Download emboj7601705-sup

EMBOJ-2007-63895
Sander et al., 2007
Supplementary Figure legends
Supplementary Figure 1 Gsc MO causes cell-autonomous ventralization of dorsal
blastomere fates. Embryos were injected with either lacZ mRNA (2.4 ng) or a mix of
lacZ mRNA and Gsc MO (68 ng) into a single B1 blastomere at 32-cell stage. The fate of
the injected cell was visualized at tadpole stage. (A) In control embryos, the B1
blastomere gives rise to neural ectoderm in the head, as well as notochord in the trunk
and tail. The magnification shows the characteristic coins-in-a-stack intercalation of
notochord cells (arrow in A’; n=15). (B, C) In embryos injected with Gsc MO the labeled
descendants populate the somites instead of the notochord. The β-Gal staining is seen in a
large portion of the somites, as well as in the head and the dorsal fin (B and B’; n=24), or
in the nuclei of medial somite cells (arrow in C’) and neural ectoderm (C and C’; n=25).
Medial somites represent the more dorsal compartment of the somite (Niehrs et al., 1993).
As expected from a repressor of Vent1/2, our results in the Gsc loss-of-function situation
are similar to the fate changes observed in the Vent1 or Vent2 gain-of-function studies
(Gawantka et al., 1995; Onichtchouk et al., 1996). df, dorsal fin; ne, neural ectoderm; no,
notochord; so, somites.
Material and methods
For lacZ lineage tracing, embryos injected with nuclear lacZ mRNA were fixed for 20
min. in MEMFA (Sive et al., 2000), and washed twice in PBS for 10 min. β-Gal staining
was performed in 0.5 M K3Fe(CN)6, 0.5 M K4Fe(CN)6, 0.5 M MgCl2 and 100 mg/ml 5Bromo-6-chloro-3-indolyl-β-D-galactopyranoside (in DMSO) in PBS at 4˚C over night.
Stained embryos were washed twice in PBS and re-fixed in MEMFA for 2 hours.
1
Supplementary Figure 2 Removal of Gsc re-specifies dorsal mesodermal fates in a
dose-dependent manner. Embryos were injected four times at 2- to 4-cell stage with
increasing amounts of Gsc MO (as indicated on the abscissa). Dorsal marginal zone
(DMZ) explants were excised at stage 10 and cultured until sibling embryos reached
stage 13. For RNA extraction and cDNA synthesis, 8 DMZs were used per sample. To
study the responses in gene expression upon increasing doses of Gsc MO, quantitative
RT-PCRs for marker genes of prechordal plate (Frzb1) and anterior brain (Otx2),
notochord (Collagen type IIA) and somites (MyoD), as well as of ventral mesoderm
(Vent1, Wnt8) were performed. The starting level of gene expression (0 ng Gsc MO) was
set to 1, and the changes in gene expression after MO injection (68 ng, 136 ng and 272 ng
Gsc MO) were calculated as fold change. (A) Anterior neural and prechordal plate genes
are highly expressed in the presence of Gsc, and are downregulated upon MO injection,
indicating that head and prechordal plate tissue formation requires maximum amount of
Gsc. (B) Notochord and somite markers are expressed at low levels in uninjected DMZs,
but their expression is upregulated at low and intermediate doses of Gsc MO, while
injection of the highest amount of Gsc MO resulted in a decrease of Col2A and MyoD
expression back to control levels and below. These curves suggest that notochord and
somites are formed in regions of intermediate Gsc. We observed very similar expression
profiles for notochord and somites - rather than more separate peaks, with notochord
being formed at lower Gsc MO doses than somites, as expected from previous
histological work of Niehrs et al. (1994). This might be due to Col2A being expressed not
only in the notochord, but also in peri-notochordal somite tissue at neurula stages (Su et
al., 1991; Larrain et al., 2000). (C) The expression of the ventral mesodermal marker
genes Vent1 and Wnt8 (as well as Vent2 and Scl, data not shown) is barely detectable in
control DMZs, but significantly increases after Gsc knockdown, indicating that Gsc
inhibits ventral mesoderm on the dorsal side of the embryo.
Primer sequences:
Frzb1,
fwd:
GACCACTGAATGTAGCCAGGA,
rev:
GGAGATGCAGACTCCTCTGTCA; Col2A, fwd: AGGCTTGGCTGGTCCTCAAGG,
rev: TGTAACGCATAGGGTCGGGTC.
References
Larrain J, Bachiller D, Lu B, Agius E, Piccolo S, De Robertis EM (2000) BMP-binding
modules in chordin: a model for signalling regulation in the extracellular space.
Development 127: 821-830
Su M-W, Suzuki HR, Bieker JJ, Solursh M, Ramirez F (1991) Expression of two
nonallelic type II procollagen genes during Xenopus laevis embryogenesis is
characterized by stage-specific production of alternatively spliced transcripts. J Cell Biol
115: 565-575
2
Supplementary Figure 3 Depletion of Wnt8 rescues the Gsc MO phenotype. (B)
Injection of Gsc MO ventralizes the embryo (n=29). (C) Wnt8 MO, in contrast, leads to
dorsalization (n=13). (D) Combined knockdown of Wnt8 and Gsc rescued the ventralized
phenotype of the Gsc knockdown (n=35), suggesting an inhibitory regulation between
Gsc and Wnt8. For each experiment, 68 ng of each MO were injected radially into 2- to
4-cell stage embryos. This result is in agreement with previous findings of Yao and
Kessler (2001).
Supplementary Figure 4 Partial redundancy of Vent1 and Vent2 at gastrula. (B, F)
Injection of Vent1 MO did not affect the expression of Chd and Gsc in the organizer
(Chd, n=17; Gsc, n=9). (C, G) Vent2 morphants showed slightly increased expression of
Chd and Gsc (Chd, n=20; Gsc, n=10). (D, H) Vent1/2 double knockdown caused a strong
expansion of Chd and Gsc expression (Chd, n=23; Gsc, n=17). 68 ng of each MO were
injected radially into 2- to 4-cell stage embryos. These results correlate with our
observation of mildly dorsalized Vent2 morphants and extreme dorsalization in Vent1/2depleted embryos at tadpole stage (Figure 4C and D). Thus, it seems that Vent1 and
Vent2 are partially redundant, with Vent2 being more active in repressing dorsal genes –
as previously concluded by Onichtchouk et al. (1998).
Supplementary Figure 5 Vent1/2 knockdown is rescued by zebrafish Vega mRNA. (A)
Control embryo stained for XAG1 (cement gland) and Scl (blood). (B) Dorsalized embryo
after Vent1/2 MO knockdown (n=16). (C) Injection of mRNAs encoding zebrafish Vega1
and Vega2 strongly ventralized the embryo (n=15) (D) Co-injection of Vega1 and Vega2
mRNAs restored normal development (n=15). 2 pg of each mRNA, and 34 ng of each
MO were injected radially into 2- to 4-cell stage embryos. Since Vega1/2 mRNA
injection leads to a stronger ventralization than Gsc MO injection (compare panel C to
Figure 1D), this indicates that Vent/Vega are also involved in Gsc-independent processes
in the embryo. This is supported by the observation that blood formation (marked by Scl
expression) cannot be restored in the Vent1/2/Gsc triple knockdowns (see Figure 5I).
Supplementary Figure 6 Complete depletion of Gsc and Vent1/2 in triple Vent1/2/Gsc
morphant embryos. (B, E, H and C, F, I) Individual injections of Gsc MO and Vent1/2
MOs in the same concentrations as used in the triple knockdowns (45 ng each) resulted in
identical phenotypes to those of embryos injected with 2- or 3-fold higher concentrations
of the same MOs. (D, G, J) The rescued phenotype of the triple Vent1/2/Gsc knockdown
did not change upon injection of higher doses of all three MOs. However, the overall
survival rates decreased with increasing doses of MOs. These results show that Gsc and
Vent1/2 are completely inhibited, even at the lower doses of MOs used for the triple
3
knockdown. Therefore, the phenotypic rescue seen in Vent1/2/Gsc morphants is not
caused by partial depletion of those transcription factors.
Supplementary Figure 7 Chd is epistatic to Vent1/2. (A) Uninjected control embryo (B)
Double knockdown of Vent1/2 showing dorsalization of the embryo (C) Chd depletion
leads to ventralization, as shown by decreased size of eyes (Rx2a), cement gland (XAG1),
hindbrain and notochord (Xbcan). (D) Co-injection of Chd MO in Vent1/2-depleted
embryos (45 ng of each MO, radial injections) not only rescued the dorsalization caused
by the double Vent1/2 knockdown, but caused mild ventralization in 80% of the tripledepleted embryos (n=41), as does the Chd MO single knockdown phenotype. Thus, the
Vent1/2 depletion phenotype requires Chd. However, Chd is epistatic to Vent1/2,
whereas Gsc MO only rescues the Vent1/2 knockdown back to a wild-type pattern. This
suggests that Chd has Gsc-independent functions, in addition to mediating the
downstream effects of overexpressed Gsc.
Supplementary Figure 8 The secreted growth factors ADMP and BMP4 compensate for
the loss of Gsc and Vent1/2. (A-C) Knockdown of Gsc leads to ventralization, while
Vent1/2 depletion strongly dorsalize the embryo. Rhombomere 5 of the hindbrain is
radialized in these embryos. The radial Krox20 expression is seen as a solid line at
neurula stages, at later stages – as shown here – the line breaks into shorter segments. (D)
The Vent1/2/Gsc triple knockdown rescued normal patterning. (E, F) Additional
depletion of ADMP or BMP4 resulted in strongly dorsalized phenotypes (n=28 for
Vent1/2/Gsc/ADMP MOs; n=34 for Vent1/2/Gsc/BMP4 MOs), showing that these two
extracellular proteins are part of the molecular safety net mechanism that compensates for
the loss of the transcription factors Gsc and Vent1/2. For the experiments in panel C to F,
34 ng of each MO were injected radially into 2- to 4-cell stage embryos.
4