* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Slide 1
Histone acetyltransferase wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Gene expression programming wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Epigenetics in learning and memory wikipedia , lookup
Nutriepigenomics wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Long non-coding RNA wikipedia , lookup
Gene expression profiling wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Epigenetics of diabetes Type 2 wikipedia , lookup
Epigenetics in stem-cell differentiation wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Gene therapy of the human retina wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Point mutation wikipedia , lookup
Mir-92 microRNA precursor family wikipedia , lookup
Characterization and mutation of sumoylation sites within ZBP-89 M. Bruce, M. Salmon and Z. Zehner HHMI Presentations 2007 Vimentin An intermediate filament protein Expressed early in development and turned off in the differentiation of many cell types such as muscle & neural cells Found expressed in most metastatic tumor cells! Regulatory Elements for the Vimentin Gene STAT3 ASE c-Jun/Fos AP-1 ZBP89 ZBP -89 ZBP -89 PS PS PS Sp1/ Sp3 GC#1 RESULT GC-box #1 binds Sp1 & is required to activate vimentin gene expression. ZBP-89 binds the PS elements and represses vimentin expression. STAT3 and c-Jun bind upstream elements and overrides ZBP-89 repression ZBP-89 Known Bifunctional Transcription Factor transcriptional activator p21 transcriptional repressor Vimentin Zinc Finger Motif binds DNA Sumo site 1 Acidic Region Sumo site 2 Sumo sites 3&4 Zinc Finger Serine Rich region Propose: ZBP-89 functions as a repressor when one or more of its four sumoylation sites are sumoylated ZBP-89: As an Activator ZBP-89 activates P21 by binding to it promoter site and complexes to SP1 -Recruits p300, a histone acetyltransferase -Promotes acetylation -Opens chromatin so genes are transcribed Bai and Merchant , JBC, 1999. ZBP-89: As a repressor Binds to Vimentin promoter (3 known sites) TSA Recruits HDAC 1 to the vimentin promoterRepresses vimentin gene expression via Histone H3 and H4 de-acetylation HDAC 1 ZBP-89 Vimentin proximal promoter Wu, Zhang, Salmon, Zehner, Genes to Cell 2007. Sp1 Sumoylation A post-translational modification of proteins involving the covalent attachment of SUMO (small ubiquitinrelated modifier) to proteins and affecting biological processes Four different sumoylation sites ΨKXD/E Sites 1, 2, 4 are conserved human to rat Site 3 not conserved TKKD vs. IKKD Sumo site 1 Acidic Region Sumo site 2 K = Lysine: Site where sumo peptide added Sumo sites 3&4 Zinc Finger Serine Rich region My Experiment Mutate the Sumoylation sites in ZBP-89 This wipes out sumoylation sites allowing us to determine if this changes the function of ZBP-89 Express ZBP-89 with mutated sites in Drosophila S2 Cells lack ZBP-89 Measure expression of p21 and Vimentin Want to see if wiping out sumoylation sites affects ZBP89 promoting aspects as well as repressing My Experiment •PCR •Transformations •Plasmid Preps •Sequencing •Transfection of Cells •Assays My Experiment Is to Mutate Lys to Arg in sumoylation sites Lys gaggagacagtgaaaaatgatgaagagcag ||||||||||||..|||||||||||||||| GAGGAGACAGTGCGAAATGATGAAGAGCAG Arg tgtccctataagcgtaaagcaggaaattac ||||||||||||||| |.|||||||||||| TGTCCCTATAAGCGT-ACGCAGGAAATTAC Agtactaaagtaaaagatgagtatatggttgcag ||||||||||||..|||||||||||||||||||| AGTACTAAAGTACGAGATGAGTATATGGTTGCAG Site 1 mutation Obtained Several plasmid with this mutation Site 2 potential mutation ? Site 4 mutation Transfections &Assays Transient Calcium Phosphate Transfection Used S2 Drosophila Cells Why? Lack Sp1 and ZBP-89 B-gal Assay Serves as an internal control for differences in transfection frequency CAT Assay -Vimentin promoter fused to CAT Chloramphenical AcetylTansferase -Purpose is to determine how sumoylation affects ZBP activity -Used to measure P21 and Vimentin expression Results????? Coming soon to a theatre near you… WHO WILL COME OUT ON TOP? VIMENTIN OR P21 ??