* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download LB145-lecture16
Survey
Document related concepts
Eukaryotic transcription wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Point mutation wikipedia , lookup
Polyadenylation wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Metalloprotein wikipedia , lookup
Proteolysis wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Gene expression wikipedia , lookup
Biochemistry wikipedia , lookup
Messenger RNA wikipedia , lookup
Transfer RNA wikipedia , lookup
Epitranscriptome wikipedia , lookup
Transcript
So... why are you here? Announcements • REU: Summer research in Malibu with pay $ • Prof Peter Smith on Thursday, I’m traveling to a CF research conference. • Exam II available for 7 days so far (since Tuesday) and due in 20 days, Nov 21st • SALG feedback expires tonight, ec 2 points. • Textbook Reading: today you were to read 7 pages on Translation, take notes, study them Our goals are not achieved by only reading or listening to a lecturer—you must actively do things in order to learn (Bio or Kung Fu) QuickTime™ and a decompressor are needed to see this picture. last night’s homework (why do we have homework?) 1. Why does your textbook keeping saying "ribosome structure reflects its function"? What does that mean? Give examples. 2. Which pages of today's reading are predominately "review" of what we've discussed already weeks ago in class (and that you drew on the poster in your room)? [list page numbers] 3. What is *one* example of something in this reading that sounded really new to you, that you don't recall us discussing/learning about previously in LB145? 7 last night’s homework (why do we have homework?) 1. Why does your textbook keeping saying "ribosome structure reflects its function"? What does that mean? Give examples. 2. Which pages of today's reading are predominately "review" of what we've discussed already weeks ago in class (and that you drew on the poster in your room)? [list page numbers] 3. What is *one* example of something in this reading that sounded really new to you, that you don't recall us discussing/learning about previously in LB145? 8 last night’s homework (why do we have homework?) 1. Why does your textbook keeping saying "ribosome structure reflects its function"? What does that mean? Give examples. 2. Which pages of today's reading are predominately "review" of what we've discussed already weeks ago in class (and that you drew on the poster in your room)? [list page numbers] 3. What is *one* example of something in this reading that sounded really new to you, that you don't recall us discussing/learning about previously in LB145? 9 Ribosome mRNA Signal peptide Signal peptide removed Signalrecognition particle (SRP) CYTOSOL ER LUMEN SRP receptor protein Translocation complex ER membrane Protein last night’s homework (why do we have homework?) 1. Why does your textbook keeping saying "ribosome structure reflects its function"? What does that mean? Give examples. 2. Which pages of today's reading are predominately "review" of what we've discussed already weeks ago in class (and that you drew on the poster in your room)? [list page numbers] 3. What is *one* example of something in this reading that sounded really new to you, that you don't recall us discussing/learning about previously in LB145? 12 last night’s homework (why do we have homework?) 1. Why does your textbook keeping saying "ribosome structure reflects its function"? What does that mean? Give examples. 2. Which pages of today's reading are predominately "review" of what we've discussed already weeks ago in class (and that you drew on the poster in your room)? [list page numbers] 3. What is *one* example of something in this reading that sounded really new to you, that you don't recall us discussing/learning about previously in LB145? 13 DNA TRANSCRIPTION 3 5 RNA transcript RNA PROCESSING RNA polymerase Exon RNA transcript (pre-mRNA) Intron Aminoacyl-tRNA synthetase NUCLEUS Amino acid CYTOPLASM AMINO ACID ACTIVATION tRNA mRNA Growing polypeptide 3 A Activated amino acid P E Ribosomal subunits 5 TRANSLATION E A Codon Ribosome Anticodon Why should I care? • What real use is such a detailed understanding of how the process of Transcription or Translation works? 1. siRNAs (small interfering, silencing) miRNAs (micro) RNA interference (RNAi) 2. Design and testing of antibiotics Azithromycin Zyvox (MRSA) methicillin-resistant Staphylococcus aureus (MRSA) vancomycin-resistant Enterococcus faecium (VRE) Test your knowledge • Identify the best answer Which of the following is NOT true of a codon? A. It consists of three nucleotides. B. It may code for the same amino acid as another codon. C. It never codes for more than one amino acid. D. It extends from one end of a tRNA molecule. E. It is the basic unit of the genetic code. Which of the mutations would be most likely to have a harmful effect on an organism? A. a base-pair substitution B. a deletion of three nucleotides near the middle of a gene C. a single nucleotide deletion in middle of intron D. a single nucleotide deletion near the end of the coding sequence E. a single nucleotide insertion downstream of, and close to, the start of the coding sequence Translation: 3 parts • • • Language (AUG!) Translators (tRNA & synth) Factory (Ribosome subunits) Language (AUG!) What words are hidden in this sentence? UUAAG I AUG I GGG I UAU I AAG I UCA I ACC I UU UUAAGAUGGGGUAUAAGUCAACCUUGA What additional information do you need? ?????????? I THE I RED I DOG I ATE I THE I CAT I STOP Frameshift mutation (delete E in RED) ?????????? I THE I RDD I OGA I TET I HEC I ATS I TOP Translators (tRNA & synth) • • tRNA is a translator/transfers amino acids (Multiple types of RNA) Aminoacyl-tRNA Synthetase (Charging enzyme loads aas on tRNAs) Charging Enzymes (aminoacyl tRNA synthetases) QuickTime™ and a Animation decompressor are needed to see this picture. Factory (Ribosome subunits) • • • Small and large subunits (mix of protein & rRNA) Large subunit contains different chambers (P-peptide, A-amino acid, Eexit) Phases: Initiation, Elongation (3 steps), and Termination Initiation 3U A C 5 5A U G 3 Initiator tRNA Large ribosomal subunit P site GTP GDP E mRNA 5 Start codon mRNA binding site 3 Small ribosomal subunit 5 A 3 Translation initiation complex Amino end of polypeptide E 3 mRNA 5 P A site site Elongation 1. Codon recognition Amino end of polypeptide E 5 1. Codon recognition 3 mRNA P A site site GTP GDP Elongation E P A 2. Bond formation Fig. 17-18-3 Amino end of polypeptide E 5 1. Codon recognition 3 mRNA P A site site GTP GDP Elongation E P A E 2. Bond formation P A Fig. 17-18-4 Amino end of polypeptide E Ribosome ready for next aminoacyl tRNA 5 1. Codon recognition 3 mRNA P A site site GTP GDP Elongation E P A E P A GDP GTP 3. Translocation E 2. Bond formation P A Termination Release factor 3 5 Stop codon (UAG, UAA, or UGA) Termination Release factor Free polypeptide 3 5 5 Stop codon (UAG, UAA, or UGA) 3 2 GTP 2 GDP Termination Release factor Free polypeptide 5 3 5 5 Stop codon (UAG, UAA, or UGA) 3 2 GTP 2 GDP 3 Translation steps