Download C h e m g u id e –... DNA: THE GENETIC CODE

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Extrachromosomal DNA wikipedia , lookup

Gene wikipedia , lookup

Polyadenylation wikipedia , lookup

History of genetic engineering wikipedia , lookup

Nucleic acid double helix wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

Non-coding DNA wikipedia , lookup

Point mutation wikipedia , lookup

Epitranscriptome wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

RNA world wikipedia , lookup

RNA-Seq wikipedia , lookup

RNA silencing wikipedia , lookup

Primary transcript wikipedia , lookup

Nucleic acid tertiary structure wikipedia , lookup

RNA wikipedia , lookup

Non-coding RNA wikipedia , lookup

History of RNA biology wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Expanded genetic code wikipedia , lookup

Genetic code wikipedia , lookup

Transcript
C h e m g u id e – q u e s t i o n s
DNA: THE GENETIC CODE
1. The table below (taken from the Chemguide page) shows the three-base combinations used to code
for the various amino acids in messenger RNA chains.
a) What three letter combinations code for lysine (Lys) in a messenger RNA chain?
b) What three letter combinations code for glycine (Gly) in a DNA chain?
c) The messenger RNA code below is for a small part of a polypeptide chain. Identify the amino
acid sequence in this part of the polypeptide chain.
UCUAAUGCAUUGACCUCUCGUUAG
www.chemguide.co.uk