Download Ectopic induction and reorganization of Wnt-1

Development 120, 3379-3394 (1994)
Printed in Great Britain © The Company of Biologists Limited 1994
3379
Ectopic induction and reorganization of Wnt-1 expression in quail/chick
chimeras
Laure Bally-Cuif and Marion Wassef
INSERM U106, Hôpital de la Salpêtrière, 47 Bd de l’hôpital, 75651-Paris Cedex 13, France and CNRS URA 1414, Equipe ATIPE,
Ecole Normale Supérieure, 46 rue d’Ulm, 75230-Paris Cedex 05, France (present address)
SUMMARY
When grafted ectopically into the diencephalon of a chick
host embryo, a portion of met-mesencephalon straddling the
met-mesencephalic constriction has the capacity to induce
En-2 expression in the surrounding host tissue. Subsequently, tectal and cerebellar structures, composed of both
host and grafted cells, are reconstructed in this ectopic
location at the expense of the host diencephalon. Previous
experiments indicated that the induction of En-2 was correlated with Wnt-1 expression within the graft. The aim of the
present study was: (i) to determine whether Wnt-1
expression was spatially regulated within the graft, (ii) to
investigate whether host Wnt-1-expressing cells were also
involved in the ectopic met-mesencephalic development and,
if so, (iii) to localize these Wnt-1-positive domains in relation
to the patterning of the ectopically developing met-mesencephalic territory. We studied the expression profile of Wnt1, in relation with that of other positional markers, in
quail/chick chimeras where various portions of met-mesencephalon had been grafted into the diencephalon. We found
that Wnt-1 expression was reorganized within the graft, and
that it was also induced in the host in contact with the graft.
Moreover, these ectopic expressions of Wnt-1, in both the
grafted and the surrounding host tissues, were organized in
concert to form a continuous positive line at the host/graft
junction, the location of which depended on the precise
origin of the graft. Finally, we found that this line was frequently located at the limit between territories expressing
different positional markers. We propose that Wnt-1
expression is turned on at the junction between domains of
different phenotypes, and may be used as a border to
stabilize these adjacent differently committed territories.
INTRODUCTION
A good candidate for the specification step is the product of
the Wnt-1 gene (Fung et al., 1985), the homolog of the
Drosophila wingless protein (Rijsewick et al., 1987), a secreted
protein involved in cell-cell signaling (Bradley and Brown,
1990; Papkoff and Schryver, 1990; Jue et al., 1992). Wnt-1 is
known to be expressed in the developing met-mesencephalon
of all vertebrate species studied (mouse (Wilkinson et al.,
1987), Xenopus (Noordermeer et al., 1989), and zebrafish
(Molven et al., 1991)). In the mouse embryo, expression in this
region is very dynamic (Wilkinson et al., 1987; Bally-Cuif et
al., 1992; Paar et al., 1993): it starts at the one-somite stage as
a broad domain encompassing what is probably most of the
met-mesencephalic region, and is rapidly restricted after neural
tube closure to a narrow ring of cells, located just rostrally to
the morphological constriction that separates the mesencephalic and metencephalic vesicles. Disruption of the Wnt-1
locus in the mouse, either by homologous recombination or in
the spontaneous mutation swaying (Thomas et al., 1991) leads,
since early embryonic stages, to severe brain defects, characterized by the lack of a broad domain encompassing most of
the presumptive mesencephalon and cerebellum (McMahon
and Bradley, 1990; Thomas and Capecchi, 1990; McMahon et
al., 1992). For that reason, Wnt-1 is believed to play a crucial
role in the early development of the met-mesencephalic region.
The so-called met-mesencephalic domain of the embryonic
neural tube, which comprises the mesencephalic and the first
rhombencephalic vesicles, is the region from which derive the
adult mesencephalon (colliculi in the mouse, optic tectum in
the chick) and cerebellum. Although these adult structures are
clearly distinct both in morphology and in function, the
embryonic met-mesencephalon seems to evolve as a unified
region. In particular, this entire domain, but no other region of
the neural tube, specifically expresses the homeobox-containing genes of the engrailed class, En-1 and En-2, since early
stages of neurulation (Davis and Joyner, 1988; Davis et al.,
1988; Gardner et al., 1988, Gardner and Barald, 1992).
Moreover, when grafted ectopically into the diencephalon of a
chick host embryo, portions of this domain are able to induce
in the contacted host tissue the ectopic expression of En-2
(Gardner and Barald, 1991; Martinez et al., 1991) and the
development of the missing met-mesencephalic parts
(Martinez et al., 1991). The mesencephalic and metencephalic
vesicles therefore seem to evolve in concert, at least at early
stages. How this domain is initially specified as a whole, and
later subdivided into its mesencephalic and cerebellar components, is not yet known.
Key words: Wnt-1, met-mesencephalon, quail/chick chimeras,
boundary formation
3380 L. Bally-Cuif and M. Wassef
These studies on mutant mice (McMahon et al., 1992) have
also identified En-1 as a gene whose early maintenance of
expression in mesencephalon was dependent on Wnt-1; but
later-occurring regulatory interactions in met-mesencephalon
could not be studied since the whole En-expressing domain
rapidly disappears. In particular, what role Wnt-1 plays after
its expression domain has been restricted to a narrow ring is
not known.
We and others have been studying the organization and early
development of the met-mesencephalic region in the chick
embryo in normal and experimentally manipulated animals,
exploiting the ease with which tissue transplantation is feasible
in this species (Martinez and Alvarado-Mallart, 1989; 1990;
Hallonet et al., 1990; Gardner and Barald, 1991; Martinez et
al., 1991). Using mouse/chick chimeras, we were able to show
that the Wnt-1-positive portion of mouse met-mesencephalon
always maintains its Wnt-1 expression when grafted ectopically, and is the region with the highest capacity to induce
ectopic expression of En-2 in the diencephalon of the chick
host embryo (Bally-Cuif et al., 1992). Again, these results
suggested that an early Wnt-1 expression might be implicated
in the specification of the met-mesencephalic domain. The
expression pattern of Wnt-1 in these grafts was not precisely
analyzed but seemed to be reorganized at the periphery of the
grafted tissue. Whether the normal pattern of Wnt-1 expression
was also modified in the chick host, and in particular whether
host Wnt-1-expressing cells were also participating in the
development of the ectopic met-mesencephalon, could
however not be determined due to the lack of a probe recognizing chick Wnt-1 transcripts. Similarly, whether Wnt-1
expression in and around the ectopic met-mesencephalon was
spatially organized, relative to other positional markers, was
not studied.
The aim of the present study was to explore these possibilities. We have cloned a portion of the chick Wnt-1 cDNA and
used it, together with the corresponding quail Wnt-1 cDNA
fragment (a kind gift of Marc Hallonet), to study Wnt-1 regulation in both the host and the grafted tissue during an ectopic
met-mesencephalic development. Our results indicate that the
host and the graft frequently cooperate to reconstruct a continuous line of Wnt-1-expressing cells at the host/graft
junction, which, at least in the case of metencephalic grafts,
separates two territories of different phenotypes. We hypothesize that Wnt-1-expressing cells serve as a boundary to stabilize
these grafted metencephalic portions within the surrounding
tissue.
MATERIALS AND METHODS
Embryos
We used White Leghorn chick embryos (Haas, Strasbourg, France),
and Japanese quail embryos (La Caille de Chanteloup, Corps-Nuds,
France), staged according to Hamburger and Hamilton (1951).
Cloning of 403 bp of the chick Wnt-1 cDNA
We used RT-PCR and degenerate oligonucleotides (designed by
comparing the Wnt-1 cDNA sequences of mouse (Fung et al., 1985),
Xenopus (Noordermeer et al., 1989) and zebrafish (Molven et al.,
1991)) to amplify a 403 bp fragment of the coding region. The
position of the oligonucleotides relative to the mouse sequence is
presented in Fig. 1. ClaI and XbaI restriction sites added at the 5′ end
of oligonucleotides a and b, respectively, are underlined. The
sequences are as follows:
oligo a: 5′ CCATCGATTCTGGTGGGG(C,T,G)AT(C,T,A)GT 3′
oligo b: 5′ GCTCTAGATACCCAGTGCCAGTCGGG 3′
oligo c: 5′ CAT(C,T)CC(G,A)TG(G,A)CA(C,T)TTGCA 3′
Total RNA was isolated from HH10-12 chick embryos by guanidinium thiocyanate-phenol-chloroform extraction (Chomczynski and
Sacchi, 1987). 10 µg RNA were then reverse transcribed with 50 u of
MMLV H− reverse transcriptase (Superscript, BRL), 200 pmoles
random primers (Boehringer Mannheim) and 1 mM each dNTP in 20
µl MMLV buffer (50 mM Tris-HCl pH 8.3, 75 mM KCl, 3 mM
MgCl2, 20 mM DTT) for 1 hour at 42°C. After heating at 95°C and
ethanol precipitation, cDNA prepared from 10 µg of RNA was used
in a PCR reaction (Perkin Elmer Cetus) with 100 pmoles primer a,
100 pmoles primer c and 2.5 u Taq DNA polymerase (Promega) in
50 mM KCl, 10 mM Tris-HCl pH 8.8, 1.5 mM MgCl2, 0.1% Triton
X-100, 200 µM each dNTP, according to the following schedule:
94°C for 1 minute, 40°C for 1 minute and 72°C for 1 minute per cycle
for the two first cycles, then 94°C for 1 min., 52°C for 1 minute and
72°C for 1 minute per cycle for the 28 following cycles. One thousandth of the total PCR reaction mix was then amplified again using
the same stringency conditions but with 100 pmoles primer b instead
of primer c. The final reaction product was run on a 2% agarose gel,
the band at 403 bp was excised and purified by phenol-chloroform
extraction and ethanol precipitation. The fragment was then digested
by XbaI and ClaI according to the manufacturer’s instructions and
subcloned into pBluescript KS(+) (Stratagene). The fragment was
sequenced on both strands using T7 DNA polymerase (Sequenase
version 2.0, U.S. Biochemical Corp.).
