Download Assignment on DNA, RNA, Transcription and Translation

Name: __________________
Section: _________________
Transcription and Translation
Objective: __________________________________________________________________________________
Analogy Story: Read the 2 stories and then compare/contrast them by answering the questions below:
Story of a Castle
Once upon a time, there were directions to build a beautiful castle. The only problem was, these directions were
locked in a library and couldn’t get out. One day, a person started to make copies of the directions. The copies
left the library to be in the world outside of the library, otherwise known as the kingdom.
The copies of the directions to build the castle couldn’t build the castle themselves, they needed workers to read
their directions and build the castle. The workers arrived to build the castle. The workers had three jobs; they
brought supplies to the castle, read the castle-building directions and put the supplies together to build different
parts of the castle.
The workers have assistants fetch the correct supplies in the kingdom. Then they read the instructions, and put the
supplies together just like the instructions said. When the workers were finished, they had a beautiful castle
before them and were happy that they had done such a good job.
DNA, Transcription and Translation Story
DNA is the directions to build our bodies. The only problem is, DNA is locked inside the nucleus of a cell and
can’t get out. To solve this problem, copies of the DNA are made in a form called mRNA. The process of
making mRNA from DNA is called transcription. After transcription, the mRNA copies leave the nucleus to be
in the part of the cell outside the nucleus, otherwise known as the cytoplasm.
mRNA can’t build a cell by itself; it needs workers to read the information coded on it and turn that information
into proteins that will make up the cell. The workers that build a cell are called ribosomes. Ribosomes have three
jobs; they bring amino acids to the mRNA, they read the mRNA code and use this code to build amino acid
chains.
The ribosomes have transfer molecules fetch the correct amino acids in the cytoplasm. Then they read the mRNA
which contains different directions, and assemble the amino acids in the right order to create a protein. The
process of turning mRNA into amino acid chains is called translation. When the workers are finished, a protein
has been created.
Questions:
1. The directions in Story 1 is like the ____________________ in Story 2.
2. The library in Story 1 is like the _______________________ in Story 2.
3. The copies of the original directions in Story 1 are like the __________________ in Story 2.
4. The workers in Story 1 are like the ____________________ in Story 2.
5. The castle in Story 1 is like the ______________________ in Story 2.
6. How were these stories alike? How were they different?
Guided Notes:
Transcription is the process that creates _____ . Translation is the process in which the _________________ read
the ______ to create ____________.
Draw a picture to show how GENES, CODONS, and BASES are related:
What does a codon do?
Who is in charge of bringing the amino acids to the ribosomes? How does this work?
How are amino acids and proteins related?
Translating proteins: Use your codon chart to translate codons into amino acids.
UAG:
AAU:
GCC:
CGGUAC:
Transcribing and Translating:
DNA: TAAGCTACCTTCGCATGGCATGCATC
RNA:
Find the start codon. Now, read the mRNA one codon at a time left to right. What is your amino acid chain?
Amino Acid Chain:
Your Turn:
DNA: ATTACCATGTGGACAACATCCT
RNA:
Amino Acid Chain: