Download DNA to Protein Practice Sheet

Biology II
DNA to Protein Practice Sheet
Completion
1. For the following DNA strands, identify the base sequence in the opposite strand.
a. AACTCGATTACAGA
b. CATGATTAGCCGATA
c. GGCATCAACCGTTAAC
True and False
If the statement is true, write a T. If the statement is false, correct it by changing the underlined word(s) and
writing the correct word(s).
2. DNA is composed of four different nucleotides.
3. In a nucleotide, the phosphate group is attached to the nitrogen-containing base, which is attached to the
five-carbon sugar.
4. The hydrogen bonding of adenine to guanine is an example of complementary base pairing.
5. Each parent strand remains intact during replication, and a new companion strand is assembled on each
of those parent strands.
6. Some of the enzymes associated with DNA assembly repair errors during the replication process.
Label and Match
Use the DNA Structure Diagram to identify the structures (use Figure 11.6 to help you). Then, match the
correct description (A-G in the box) to each. Each letter will be used once.
7. 6)________________ (
)
8. 7)_____________ ______________ ( )
9.
8)________________ (
)
10. 9)________________ (
)
11. 10)_______________ (
)
12. 11)_______________ (
)
13. 12)_______________ (
)
A. The pyrimidine is thymine because it has two
hydrogen bonds.
B. A five-carbon sugar joined to two phosphate
groups in the upright portion of the DNA ladder.
C. The purine is guanine because it has three
hydrogen bonds.
D. The pyrimidine is cytosine because it has three
hydrogen bonds.
E. The purine is adenine because it has two
hydrogen bonds.
F. Composed of three smaller molecules: a
phosphate group, five-carbon deoxyribose sugar,
and a nitrogenous base (in this case, a
pyrimidine).
G. A chemical group that joins two sugars in the
upright portion of the DNA ladder.
Transcription Short Answer
14. List three ways in which a molecule of RNA is structurally different from a molecule of DNA.
15. What are the three key ways in which transcription differs from DNA replication?
16. Given the following DNA sequences, identify the sequence of the mRNA that it would form.
a. TACAAGATAACA
b. TTATTTCCTACCG
c. ATCGGCATCGAAT
Translation Matching
Choose the most appropriate answer for each.
17. Codon
18. Three at a time
19. Genetic code
20. Release factors
21. Ribosome
22. Anticodon
23. “Stop” codons
A. Composed of two subunits, one of which includes binding site
for mRNA
B. Reading frame of the nucleotide bases in mRNA
C. Detach protein and mRNA from the ribosome
D. UAA, UAG, UGA
E. A sequence of three nucleotide bases that can pair with a
specific mRNA codon
F. Name for each base triplet in mRNA
G. Term for how the nucleotide sequences of DNA and then
mRNA correspond to the amino acid sequence of a
polypeptide chain
Translation Completion
Use the RNA sequence (AUGUUCUAUUGUAAUAAAGGAUGGCAGUAG) to answer the following…
24. Write the corresponding mRNA sequence, breaking it into codons.
25. Use Figure 12.7 of your textbook to identify the chain of amino acids that would be formed.