Probes
The Ch.Wnt-1 subclone (Fig. 1) was linearized with ClaI and transcribed using T7 RNA polymerase, or linearized with XbaI and transcribed with T3 RNA polymerase, to generate the antisense and sense
probes, respectively. The Pax QNR (Pax 6) subclone (Martin et al.,
1992) was linearized with EcoRI and transcribed using T7 RNA polymerase; the Cotx2 subclone (Bally-Cuif et al., in press) was linearized
with EcoRI and transcribed with T3 RNA polymerase; and the Q.Wnt1 subclone (kind gift of Marc Hallonet) was linearized with NotI and
transcribed with SP6 RNA polymerase, to generate the other antisense
probes. No signals were obtained with the corresponding sense
probes.
Grafting experiments
The experimental designs are presented in Fig. 2. After a small
opening was made in the egg, HH10-11 chick host embryos were
visualized by a sub-blastodermal injection of India ink, the vitelline
membrane was cut, and a small portion of the right-hand side of mesencephalon (A) or diencephalon (B) was removed using a bevelled
needle. Quail donor embryos of the same stage were removed from
the egg and pinched in a paraffin-containing Petri dish in Tyrodes
saline solution. The desired portion of met-mesencephalon, either
from the right (non inverted grafts) or from the left (inverted grafts)
side of the embryo, was then cut out and transported to the chick host
with a glass pipette, to replace the ablated portion of mesencephalon
or diencephalon. The dorsolateral orientation of the graft was always
respected, so that pieces taken from the left side of the embryo were
grafted with a rostrocaudal inversion. The egg was then closed with
parafilm and returned to the incubator for 48 to 72 hours after which
time the embryos were fixed and processed for whole-mount in situ
hybridization.
Single colour whole-mount in situ hybridization
Embryos were fixed by immersion overnight at 4°C in 4%
paraformaldehyde and dehydrated in methanol. For embryos older
than HH10, the neural tube was manually dissected after 1-2 hours of
Wnt-1 in met/mesencephalic grafts 3381
Fig. 1. (A) Position of the
Ch.Wnt-1 amplified fragment
(b.) relative to the mouse
Wnt-1 coding sequence (a.)
(Fung et al., 1985). The
primers a, b and c used in the
PCR reaction are indicated
(arrows). Size of cDNA
fragments are in bp.
(B) Alignment of mouse
Wnt-1 (Fung et al., 1985) and
Ch.Wnt-1 nucleotide
sequences (above), and the
corresponding amino acid
sequences of mouse Wnt-1,
Wnt-2, Wnt-3, Wnt-4 (Gavin
et al., 1990) with Ch. Wnt-1
(below). Dashes and
asterisks indicate identical
residues or gaps,
respectively. The Q.Wnt-1
corresponding fragment
shows 84% sequence identity
with Ch.Wnt-1 at the
nucleotide level, and 96% at
the protein level (Hallonet,
1993).
fixation. Whole-mount in situ hybridization was done exactly as
described (Bally-Cuif et al., 1993) except that the anti-digoxigeninalkaline phosphatase (AP) antibody was diluted 1/2000. When two
different mRNAs were detected, the two corresponding probes were
labeled with digoxigenin-UTP, added together at the same concentration (1-2 µg/ml) to the hybridization buffer and revealed using
NBT/BCIP as a substrate for alkaline phosphatase. After the colour
reaction, embryos were rinsed extensively in PBS-0.1% Tween-20
(PBT) and stored, photographed and flat-mounted in 80% glycerol in
PBT.
Staining was never observed with any sense control probe. In
addition, no signal was ever observed, under our conditions, in chick
embryos using the Q.Wnt-1 probe and vice-versa. In fact, sequence
homology at the nucleotide level was not any higher between chick
and quail than between chick and mouse Wnt-1, which do not crossreact (Bally-Cuif et al., 1992).
Double colour whole-mount in situ hybridization
Riboprobes were synthesized with incorporation of digoxigenin-UTP
or fluorescein-UTP (both from Boehringer Mannheim) in the same
conditions. Embryos were fixed, pretreated and prehybridized as previously described (Bally-Cuif et al., 1993). The two probes were
added to the hybridization buffer at the same concentration (1-2
µg/ml) and hybridization was performed overnight at 70°C. Posthybridization washes were as described (Bally-Cuif et al., 1993), and
embryos were preblocked in 10% normal goat serum (Gibco) in TBST
(1.5 mM NaCl, 0.03 mM KCl, 0.025 M Tris-HCl pH 7.5, 0.1% Tween
20) for 2 hours at room temperature. They were then incubated in
either anti-digoxigenin-AP antibody (1/2000, Boehringer Mannheim)
or in anti-fluorescein-AP antibody (1/500, Boehringer Mannheim),
depending on which probe was to be revealed first, both in 1% NGS
in TBST-2 mM levamisole overnight at 4°C. Rinses were in TBST2 mM levamisole, and AP activity was revealed using NBT/BCIP as
described (Bally-Cuif et al., 1993). After the colour had developed,
the embryos were extensively rinsed in PBT and incubated overnight
at 4°C in anti-fluorescein-AP (1/500) or anti-digoxigenin-AP
(1/2000), depending on the second probe to be revealed, in 1% NGS
in TBST-2 mM levamisole. They were then rinsed for 5 hours in many
changes of TBST-2 mM levamisole. AP activity was then revealed
using Fast Red (Bioprobe Systems), as follows: embryos were preincubated in Naphtol phosphate buffer (Bioprobe Systems)-0.1%
Tween-20 for 30 minutes, then in the same buffer containing 3 mg/ml
Fast Red powder, in the dark and in glass containers, until red colour
developed. Residual alkaline phosphatase activity from the first
reaction was generally negligible, and did not interfere with the
second colour development (see in particular Fig. 5, where the two
colors are clearly distinct).
Whole-mount immunocytochemistry
The chick or quail En-2 protein was revealed using the 4D9 monoclonal antibody (Patel et al., 1989). Immunostaining was always
performed after in situ hybridization. After AP activity had been
revealed, the embryos were extensively rinsed in PBT, and incubated
in 4D9 antibody diluted to 1/2 in PBS-2 g/l gelatin-0.25% Triton X-
3382 L. Bally-Cuif and M. Wassef
Fig. 2. Schematic representation of the grafting experiments. (A) Homotopic mesencephalic grafts: a medial portion of the right side of the
mesencephalic vesicle (black) was ablated from a HH11 chick embryo, and grafted into a HH11 quail host. Grafted embryos were analyzed at
HH14 for Ch.Wnt-1 expression. (B) Heterotopic grafts: one side of the mesencephalic (A), metencephalic (B) or met-mesencephalic
(C1,C2,C3) domains (stripes) was ablated from a HH11 quail embryo and grafted into the diencephalon of a HH11 chick host. The dorsal
midline region present in the graft was always put in contact with that of the host neural tube, so that fragments taken from the left side of the
quail embryo were grafted in a rostrocaudally inverted orientation (curved arrow). Embryos were analyzed at HH18-20.
100 (PGT) overnight at 4°C. Subsequent rinses were in PT (PBS0.025% Triton X-100), and the antibody was revealed using the peroxidase-anti-peroxidase method of Sternberger et al. (1970).
Cryostat sectioning of embryos and propidium iodide
counterstaining
After whole-mount in situ hybridization, embryos were cryoprotected
in 15% sucrose in phosphate buffer. They were then embedded in
7.5% gelatin in 15% sucrose in phosphate buffer (Canning and Stern,
1988), frozen in isopentane in liquid nitrogen at −50°C, and cryostat
sectioned at 15 µm. Sections were degelatinized for 30 minutes in
PBS at 37°C, and counterstained with propidium iodide (see Fig.
5F,G) by incubation for 30 minutes at room temperature in a 1 µg/ml
solution. Sections were then mounted in Mowiol (Calbiochem), and
quail nuclei were identified by the presence of a fluorescent red spot
corresponding to their nucleolus-associated heterochromatin.
RESULTS
Cloning of a 403 bp fragment of the chick Wnt-1
cDNA
We used degenerate oligonucleotides and two rounds of RTPCR to amplify a 403 bp cDNA fragment of the chick Wnt-1
gene (Ch.Wnt-1), corresponding to nt 285-689 of the mouse
Wnt-1 cDNA sequence (Fung et al., 1985; see Fig. 1A). After
one round of amplification using oligonucleotides a and c, a
fragment of correct size was obtained, but additional bands,
corresponding to non-specific hybridization of the primers,
were also visible. Reamplification at this stage with a nested
3′ primer (b) gave a single 403 bp fragment which corresponded in size to the cognate mouse sequence (see Fig. 1A).
This fragment was purified, subcloned into pBluescript KS(+)
and sequenced on both strands. The sequences of two
subclones obtained from two independent RT-PCR reactions
were determined and proved to be identical. The sequence of
the 403 bp fragment is given in Fig. 1B, aligned with the corresponding region of the mouse Wnt-1 cDNA (Fung et al.,
1985). The sequences are 84% identical at the nucleotide level,
and 92% at the protein level. As expected, this homology is
slightly higher than that observed between the mouse and
Xenopus (Noordermeer et al., 1989) or between the mouse and
zebrafish (Molven et al., 1991) sequences. Most of the amino
acid exchanges occurred in the same region of the protein in
these four species, indicating that they may not be of functional
importance.
The sequence comparisons (Fig. 1B), together with the
expression pattern reported below, strongly suggest that we
have indeed isolated part of the chick homolog of Wnt-1. We
have therefore used this cDNA fragment as a probe to study
the spatial regulation of Wnt-1 expression during development
of the chick embryonic neural tube, both in the normal embryo
and after experimental manipulations.
Wnt-1 in met/mesencephalic grafts 3383
Expression pattern of the Wnt-1 gene during normal
development of the chick embryonic neural tube
In a first set of experiments, we determined the spatiotemporal evolution of Wnt-1 expression in the chick embryonic
neural tube, between stages HH1 and HH35 (embryonic day 8
[E8]), by whole-mount in situ hybridization (ISH). Control
experiments at various stages on entire embryos (that is,
without dissecting away non-neural tissues) showed that Wnt1 expression was, as reported for the other species studied,
confined to the developing neural tube.
No Wnt-1 expression was detected prior to the condensation
of the first somite (HH7, 24 hour incubation), that is several
hours after the beginning of neural plate formation. Wnt-1 transcripts first appear at HH7, on the dorsal region of the anterior
neural folds, overlapping the sites of neural tube closure (Fig.
3A). At HH9 (7 somites), this expression domain has extended
posteriorly and anteriorly, and additional positive cells have
also started to appear on the lateral walls of the neural tube
(hardly visible on Fig. 3B), in a region that, based on the pattern
observed at later stages (see below at E2), we identify as the
presumptive mesencephalic vesicle. Later (HH11-12, E2, 10-15
somites), expression is detected on the dorsal midline throughout the length of the neural tube up to the presumptive diencephalon (Fig. 3C,D), but the intensity is not uniform, and
weakly positive regions in the spinal cord and metencephalic
primordia separate two sharply delimited regions of intense
staining: the mesencephalic vesicle and the rhombic lips of
rhombomere 4. Most of the mesencephalic vesicle is labelled
at this stage (Fig. 3C). The staining is more intense in the alar
than in the basal plate, except near the met-mesencephalic constriction where it forms a large ring encircling the neural tube
(Fig. 3D). Digoxigenin-labelled probes offer single cell resolution, and it is obvious at higher magnification (Fig. 4G) that the
intensity of expression in this domain is uneven: small clusters
of strongly Wnt-1-positive cells are juxtaposed to clusters of
faintly positive or negative cells. This was already suggested in
the E8.5 mouse (McMahon et al., 1992). A few patches of
strongly positive cells are also detected in the dorsal region of
the metencephalic vesicle (see Fig. 4G). At stage HH12-13 (1619 somites), Wnt-1 expression transiently extends anteriorly
into the diencephalic vesicle, which now starts to be visible
(Fig. 3E). The met-mesencephalic ring remains however the
most strongly positive region.
At E3 (HH14-15, when the neural tube is entirely closed in
its caudal part, and the characteristic diencephalic and telencephalic vesicles have developed) the Wnt-1-positive territory
is confined to a ring of cells, encircling the neural tube except
for its ventral midline, immediately rostral to the constriction
separating the met- and mesencephalic vesicles (Fig. 3F,G).
Wnt-1 expression therefore disappears very rapidly from the
anterior mesencephalon between HH12-13 and HH14. At E3,
Wnt-1 expression is also clearly detected on the dorsal midline
of the neural tube, both caudally throughout the length of the
presumptive spinal cord, up to the edge of the cerebellar plate
(the dorsal midline of which is now negative), and rostrally in
the mesencephalic and part of the diencephalic vesicles, up to
the epiphysis. Expression in the latter domain seems on wholemount stainings to consist of two parallel rows of stained cells
(Fig. 3G,H, arrows). A sharp transition from strong to weak
signal intensity is visible between the mesencephalon and diencephalic vesicles, respectively (Fig. 3H).
The same two domains of expression are found at later
stages. Expression on the edge of the cerebellar anlage progressively increases. Until E7 (HH31-32, see Fig. 3K for a E6
(HH28) embryo), the Wnt-1-positive ring encircling the
neural tube (except for the ventral midline) remains located
slightly rostrally to the met-mesencephalic constriction.
Starting at E8, expression in the met-mesencephalic ring is
progressively turned off, beginning with its lateral parts (not
shown). Expression on the dorsal midline at this stage remains
intense.
The spatiotemporal pattern of Ch.Wnt-1 expression on the
dorsal midline of the neural tube and in the met-mesencephalic
region appears similar to that observed for the mouse Wnt-1
gene at equivalent stages (Wilkinson et al., 1987; Bally-Cuif
et al., 1992; McMahon et al., 1992; Parr et al., 1993). However,
a third domain of expression was detected on the ventral
midline of the mesencephalon and part of the diencephalon in
the mouse embryo between E9.5 and at least E12.5, which we
did not see in the chick (compare Fig. 2F and I), even when
using radioactive probes (not shown). The study of Wnt-1
expression in quail embryos using a quail Wnt-1 probe (Q.Wnt1) reveals the same pattern as described in the chick at equivalent stages (not shown).
As in other species, Wnt-1 expression in chick and quail
embryos thus appears to be closely associated with the early
development of the met-mesencephalic region of the neural
tube. The avian embryo lends itself to experimental manipulations and we have subsequently analyzed the regulation of
Wnt-1 expression during the development of portions of metmesencephalon that were homotopically or heterotopically
grafted in a chick host neural tube.
The spatial restriction of Wnt-1 expression between
HH12-13 and HH14 results from down-regulation of
the gene rather than from caudal migration of
positive cells
Between HH12-13 and HH14, the met-mesencephalic domain
is the site of important cell migrations and morphogenetic
movements. To investigate whether the disappearance of Wnt1 expression in mesencephalon after stage HH13 was due to
the migration of positive cells towards the met-mesencephalic
ring, we performed the grafting experiments presented in Fig.
2A. The rostral mesencephalon of a HH11 chick embryo was
grafted homotopically into a quail embryo of the same stage
and analyzed for Ch.Wnt-1 expression at HH14 (quail Wnt-1
transcripts are not detected with the chick Wnt-1 probe). In all
cases analyzed (n=13), Ch.Wnt-1-positive cells were only
detected along the dorsal midline and not at the level of the
met-mesencephalic ring (Fig. 3J), indicating that the grafted
Wnt-1-positive cells did not migrate caudally to participate in
the Wnt-1 ring. Rather, the spatial restriction of the Wnt-1positive domain must result from the down-regulation of the
gene in most of the mesencephalic vesicle.
The subsequent series of experiments were aimed at
analyzing the regulation of Wnt-1 expression in portions of
met-mesencephalon which were ectopically grafted into more
anterior regions of the neural tube, in relation with the patterning and development of the grafted domain. For this study,
we used several positional markers, the expression of which in
normal chick (and quail, not shown) embryos will first be
described below briefly, both at the stage used for grafting
3384 L. Bally-Cuif and M. Wassef
Wnt-1 in met/mesencephalic grafts 3385
Fig. 3. Localization of Wnt-1 transcripts on whole-mounts HH7 (A),
HH9 (B), HH11 (C, dorsal view; D, lateral view), HH12-13 (E),
HH14-15 (E3) (F (lateral view),G,H (dorsal views)), E6 (K, lateral
internal view of the neural tube cut along the midline) chick
embryos, or E9.5 mouse embryo (I), and on a HH14 quail embryo
homotopically grafted at HH10 with chick mesencephalon (Fig. 2A)
and hybridized with the Ch.Wnt-1 probe (J, dorsal view). Except in
A and B, where entire embryos are shown, hybridizations were
performed on dissected neural tubes. In A-F, I and K, anterior is to
the right. In the chick embryo, expression appears on the anterior
neural folds at the level of neural tube closure (A) and scattered cells
then appear laterally (hardly visible in B, arrows). Later on,
expression covers the mesencephalic vesicle, and is more
concentrated in a ring in its caudal part (arrowhead in C-E) and in
rhombomere 4 (open arrow in C-E). A higher magnification of
expression at HH11 is presented in Fig. 4G. Transient expression is
visible in diencephalon at HH12-13 (arrow in E). Between E3 and
E8, two delimited domains of expression are seen: the metmesencephalic ring (arrowheads in F (where the left side of the ring
is visible by transparency), G,K) and the dorsal midline (arrows in
F,G,K). Expression in the latter domain appears as two parallel rows
of stained cells, and decreases between mes- and diencephalon
(arrow in H). No expression is seen on ventral midline cells, contrary
to the mouse embryo (small arrow in I). In J, the location of the graft
is delimited by the doted line. Note that Ch.Wnt-1 expression is
confined to the dorsal midline (arrow) and that no positive cells are
found at the level of the met-mesencephalic ring.
Fig. 4. Expression patterns of Wnt-1, En-2, Pax 6 and Cotx2 in the anterior chick neural tube at stages HH10-11 (A,C,E,G,H) and HH16
(B,D,F,I). The En-2 protein was detected using the mAb 4D9 (Patel et al., 1989) and whole-mount immunocytochemistry (brown in A-D), and
the other markers (Wnt-1 (A,B,G), Pax 6 (C,D) and Cotx2 (E,F)) were studied by whole-mount ISH (blue in A-G). H and I are flat-mounted
met-mesencephalic regions of embryonic neural tubes where Wnt-1 and Cotx2 transcripts were revealed by double-labeling ISH (in H, Wnt-1
expression is brown and Cotx2 red; the reverse is used in I). En-2 is expressed over the whole met-mesencephalic domain, and the location of
theWnt-1-positive ring (arrowheads in A and B) corresponds to the region of highest En-2 expression. Pax 6 transcription occurs in the alar
plate of tel- and diencephalon, and in the basal plate of rhombencephalon starting at the rhombomere 1/2 boundary. The Pax-6-negative region
is delimited by the arrows in C,D. Expression excludes the En-2-positive domain. Cotx2 is transcribed in telencephalon, diencephalon and
mesencephalon, and expression abruptly stops at the caudal end of the mesencephalic vesicle (arrowheads in E and F). Later expression in a
remnant of the tela choroidea is indicated (arrow in F). At stage HH10-11, Wnt-1 expression is uneven, and patches of positive cells are
scattered in the rostral part of the metencephalic vesicle (arrows in G). These cells (bracket in H) are Cotx2 negative. The caudal limits of Wnt1 and Cotx2 expression later become closer to one another, and are almost coincident at HH16 (I).
3386 L. Bally-Cuif and M. Wassef
(HH10-11) and at the stage when grafted embryos were
analyzed (after E3).
Expression of Wnt-1 in the normal chick neural tube
in relation to other positional markers
In the following, we will designate as ‘mesencephalic’ the
portions of tissue originating from the mesencephalic vesicle,
and as ‘metencephalic’ those originating from the metencephalic (first rhombencephalic) vesicle. ‘Met-mesencephalic’
grafts overlap the constriction that separates these two vesicles.
This nomenclature therefore only refers to morphological
landmarks, and is not related to fate map (see discussion).
The following morphological criteria and positional markers
were used to characterize specific regions of the anterior neural
tube.
Expression of En-2 is a marker of the metmesencephalic domain
We used the 4D9 monoclonal antibody (Patel et al., 1989) to
localize En-2-positive cells on whole-mount embryos. At the
stage of grafting (HH11), and as already described in previous
reports (Gardner et al., 1988; Patel et al., 1989; Martinez and
Alvarado-Mallart, 1990; Martinez et al., 1991; Storey et al.,
1992), this antibody specifically stains the mesencephalon and
metencephalic vesicles (Fig. 4A). Maximal intensity of
expression is found at the junction between these vesicles, and
staining progressively decreases as one moves from this
region, both posteriorly into the cerebellar plate and anteriorly
into the mesencephalon. As in the mouse (Bally-Cuif et al.,
1992), we found that the met-mesencephalic Wnt-1-positive
ring was located within the En-2-positive domain, coinciding
with the region of highest En-2 expression (see Fig. 4A). This
expression pattern and the relationship between Wnt-1 and En2 expressions are maintained at later stages (Fig. 4B).
Expression of Pax 6 is a marker of the diencephalon
and telencephalic territories
To identify a diencephalic or telencephalic phenotype, we used
a quail Pax 6 probe, Pax-QNR (Martin et al., 1992). This probe
was found to cross-react with the chick Pax 6 mRNAs in our
experimental conditions, and gave the same expression pattern
in both species (see Fig. 4C,D for chick embryos): at stage
HH11 (Fig. 4C) and later (Fig. 4D), Pax 6 transcripts are
detected in the alar plate of the presumptive diencephalon and
telencephalic vesicles, as well as in the basal plate of spinal
cord and rhombencephalon with a rostral limit at the rhombomere 1/2 border. These results are in agreement with
previous reports in the chick (Li et al., 1994), zebrafish
(Püschel et al., 1992) and mouse (Walther and Gruss, 1991)
embryos. Double staining for both Pax 6 and En-2 on the same
embryos indicate that the two genes are expressed in mutually
exclusive domains (Fig. 4C,D), as reported for zebrafish
(Püschel et al., 1992), with gaps expressing neither gene in the
rostral mesencephalon and caudal metencephalon, due to the
rostrally and caudally decreasing expression of En-2.
Expression of chick Otx2 (Cotx2) is a marker of the tel-,
di- and mesencephalic territories
The chick Otx2 gene, like its mouse homolog (Simeone et al.,
1992, 1993), is expressed in the anterior neural plate since the
beginning of neurulation (Bally-Cuif et al., in press). Its caudal
limit of expression, initially fuzzy, becomes more sharply
defined after approximately stage HH10, running through the
caudal portion of the mesencephalic vesicle (see Fig. 4E,F),
within the Wnt-1-positive domain, as revealed using doublelabeling whole-mount in situ hybridization (see Fig. 4G,H).
Once Wnt-1 expression becomes restricted to a narrow metmesencephalic ring, the Wnt-1-positive territory extends for
only one or two rows of cells further caudally (stage HH13,
Fig. 4I). The cerebellar plate is Cotx2-negative. Expression is
also detected after this stage in the tela choroidea (Fig. 4F,
arrow), and in rhombencephalic cells bordering the tela. We
therefore used Cotx2 expression as a marker of tel-, di- and
mesencephalic territories, as well as of choroid plexus, versus
metencephalic territories. In our experimental conditions, the
Cotx2 probe cross-reacted with the quail otx2 transcripts, and
the same expression pattern was observed in quail and chick
embryos at equivalent stages (not shown).
After an ectopic met-mesencephalic graft, Wnt-1
expression is reorganized in concert between the
grafted tissue and the surrounding host
In previous experiments (Bally-Cuif et al., 1992), we observed
that Wnt-1 expression was maintained in grafts taken from the
Wnt-1-positive region of a mouse met-mesencephalon and
placed in the diencephalon of chick hosts. In order to study
whether Wnt-1 expression was reorganized within the graft,
and whether host Wnt-1-expressing cells were also participating in the ectopic development of the grafted tissue, we
analyzed Wnt-1 expression in chimeras where various portions
of quail met-mesencephalon were allowed to develop ectopically in the anterior neural tube of a chick host (Fig. 2B). For
this study, we used the Ch.Wnt-1 and Q.Wnt-1 probes, which
do not cross-react in our experimental conditions, so that host
and graft Wnt-1 transcripts can be separately identified in the
chimeras.
Chick hosts grafted at stage HH10-11 with regions A (‘mesencephalic’ grafts), B (‘metencephalic’ grafts) or C (‘met-mesencephalic’ grafts) (Fig. 2B) were first analyzed after 2 days
for Ch.Wnt-1 expression. In all cases, chick Wnt-1-expressing
cells were found in contact with the graft (n=approx. 100). Surprisingly, in most cases (approx. 90%), the Wnt-1-expressing
host cells formed a continuous line connecting the Wnt-1positive dorsal midline with the graft (Fig. 5A, open arrow).
Wnt-1 expression on the midline thus seemed to extend anteriorly and to deviate on the grafted side compared to the contralateral side. In rare cases only (approx. 10%), these ectopic
Wnt-1-positive cells had no connection with Wnt-1-positive
dorsal midline cells (Fig. 5B). No Ch.Wnt-1-positive cells were
ever observed near a portion of telencephalon or diencephalon
grafted in the same location (n=12, Fig. 5J).
Q.Wnt-1 was expressed in the grafted tissue in almost all
embryos analyzed (98%, n=88). When both Ch.Wnt-1 and
Q.Wnt-1 were analyzed using two-color whole-mount in situ
hybridization (n=88), the quail and chick Wnt-1-expressing
regions were always found to contact each other (Fig. 5C-I).
The Q.Wnt-1-positive cells were arranged in highly regionalized patterns which depended on the type of graft.
(i) In 85% of mesencephalic (type A) grafts (n=21), Q.Wnt1 was found concentrated on one side of the graft, directly in
contact with the host tissue (see Fig. 5C-G). In 10% of cases,
no Q.Wnt-1-expressing cells were seen, and a Ch.Wnt-1-
Wnt-1 in met/mesencephalic grafts 3387
positive line was partly surrounding the graft. In the remaining
5% of cases, Q.Wnt-1 expression was very low and could not
be precisely mapped. The reorganization of Q.Wnt-1
expression was never found in non-integrated grafts. The chick
and quail Wnt-1-expressing zones, whether they were continuous (71% of cases, see Figs 5C; 6B) or adjacent to each other
(29% of cases, see Fig. 6A), always formed a narrow domain
separating the graft from the host.
(ii) In 100% of metencephalic (type B) grafts (n=36), Q.Wnt1 was regionalized within the grafted tissue as a more or less
complete circle-shaped positive region, dorsally in contact with
the host and surrounding a tissue of thin teloid appearance
(Figs 5H,I; 6C,D). Based on Wnt-1 expression in met-mesencephalon at the time of grafting (see Figs 3C,D; 4G), this
expression of Wnt-1 probably results from de novo initiation
of Wnt-1 transcription within the graft. Importantly, this
specific spatial organization of Wnt-1 expression was also
observed in non-integrated grafts (3% of cases), suggesting
that it could occur independently of the surrounding host.
When the graft was integrated, the chick host was found to participate in the formation of a complete Wnt-1-positive circle,
either through a cluster of strongly Ch.Wnt-1-positive cells on
the dorsal aspect of the circle (33% of cases) (Fig. 5I), or
through a longer line of positive cells surrounding part of the
tela (67% of cases) (Fig. 5H, 6C,D), usually caudally. In both
cases, chick and quail Wnt-1-expressing cells were in continuity with each other.
(iii) Met-mesencephalic (type C) grafts (n=31) gave more
variable results concerning Wnt-1 expression, and will be
detailed below, in relation with the localization of other phenotypic markers. Briefly, the two aspects described above for
mesencephalic and metencephalic grafts were obtained, in
various proportions depending on the exact region grafted.
(iv) When portions of diencephalon or telencephalon were
grafted into the same location (n=12), Wnt-1 expression was
only observed in the graft in one case, as scattered clusters of
positive cells, that is with no sign of reorganization (not
shown). All the other grafts (i.e. 92% of cases) were devoid of
Wnt-1-expressing cells (Fig. 5J).
