* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download C h e m g u id e –... DNA: THE GENETIC CODE
Survey
Document related concepts
Extrachromosomal DNA wikipedia , lookup
Polyadenylation wikipedia , lookup
History of genetic engineering wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Non-coding DNA wikipedia , lookup
Point mutation wikipedia , lookup
Epitranscriptome wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
RNA silencing wikipedia , lookup
Primary transcript wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
Non-coding RNA wikipedia , lookup
History of RNA biology wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Transcript
C h e m g u id e – q u e s t i o n s DNA: THE GENETIC CODE 1. The table below (taken from the Chemguide page) shows the three-base combinations used to code for the various amino acids in messenger RNA chains. a) What three letter combinations code for lysine (Lys) in a messenger RNA chain? b) What three letter combinations code for glycine (Gly) in a DNA chain? c) The messenger RNA code below is for a small part of a polypeptide chain. Identify the amino acid sequence in this part of the polypeptide chain. UCUAAUGCAUUGACCUCUCGUUAG www.chemguide.co.uk