” – human insulin
produced in pigs
Fig. 20.18
• Genetic engineering is quickly replacing traditional
plant-breeding programs.
• 50% of American soybeans and corn grown from
genetically modified seeds.
• Contain genes for resistance to weed-killing
herbicides or to infectious microbes and pest insects.
• Gene transfer to improve the nutritional value of
crop plants.
•Introduce B-carotene (a vitamin A
precursor) into transgenic rice to
prevent vision impairment in third
world
Fig. 20.20
8. DNA technology raises important safety
and ethical questions
• The power of DNA technology has led to worries
about potential dangers.
• Create hazardous new pathogens?
• AIDS virus?
• Many countries carefully monitor laboratories
• Accidental release
• Bioterrorism
• Is the Saddam Hussein regime in Iraq a threat?
• Recent anthrax-by-mail scheme
• Small pox
• Most public concern centers on genetically
modified (GM) organisms used in agriculture.
• “GM organisms” have acquired one or more genes
(perhaps from another species) by artificial means.
• Genetically modified animals are still not part of our
food supply, but GM crop plants are.
• In Europe, safety concerns have led to pending new
legislation regarding GM crops and bans on the import
of all GM foodstuffs.
• In the United States and other countries the labeling of
GM foods is now being debated.
• To date there is little good data either for or against any
special health or environmental risks posed by
genetically modified crops.
• As with all new technologies, developments in
DNA technology have ethical overtones.
• Who should have the right to examine someone else’s
genes?
• How should that information be used?
• Should a person’s genome be a factor in suitability for a
job or eligibility for life insurance?
• The power of DNA technology and genetic
engineering demands that we proceed with
humility and caution.