In summary, in a large majority of cases, the host and the
grafted portion of met-mesencephalon were observed to
cooperate to reconstruct a continuous line of Wnt-1-expressing
cells delimiting territories within and around the grafted
region.
Identification of the territories in contact with Wnt-1positive cells during the ectopic development of
met-mesencephalic regions
Grafts of met-mesencephalon into chick diencephalon are able
to modify the phenotype of the surrounding host tissue
(Gardner and Barald, 1991; Martinez et al., 1991; Bally-Cuif
et al., 1992). To define the phenotype of both the grafted and
host structures in contact with the Wnt-1-positive cells, we
used the Cotx2, Pax 6 and En-2 markers. The most frequent
configurations are schematized in Fig. 8, and detailed observations are presented below.
Mesencephalic (type A) grafts (see Fig. 6A-B′)
The grafted tissue was in all cases En-2- (n=11) and Cotx2(n=4) positive, but Pax 6-negative (n=14), indicating that it had
maintained its original mesencephalic phenotype. Cotx2
expression was not perturbed in the grafted region (not shown).
En-2 inductions were observed in the host territory in contact
with the graft in 65% of cases (n=11) (see Fig. 6A,B), principally caudal to the graft. Pax 6 transcription was generally shut
off in the induced region (asterisk in Fig. 6A,B) and replaced
by En-2 expression, although regions of overlap between high
expression of the two genes were sometimes observed rostrally
(see Fig. 6B, double arrows). In most (80%) of the cases
showing En-2 induction, the quail/chick Wnt-1-positive line
reconstructed in the periphery of the graft ran through the En2-positive territory, separating the graft from the induced host
tissue (see Fig. 6A,B). Wnt-1-positive cells were rarely found
between En-2- and Pax 6-expressing domains laterally (20%
of cases). However, the ‘deflected’ Wnt-1-positive dorsal
midline stripe joining the graft was found to border the induced
tissue dorsally and to separate it from the contralateral Pax 6expressing cells in 50% of cases (open arrows in Fig. 6B).
Metencephalic (type B) grafts (see Fig. 6C-D′)
The grafted tissue was in most cases (71%, n=7) En-2 positive,
although at a rather low level. No induction of En-2 in the host
was ever observed around the graft. Pax 6 expression was in
most cases maintained near the graft and extended caudally to
the same limit as on the contralateral side (not shown). In all
cases studied (n=36), the dorsally located tela-like structure
bordered by Wnt-1-positive cells (stars in Fig. 6C,D) showed
faint Cotx2 expression (only visible in Fig. 6D), whereas the
rest of the graft appeared entirely Cotx2-negative. These two
structures can therefore be identified as tela choroidea and
metencephalon, respectively. In 92% of cases, Ch.Wnt-1
expression was only found to border the graft along the tela
choroidea, when the latter was in contact with the host. It was
rapidly interrupted as it reached Q.Wnt-1 expression and the
metencephalic tissue. The latter was therefore only rarely (8%
of cases) separated from Pax 6 expression by Wnt-1-positive
cells, whereas the tela choroidea was in all cases surrounded
by a combination of chick and quail Wnt-1-expressing cells.
Met-mesencephalic (type C) grafts (Fig. 7)
These grafts overlapped the constriction and were further subdivided in three categories depending on their rostrocaudal
location: as shown in Fig. 2B, C1, C2 and C3 grafts contained
approximately the same amount of tissue but a decreasing proportion of metencephalic territory.
Grafts of type C1 (n=10), which overlap the met-mesencephalic constriction but carry a large portion of metencephalon, behaved exactly as the grafts B previously described,
that is developed as a small metencephalic territory (Cotx-2−)
and tela choroidea (Fig. 7A). However, En-2 expression in the
graft was generally stronger and was induced in the surrounding host in 40% of cases. In these cases, Ch.Wnt-1 expression
was still found to border mainly the tela choroidea, although it
could surround the whole graft in some cases (Fig. 7A, small
arrows). This time Ch.Wnt-1-positive cells were found in a En2-positive environment.
Grafts of type C 2 and C3 (n=21) (Fig. 7B-D′) gave the same
results. They formed in 95% of cases two different structures,
separated by a small constriction within the grafted tissue. In
all cases, one of these structures was Cotx2-positive and the
other Cotx2-negative; their phenotype can therefore be identified as mesencephalic and metencephalic, respectively.
3388 L. Bally-Cuif and M. Wassef
Fig. 5. Expression of Ch.Wnt-1 and Q.Wnt-1 in chick embryos bearing heterotopic (Fig. 2B) grafts of quail mesencephalon (A-G),
metencephalon (H,I), or diencephalon (J). All the whole-mount preparations (A,B,I) are lateral views of dissected neural tubes, anterior to the
right, and C,H are schematic drawings of such whole-mount neural tubes, with the same orientation. In A and B, Ch.Wnt-1 transcripts (blue)
and the En-2 protein (brown) are detected. The grafts are En-2-positive and En-2 inductions are observed in the hosts (arrows). The Wnt-1positive dorsal midline (large arrow) and the ectopic Ch.Wnt-1-positive cells (open arrows) are indicated. The latter form in most cases a
continuous line joining the dorsal midline and the graft (A). In C-J, Ch.Wnt-1 (red, arrowheads) and Q.Wnt-1 (blue, open arrows) transcripts
were detected by double-labeling whole-mount ISH. The grafts in D and J are surrounded by dotted lines. C is a schematic drawing of the
neural tube of the embryo flat-mounted in D, the graft is surrounded by the black line. In D, anterior is to the top, and the dorsal midline is
indicated by the white dotted line. E is the corresponding section at the level indicated (bar in D), anterior to the top, counterstained with
propidium iodide (F,G) to visualise quail nuclei (arrows in G). The host/graft limit is indicated by the dotted arrow in E, the quail is to the right
and the chick to the left. The Ch. and Q.Wnt-1-positive domains form a continuous line (C,D), and Q.Wnt-1 transcripts are confined to the
host/graft junction (E). H is a schematic drawing of the results obtained with metencephalic grafts, and I shows one example. A ring of Q.Wnt1-expressing cells (open arrow) surrounds a tela (not visible in I, but see Fig. 6C,D), and is connected with Ch.Wnt-1-positive ectopic cells
(arrowhead) joining the host dorsal midline to the graft (not visible in I, but see Fig. 6C, D). J is a flat-mount of the grafted region in the case of
a diencephalic graft, anterior to the top. The dorsal midline is Ch.Wnt-1-positive (arrowhead). Note that the grafted tissue is Q.Wnt-1-negative,
and that no ectopic Ch.Wnt-1-positive cells are observed in contact with it.
Wnt-1 in met/mesencephalic grafts 3389
Fig. 6. Expression of Wnt-1 in and around
mesencephalic grafts (type A) (A-B′) and
metencephalic grafts (type B) (C-D′), in
relation with other positional markers. All
pictures are flat-mounts of the grafted
region in grafted embryos analyzed at
HH16. In A and D, anterior is to the top;
in B and C, it is to the right. In each case,
several markers were analyzed and
interpretations of the results are presented
in the drawings below each figure (see
key). The graft is indicated by the
continuous black line, and the cuts made
for flat-mounting the embryos are
schematized by the irregular broken line.
En-2 was detected by
immunocytochemistry (brown), and all
the other markers by whole-mount ISH
(blue and/or red). D is a double colour
ISH; Ch. and Q.Wnt-1 are red, Cotx2 is
purple. When visible, the location of the
dorsal midline is indicated by the small
arrow on the left (A) or bottom (B) of the
drawings. En-2 is induced in contact with
the graft in A and B, and a Pax-6-negative
region (asterisk) is found adjacent to the
graft, in a faintly En-2-positive region.
Dorsally, the Wnt-1-positive line often
separates an En-2-positive from a Pax-6positive territory (regions indicated by the
arrowheads in B). The induced En-2positive cells however often stradle the
Wnt-1 line anteriorly (arrows in A and B)
and laterally (when present); note, in B,
that some of these cells can express both
En-2 and Pax 6 (double arrow).
Metencephalic grafts (C,D) develop a
faintly Cotx2-positive (see D) tela-like
structure (stars in C and D), easily visible
in C which is a dark-field view. The tela is
surrounded by a combination of Ch. and
Q.Wnt-1-expressing cells, but the
metencephalon (mt) is generally not.
Cotx2 (D) and Pax 6 (C, visible in brightfield) expressions are not modified around
the grafts.
However, in contrast with grafts B and C1, a tela choroidea
developed in the metencephalic part of the graft in only 14%
of cases (Fig. 7B). The final anteroposterior (AP) orientation
observed within the grafted tissue was strictly dependent on its
AP orientation in the donor: in non-inverted grafts (Fig. 7B,D),
metencephalon developed posteriorly and mesencephalon
anteriorly, and the reverse was obtained in inverted grafts (Fig.
7C). In all cases, both parts of the graft strongly expressed En2, and En-2 was induced in the host, generally caudal to the
graft and in contact with both its metencephalic and mesen-
cephalic parts. In this type of grafts, chick and quail Wnt-1
behaved differently. In 95% of cases (n=16), Q.Wnt-1expression was found regionalized within the grafted tissue at
the junction between the metencephalon and mesencephalic
aspects of the graft, on the Otx-2-positive side, therefore
mimicking the normal met-mesencephalic pattern (see Fig.
7C,D). Ch.Wnt-1-positive cells, in contrast, surrounded part of
the graft, either its metencephalic (75% of cases) (Fig. 7B,D)
or mesencephalic (25% of cases) (Fig. 7C) component. This
choice seemed independent of the AP orientation of the graft.
