* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download The elabration of RAMD-PCR assay for detection of a
DNA barcoding wikipedia , lookup
Gel electrophoresis wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Maurice Wilkins wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Point mutation wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Non-coding DNA wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
DNA supercoil wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Molecular cloning wikipedia , lookup
Molecular evolution wikipedia , lookup
Deoxyribozyme wikipedia , lookup
PCR assay of intragenic mutation lesions induced by monoenergetic fission neutrons and gamma rays in Drosophila Part I: Gamma rays Dr Igor Donatovich Alexandrov Genetic Group Laboratory of Nuclear Problems Nanette Brand1 Nonhlanhla Ngwenya2 1Stellenbosch University, 2University of Pretoria, South Africa Goal To detect the quality and frequency of neutron-induced mutational lesions in comparison to gamma ray-induced ones for different genes of Drosophila using PCR assay Our aim: To study the molecular genetic action of gamma rays (60Co) on the black mutant of Drosophila Polymerase Chain Reaction The polymerase chain reaction (PCR) is a technique for the in vitro amplification of specific sequences of DNA PCR allows the detection of different kinds of mutational changes within fragments, deletions locations PCR result can be positive or negative Model of study A B Drosophila melanogaster (A) Wild type, (B) Black mutant Well studied example, gene structure known Has common principal DNA structure with humans Short life cycle (~15 days) Permits the study of heritable gene mutation Black gene structure A 5’ DNA Ex1 Ex2 In 1 Ex3 DNA 3’ In 2 ’ B F1 R1 F3 R3 Fragment 1 Fragment 3 F2 R2 Fragment 2 A. Physical map of black gene showing introns (In 1-2) and exons (Ex 1-3). B. Sizes and location of the black gene fragments studied with forward (F) and reverse (R) primers Primer sequence for PCR Fragment 1 2 3 Primer Primer sequence F1 aggtgagatcggcacctg R1 ttggctgcaatggggcactcac F2 acaacactcgcccgagtcca R2 acactgttgcaggcagc F3 tggttgctcatttcgaggggt R3 tcccagttcccaaggcaaggac Annealing temperature (○С) Size of the PCR product (bp) 64 1068 Size of the overlap fragment (bp) 45 64 1043 99 64 859 Methods DNA isolation PCR assay Gel electrophoresis (DNA analysis) Results 22 black mutants studied 66 PCR assays performed Deletion of 2 fragments for 1 black mutant was detected 21 black mutants have a small DNA alterations not detected by PCR Electrophoresis 1 2 3 4 5 6 7 8 9 10 Conclusion Gamma rays induce mostly small DNA alterations which cannot be detected by PCR This study serves as a basis for a study of the molecular genetic action of neutrons Acknowledgements Dr I. Alexandrov, Dr M. Alexandrova and Liliana Namolovan Co-presenter Thank You for Your attention Protocol for DNA Isolation Homogenization of tissue Binding of DNA with sorbent Purification step Purified DNA 1 2 3 4 5 6 7 8 9 10 Lane 1-3 = 1st fragment, Lane 4, 5 & 7 = 2nd fragment, Lane 8-10 = 3rd fragment and Lane 6 = DNA marker