3390 L. Bally-Cuif and M. Wassef
Similarly to what was observed in type A grafts, Ch.Wnt-1positive cells were located inside the En-2-positive domain
(grafted and induced), separating the graft from the host rather
than two territories expressing different markers. Again, the
En-2-positive induced territory was separated from the contralateral Pax 6-positive domain by the ‘deflected’ Wnt-1positive dorsal midline (not visible in the cases presented in
Fig. 7 since the grafts are located very close to the midline).
DISCUSSION
Wnt-1 expression in the chick embryonic neural
tube in relation with other markers and metmesencephalic fate map
We have used PCR amplification and degenerate oligonucleotides to isolate a chick Wnt-1 cDNA. Several Wnt-1-related
genes have been isolated in vertebrates (see McMahon, 1992,
for a review) and encode a family of structurally related
proteins. Our cDNA is much more homologous to mouse,
Xenopus and zebrafish Wnt-1 than the various Wnt genes are
to one another (<60%), and the expression pattern observed on
the dorsal midline and met-mesencephalic region of the chick
neural tube was very similar to that reported for Wnt-1 in other
vertebrate species (Wilkinson et al., 1987; Molven et al., 1991;
Noordermeer et al., 1989), showing that we have indeed
isolated part of the chicken homolog of Wnt-1. A surprising
feature was the absence of Wnt-1 transcripts on ventral midline
cells of mesencephalon and diencephalon, a region which, in
the mouse embryo, shows strong expression. This domain also
seems to be missing in zebrafish (see Figs 6, 7 in Molven et
al., 1991), indicating that it may either lack a relevant developmental function, or play an evolutionary recent, mammalianspecific, role.
The setting up of Wnt-1 expression in the met-mesencephalic region appears to be a highly dynamic process, as previously noted in the mouse (Bally-Cuif et al., 1992; McMahon
et al., 1992; Parr et al., 1993). A wide (although not uniform)
distribution of transcripts throughout the mesencephalic
vesicle at early stages (HH10-12) is rapidly turned into a
narrow met-mesencephalic ring, which is maintained later on.
Our homotopic quail/chick grafts (Figs 2A, 3J) indicate that
this transition most probably results from turning off the Wnt1 gene anteriorly, rather than from a caudal migration of the
mesencephalic Wnt-1-positive cells.
The occurrence of a late, spatially restricted, phase of Wnt1 expression at the met-mesencephalic junction suggests that
Wnt-1 might play a role in providing positional cues in this
location, after the met-mesencephalic domain has been
specified as a whole. Similarly, after a phase of broad
expression involved in the specification of the wing disc
(Sharma and Chopra, 1976; Couso et al., 1993), wingless
expression becomes restricted to the dorsoventral boundary of
the disc, where it plays a role in patterning the wing margin
(Phillips and Whittle, 1993; Williams et al., 1993). In met-mesencephalon, the location of the future met-mesencephalic ring
is clearly visible from stage HH10-11 onwards as a strongly
Wnt-1-positive region in the caudal part of the mesencephalic
vesicle. The rostral border of this Wnt-1-expressing domain
seems to correspond to the rostral limit of the territory participating in cerebellar development, as defined using quail/chick
chimeras (Martinez and Alvarado-Mallart, 1989; Hallonet et
al., 1990); however, at this stage, this region also contributes
to tectal structures (Martinez and Alvarado-Mallart, 1989;
Hallonet et al., 1990). The avian met-mesencephalic fate map
is not directly known at later stages. However, Itasaki et al.
(1991) showed that the local influences, which, at HH10-11,
have the capacity to modify the fate of rostral mesencephalon
grafted in the caudalmost part of the mesencephalic vesicle, are
no longer operative after HH16. This suggests that the presumptive cerebellar and tectal territories are more clearly determined and separated after HH16. The refinement of the
strongly positive Wnt-1 domain thus seems to parallel that of
the met-mesencephalic fate map. However, whether the
location of the Wnt-1-positive ring at HH16 corresponds to the
limit between the presumptive cerebellar and tectal territories
cannot be ascertained. The same conclusions hold for the
location of the caudal limit of Cotx2 expression, and we
accordingly called ‘mesencephalic’ and ‘metencephalic’ the
Cotx2-positive and -negative domains, respectively, by
reference to morphology only. However, the progressive
alignment of the caudal limit of Cotx2 expression with the Wnt1 ring, together with the observation that this limit is perturbed
in swaying (Wnt-1−) mouse mutants (Bally-Cuif et al., unpublished data), strongly suggest that Wnt-1 expression is implicated in the positioning or the maintenance of this Otx-2+/−
subdivision within the neural tube.
Fate of the grafted tissue, expression of Wnt-1 and
correlation with the induction of En-2
A possible early role of Wnt-1 in the regulation of expression
of En genes has been suggested (Bally-Cuif et al., 1992;
McMahon et al., 1992). Our results in the chick embryo add
support to this hypothesis. First, as noted in the mouse (BallyCuif et al., 1992; McMahon et al., 1992), Wnt-1 expression
overlapped with the En-1- (not shown) and En-2-positive
domains since the earliest expression of these genes. Second,
En-2 induction in our grafted embryos was closely correlated
with the presence in the graft of the caudal mesencephalic
vesicle, which contains the region of highest Wnt-1 expression
(compare grafts B and C). Together with the disappearance of
En-expressing cells in Wnt-1− mice (McMahon et al., 1992),
these results suggest the possibility of crossregulations
between Wnt-1 and En genes, reminiscent of those observed
between their Drosophila homologs wingless and engrailed
(Di Nardo et al., 1988; Heemskerk et al., 1991; Cumberledge
and Krasnow, 1993). In vertebrates, these interactions might
be involved in the specification of the met-mesencephalic
domain. However, Wnt-1 was also expressed at the host-graft
junction, near the ectopic tela choroidea, and in the ‘deviated’
dorsal midline cells, in the case of metencephalic grafts (B),
which did not induce En-2. This observation suggests that Wnt1, if implicated, is not the only factor responsible for En-2
induction, since even in a permissive environment Wnt-1expressing cells of the met-mesencephalic junction and those
of the dorsal midline and lining the tela choroidea do not have
the same inducing capacity. However, it remains possible that
the latter expression of Wnt-1 is initiated too late to influence
the diencephalic phenotype of the host. Indeed, Wnt-1
expression is turned on between the cerebellar edge and the
tela choroidea at a rather late stage in situ, compared to its
initiation at the met-mesencephalic junction.
Wnt-1 in met/mesencephalic grafts 3391
The factors governing the directionality of the En-2 inductions remain elusive at present. As already reported (Martinez
et al., 1991; Gardner and Barald, 1992), although a few En-2positive cells were often found anterior to met-mesencephalic
grafts, En-2 expression was mostly induced caudally and with
a rostrocaudally decreasing gradient. From these previous
reports, however, it could not be concluded whether or not the
directionality of En-2 induction was due to the AP orientation
of the graft, since in the previous reports either this orientation
was not precisely determined (Gardner and Barald, 1992) or
the grafts were themselves rostrocaudally inverted (Martinez
et al., 1991). It is known that rostrally directed inductions can
be produced when rostrocaudally inverted mesencephalic
vesicles are grafted into mesencephalon (Marin and Puelles,
1994), and that En-2-inhibitory factors are present near the
mes/diencephalic junction (Itasaki et al., 1991), suggesting that
environmental influences might be important to restrict the
extent of induction in the anterior neural tube. The use of positional markers in our study allows us to conclude (1) that a
graft straddling the met-mesencephalic constriction and placed
in diencephalon always maintains its intrinsic rostrocaudal
polarity and (2) that the directionality of En-2 induction does
not depend on the AP orientation of the graft, but rather on surrounding polarizing influences.
The fate of the caudal mesencephalon varied depending on
which met-mesencephalic domain it was grafted with: it
developed a metencephalic phenotype when associated with
caudal regions (case C1) and a mesencephalic phenotype when
associated with rostral regions (case A). This indicates that this
region of the neural tube is at least bipotent, and that the choice
governing its fate depends on rostral and caudal influences
from the surrounding tissues. This is in agreement with the
results obtained by Martinez and Alvarado-Mallart (1990) and
Alvarado-Mallart et al. (1990), showing that rostrocaudally
inverted mesencephalic grafts can regulate their fate according
to the A/P orientation of the environment.
Wnt-1 expression is induced or maintained
ectopically in the host in contact with a grafted
portion of met-mesencephalon
Our results indicate that ectopic Wnt-1-expressing host cells
are always found in contact with a grafted portion of met-mesencephalon. Whether this results from a de novo induction of
Wnt-1 in contact with the graft, or from the stabilization of the
transient diencephalic Wnt-1 expression near the graft, is not
known. The fact that these Wnt-1-expressing host cells are very
rarely found in isolation, but are in most cases connected with
dorsal midline cells through a continuous positive line, is
puzzling. Diencephalic or telencephalic grafts placed in the
same location do not have the same effect, demonstrating that
this line is not due to mechanical distortion of the dorsal
midline during grafting. Moreover, experiments where the
grafted tissue was placed very laterally in the diencephalon,
without cutting the dorsal midline, showed the same midline
‘deviation’ (not shown). Met-mesencephalic grafts are known
to modify the surrounding host. It is therefore possible that they
create in the host a new morphogenetic field within the diencephalic domain, and that Wnt-1 expression is induced as a
result of discontinuities in positional values. The midline of the
neural tube might dorsally limit the field of influence of the
grafts. A continuous region of discontinuity in positional
values, joining the dorsal midline and the graft, might therefore
be created in the host, and Wnt-1 expression induced in this
location. The exact ‘phenotype’ of the ectopic Wnt-1-positive
cells is not clear: because their presence is not correlated with
En-2 induction, it appears more likely that they have dorsal
midline properties, rather than met-mesencephalic characteristics. However, as will be discussed below, they are sometimes
positioned as a border between territories of different phenotypes, which is reminiscent of the met-mesencephalic Wnt-1expressing cells. It would be interesting to compare the
location of these cells with that of known dorsal midline
markers.
Wnt-1 expression is reorganized in concert between
the host and the graft to border specific metmesencephalic domains
The spatial pattern of Wnt-1 expression within the grafted
tissue corresponded precisely to the origin and fate of the graft:
around the tela choroidea for metencephalic grafts, between the
metencephalon and mesencephalic regions for met-mesencephalic grafts, and on the edge of the grafted tissue for mesencephalic grafts. A constant feature, however, was the participation of host Wnt-1-expressing cells to complete or reinforce
this pattern, so that a continuous Wnt-1-positive line was
formed. We have recently observed in the swaying Wnt-1−
mouse mutants that Wnt-1 expression was necessary boundary
formation between mesencephalon and metencephalon, and
between metencephalon and choroid plexus (Bally-Cuif et al.,
unpublished data). In the case of our grafting experiments, the
ectopically organized Wnt-1 line might also mark the location
of a boundary between differently developing territories. The
observation, further discussed below, that it is frequently found
between regions expressing different markers, argues in favor
of this interpretation.
In the case of mesencephalic or met-mesencephalic grafts,
the ‘deviated’ Wnt-1-positive dorsal midline was frequently
found to separate the grafted and induced En-2-positive
territory from the contralateral Pax 6-positive domain. In some
cases, the anterior host/graft junction almost corresponded to
the limit between En-2 and Pax 6 expressions; but a few En2-positive cells were generally found to straddle the Wnt-1 line.
Interestingly, En-2 and Pax 6 were generally coexpressed in
these cells. By analogy with engrailed and cubitus interruptusD expressions at the AP boundary of the Drosophila wing disc
(Blair, 1992), it is therefore possible that these En-2-positive
cells do not necessarily correlate with the future development
of a met-mesencephalic phenotype, and that the Wnt-1 line
indeed separates two domains that will evolve as different
structures. The study of grafted embryos at later stages would
help to resolve this point. In the case of metencephalic grafts,
the Wnt-1-positive line was always found to separate Cotx-2positive and -negative territories. These observations, in particular in the case of metencephalic grafts, indicate that Wnt-1
expression can be ectopically turned on at the junction between
territories of different specification. This is strongly reminiscent of the Drosophila wing imaginal disc system, where
ventral-type cells become surrounded by margin structures
when they are artificially induced within the presumptive
dorsal territory of the disc (Diaz-Benjumea and Cohen, 1993).
Whether this expression of Wnt-1 plays some active role in
the development of the territories artificially placed in contact
3392 L. Bally-Cuif and M. Wassef
cannot be directly concluded from our experiments. Several
expression might be more generally induced at the junction
arguments, based on the study of Wnt-1− mutant mice, however
between rostral metencephalon or choroid plexus and a region
suggest that this is the case, at least for metencephalic grafts.
of different specification, and be involved in stabilizing this
First, in the Wnt-1neo mutants, the metencephalic tissue starts
metencephalic domain. This proposal would be in keeping with
to degenerate when it gets in contact with rostral mesenthe general mechanism proposed by Meinhardt (1983), who
cephalic or diencephalic regions
(McMahon et al., 1992), after the caudal
mesencephalon has been deleted. This
observation suggests that some stabilizing factors, normally present in the
caudal mesencephalon, are required to
allow cerebellar development, factors
that cannot be restored in the absence of
Wnt-1. It is therefore tempting to
speculate that the Wnt-1 protein itself
might be the factor exerting this stabilizing function, in situ and more
generally in the case of our ectopic
metencephalic grafts. Second, the
metencephalic domains that induce a
Wnt-1 line in their contact when ectopically grafted are those that are preferentially affected in the Wnt-1− mutants
(see McMahon et al., 1990; Thomas and
Capecchi, 1990), being either deleted
(rostral cerebellum) or abnormally
patterned (edge of the tela choroidea)
(Bally-Cuif et al., unpublished data).
For example, in type B grafts, Wnt-1expressing cells were found to surround
the tela choroidea, but not the cerebellar tissue, and it is known that the lateral
and caudalmost parts of the cerebellum
can be maintained in some Wnt-1−
mutants (Thomas and Capecchi, 1990;
Thomas et al., 1991) whereas the edge
of the tela is always abnormal (BallyCuif et al., unpublished data). Also,
when portions of presumptive rostral
cerebellum are grafted together with the
metencephalic vesicle (type C1), Wnt-1
expression can be found to surround
part of the metencephalic tissue and not
only the tela (see Fig. 7A). Likewise,
rostral cerebellum always disappears in
the Wnt-1− mutants. Taken together,
these observations suggest that the
induction of Wnt-1 expression plays an
active role in the development of our
grafts, possibly by providing them with
Fig. 7. Expression of Wnt-1 in and around met-mesencephalic grafts of type C1 (A,A′) and
stabilizing cues.
C2/C3 (B-D′), in relation with other positional markers. The symbols used and the key are the
same as in Fig. 6. Grafts of type C1 behave identically to metencephalic grafts, but inductions
In the normal embryo, Wnt-1 is
of En-2 can be observed (arrow in A). Ch.Wnt-1-expression bordering the tela and, in this
expressed between metencephalon and
case,
most of the graft, is indicated (small arrows); these cells are within the En-2-positive
mesencephalon, and between metendomain. Grafts of type C2/C3 can be divided into a Cotx2-positive (mesencephalon, ms) and a
cephalon and choroid plexus, and our
Cotx2-negative (metencephalon, mt) part, separated by Q.Wnt-1-expressing cells (see C,D).
study of the swaying mice (Bally-Cuif
In C, but not in B and D, the graft was placed in the host with a rostrocaudally inverted
et al., unpublished data) indicates that it
orientation; note that this orientation has been maintained. In rare cases, choroid plexus is
is implicated in maintaining the spatial
formed (star in B). En-2 expression is induced in all cases around the graft (arrows in B-D),
integrity of these domains. From the
sometimes straddling the Wnt-1-positive line anteriorly (double arrow in B). In D, the brown
results presented in this paper, we
line within the metencephalic domain is a fold of the tissue, which was flat-mounted in
would like to propose that Wnt-1
double thickness.
Wnt-1 in met/mesencephalic grafts 3393
Fig. 8. Schematic representation of the results obtained with heterotopic grafts (Fig. 2B). The expression of the different markers (see key) is
represented at the time of grafting (left panel) and at the time of analysis in the grafted region (right panel). The graft is surrounded by a black
line. Case C2/C3 represents a rostrocaudally inverted graft. The dorsal midline is to the left, between the two Ch.Wnt-1-positive lines.
suggested that the juxtaposition of differently specified territories leads to the establishment of signalling boundaries implicated in patterning the adjacent domains.
We wish to thank P. Charnay and C. Goridis for their critical
reading of the manuscript, E. Boncinelli for providing the c-otx2
probe, M. Hallonet for the Q.Wnt-1 probe and S. Saule for the Pax
QNR probe. We are also grateful to C. Goridis and to the members of
his group for providing laboratory facilities and advice for the cloning
of the Ch.Wnt-1 cDNA. Finally, we are greatly indebted to B. Cholley
for expert help in setting up the double labeling in situ hybridization
procedure.
REFERENCES
Alvarado-Mallart, R-M., Martinez, S. and Lance-Jones, C. C. (1990).
Pluripotentiality of the 2-day-old avian germinative neuroepithelium. Dev.
Biol. 139, 75-88.
Bally-Cuif, L., Alvarado-Mallart, R-M., Darnell, D. K. and Wassef, M.
(1992). Relationship between Wnt-1 and En-2 expression domains during
early development of normal and ectopic met-mesencephalon. Development
115, 999-1009.
Bally-Cuif, L., Goridis, C. and Santoni, M-J. (1993). The mouse NCAM gene
displays a biphasic expression pattern during neural tube development.
Development 117, 543-552.
Bally-Cuif, L., Gulisano, M., Broccoli, V. and Boncinelli, E. c.otx2 is
expressed in two different phases of gastrulation and is sensitive to retinoic
acid treatment in chick embryo. Mech. Dev., in press.
Blair, S. S. (1992). Engrailed expression in the anterior lineage compartment of
the developing wing blade of Drosophila. Development 115, 21-33.
Bradley, R. S. and Brown, A. M. C. (1990). The proto-oncogene int-1 encodes
a secreted protein associated with the extracellular matrix. EMBO J. 9, 15691575.
Canning, D. R. and Stern, C. D. (1988). Changes in the expression of the
carbohydrate epitope HNK-1 associated with mesoderm induciton in the
chick embryo. Development 104, 643-655.
Chomczynski, P. and Sacchi, N. (1987). Single-step method of RNA isolation
by acid guanidinium-thiocyanate-phenol-chloroform extraction. Anal.
Biochem. 162, 156-159
Couso, J. P., Bate, M. and Martinez-Arias, A. (1993). A wingless-dependent
polar coordinate system in Drosophila imaginal discs. Science 259, 484-489.
Cumberledge, S. and Krasnow, M. A. (1993). Intercellular signalling in
Drosophila segment formation reconstructed in vitro. Nature 363, 549-552.
Davis, C. A. and Joyner, A. L. (1988). Expression patterns of the homeoboxcontaining genes En-1 and En-2 and the proto-oncogene int-1 diverge during
mouse development. Genes Dev. 2, 1736-1744.
Davis, C. A., Noble-Topham, S. E., Rossant, J. and Joyner, A. L. (1988).
Expression of the homeobox-containing gene En-2 delineates a specific
region in the developing mouse brain. Genes Dev. 2, 361-371.
Diaz-Benjumea, F. J. and Cohen, S. M. (1993). Interaction between dorsal
and ventral cells in the imaginal disc directs wing development in
Drosophila. Cell 75, 741-752.
Di Nardo, S., Sher, E., Heemskerk-Jongens, J., Kassis, J. A. and O’Farrell,
P. H. (1988). Two-tiered regulation of spatially patterned engrailed gene
expression during Drosophila embryogenesis. Nature 332, 604-609.
Fung, Y. K. T., Shackleford, G. M., Brown, A. M. C., Sanders, G. S. and
Varmus, H. E. (1985). Nucleotide sequence and expression in vitro of
cDNA derived from mRNA of int-1, a provirally activated mouse mammary
oncogene. Mol. Cell. Biol. 5, 3337-3344.
Gardner, C. A., Darnell, D. K., Poole, S. J., Ordahl, C. P. and Barald, K. F.
(1988). Expression of an engrailed-like gene during development of the early
embryonic chick nervous system. J. Neurosci. Res. 21, 426-437.
Gardner, C. A. and Barald, K. F. (1991). The cellular environment controls
the expression of engrailed-like protein in the cranial neuroepithelium of
quail-chick chimeric embryos. Development 113, 1037-1048.
Gardner, C. A. and Barald, K. F. (1992). Expression patterns of engrailedlike proteins in the chick embryo. Developmental Dynamics 193, 370-388.
Gavin, B. J., McMahon, J. A. and McMahon A. P. (1990). Expression of
multiple novel Wnt-1/int-1-related genes during fetal and adult mouse
development. Genes Dev. 4, 2319-2332.
3394 L. Bally-Cuif and M. Wassef
Hallonet, M. E. R. (1993). Etude de l’ontogenèse du cervelet au moyen de la
technique de marquage cellulaire caille-poulet. PhD Thesis. Université Paris
6. Paris, France.
Hallonet, M. E. R., Teillet, M-A. and Le Douarin, N. M. (1990). A new
approach to the development of the cerebellum provided by the quail/chick
marker system. Development 108, 19-31.
Hamburger, V. and Hamilton, H. L. (1951). A series of normal stages in the
development of the chick embryo. J. Morphol. 88, 49-92.
Heemskerk, J., Di Nardo, S., Kostriken, R. and O’Farrell, P. H. (1991).
Multiple modes of engrailed regulation in the progression towards cell fate
determination. Nature 352, 404-410.
Itasaki, N., Ichijo, H., Hama, C., Matsuno, T. and Nakamura, H. (1991).
Extablishment of rostrocaudal polarity in tectal primordium: engrailed
expression and subsequent tectal polarity. Development 113, 1133-1144.
Jue, S. F., Bradley, R. S., Rudnicki, J. A., Varmus, H. E. and Brown,
A. M. C. (1992). The mouse Wnt-1 gene can act via a paracrine mechanism
in tranformation of mammary epithelial cells. Mol. Cell. Biol. 12, 321-3
28.
Li, H-S., Yang, J-M., Jacobson, R. D., Pasko, D. and Sundin, O. (1994).
Pax-6 is first expressed in a region of ectoderm anterior to the early neural
plate: implications for stepwise determination of the lens. Dev. Biol. 162,
181-194.
Marin, F. and Puelles, L. (1994). Patterning of the embryonic avian midbrain
after experimental inversions: a polarizing activity from the isthmus. Dev.
Biol. 163, 19-37.
Martin, P., Carriere, C., Dozier, C., Quatannens, B., Mirabel, M-A.,
Vandenbunder, B., Stehelin, D. and Saule, S. (1992). Characterization of a
paired box- and homeobox-containing quail gene (Pax-QNR) expressed in
the neuroretina. Oncogene 7, 1721-1728.
Martinez, S. and Alvarado-Mallart, R-M. (1989). Rostral cerebellum
originates from the caudal portion of the so called ‘mesencephalic’ vesicle: a
study using quail/chick chimeras. Eur. J. Neurosc. 1, 549-560.
Martinez, S. and Alvarado-Mallart, R-M. (1990). Expression of the
homeobox ChickEn gene in chick/quail chimeras with inverted metmesencephalic grafts. Dev. Biol. 139, 432-436.
Martinez, S., Wassef, M. and Alvarado-Mallart, R-M. (1991). Induction of a
mesencephalic phenotype in the 2 day-old chick prosencephalon is preceded
by the early expression of the homeobox gene en. Neuron 6, 971-981.
McMahon, A. P. (1992). The Wnt family of developmental regulators. Trends
Genet. 8, 236-242.
McMahon, A. P. and Bradley, A. (1990). The Wnt-1 (int-1) proto-oncogene is
required for development of a large region of the mouse brain. Cell 62, 10731085.
McMahon, A. P., Joyner, A. L., Bradley, A. and McMahon, J. A. (1992).
The midbrain-hindbrain phenotype of Wnt-1−/Wnt-1− mice results from
stepwise deletion of engrailed-expressing cells by 9. 5 days postcoitum. Cell
69, 581-595.
Meinhardt, H. (1983). Cell determination boundaries as organizing regions for
secondary embryonic fields. Dev. Biol. 96, 375-385.
Molven, A., Njolstad, P. R. and Flose, A. (1991). Genomic structure and
restricted neural expression of the zebrafish wnt-1 (int-1) gene. EMBO J. 10,
799-807.
Noordermeer, J., Meijlink, F., Verrijzer, P., Rijsewick, F. and Destrée, O.
(1989). Isolation of the Xenopus homolog of int-1/wingless and expression
during neurula stages of early development. Nucl. Acids Res. 17, 11-18.
Papkoff, J. and Schryver, B. (1990). Secreted int-1 protein is associated with
the cell surface. Mol. Cell. Biol. 10, 2723-2730.
Parr, B. A., Shea, M. J., Vassileva, G. and McMahon, A. P. (1993). Mouse
Wnt genes exhibit discrete domains of expression in the early embryonic
CNS and limb buds. Development 119, 247-261.
Patel, N. H., Martin-Blanco, E., Coleman, K. G., Poole, S. J., Ellis, M. C.,
Kornberg, T. B. and Goodman, C. S. (1989). Expression of engrailed
proteins in arthropods, annelids and chordates. Cell 58, 955-968.
Phillips, R. G. and Whittle, J. R. L. (1993). Wingless expression mediates
determination of peripheral nervous system elements in late stages of
Drosophila wing disc development. Development 118, 427-438.
Püschel, A. W., Gruss, P. and Westerfield, M. (1992). Sequence and
expression pattern of pax-6 are highly conserved between zebrafish and
mice. Development 114, 643-651.
Rijsewick, F., Schuermann, M., Wagenaar, E., Parren, P., Weigel, D. and
Nusse, R. (1987). The Drosophila homolog of the mouse mammary
oncogene int-1 is identical to the segment polarity gene wingless. Cell 50,
649-657.
Sharma, R. P. and Chopra, V. L. (1976). Effect of wingless (wg1) mutation
on wing and haltere development in Drosophila melanogaster. Dev. Biol. 48,
659-667.
Simeone, A., Acampora, D., Gulisano, M., Stornaiuolo, A. and Boncinelli,
E. (1992). Nested expression of four homeobox genes in developing rostral
brain. Nature 358, 687-690.
Simeone, A., Acampora, D., Mallamaci, A., Stornaiuolo, A., D’Apice, M.
R., Nigro, V. and Boncinelli, E. (1993). A vertebrate gene related to
orthodenticle contains a homeodomain of the bicoid class and demarcates
anterior neuroectoderm in the gastrulating mouse embryo. EMBO J. 12,
2735-2747.
Sternberger, L. A., Hardy, P. H., Jr., Cuculis, J. J. and Meyer, H. G. J.
(1970). The unlabeled antibody method of immunohistochemistry.
Preparation and properties of soluble antigen complex and its use in
identification of spirochetes. Histochem. Cytochem. 18, 315-333.
Storey, K. G., Crossley, J. M., De Robertis, E. M., Norris, W. E. and Stern,
C. D. (1992). Neural induction and regionalisation in the chick embryo.
Development 114, 729-741.
Thomas, K. R. and Capecchi, M. R. (1990). Targeted disruption of the murine
int-1 proto-oncogene resulting in severe abnormalities in midbrain and
cerebellar development. Nature 346, 847-850.
Thomas, K. R., Musci, T. S., Neumann, P. E. and Capecchi, M. R. (1991).
Swaying is a mutant allele of the proto-oncogene Wnt-1. Cell 67, 969-976.
Walther, C. and Gruss, P. (1991). Pax-6, a murine paired box gene, is
expressed in the developing CNS. Development 113, 1435-1449.
Wilkinson, D. G., Bailes, J. A. and McMahon, A. P. (1987). Expression of the
proto-oncogene int-1 is restricted to specific neural cells in the developing
mouse embryo. Cell 50, 79-88.
Williams, J. A., Paddock, S. W. and Carroll, S. B. (1993). Pattern formation
in a secondary field: a hierarchy of regulatory genes subdivides the
developing Drosophila wing disc into discrete subregions. Development 117,
571-584.
(Accepted 6 September 1994)
Note added in proof
The EMBL database accession number for the sequence
reported in this paper is X81693 GGWNT 1.