Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Sequence comparison of aflR from different Aspergillus species
Document related concepts
Primary transcript wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Long non-coding RNA wikipedia , lookup
Designer baby wikipedia , lookup
Gene expression profiling wikipedia , lookup
Maximum parsimony (phylogenetics) wikipedia , lookup
Gene desert wikipedia , lookup
Pathogenomics wikipedia , lookup
Genome evolution wikipedia , lookup
Non-coding DNA wikipedia , lookup
DNA barcoding wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Metagenomics wikipedia , lookup
Microevolution wikipedia , lookup
Point mutation wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Helitron (biology) wikipedia , lookup
Transcript
Fungal Genetics and Biology 38 (2003) 63–74 www.elsevier.com/locate/yfgbi Sequence comparison of aflR from different Aspergillus species provides evidence for variability in regulation of aflatoxin production Kenneth C. Ehrlich,* Beverly G. Montalbano, and Peter J. Cotty US Department of Agriculture, Southern Regional Research Center, Agricultural Research Service, New Orleans, LA 70179-0687, USA Received 7 December 2001; accepted 15 July 2002 Abstract Aflatoxin contamination of foods and feeds is a world-wide agricultural problem. Aflatoxin production requires expression of the biosynthetic pathway regulatory gene, aflR, which encodes a Cys6 Zn2 -type DNA-binding protein. Homologs of aflR from Aspergillus nomius, bombycis, parasiticus, flavus, and pseudotamarii were compared to investigate the molecular basis for variation among aflatoxin-producing taxa in the regulation of aflatoxin production. Variability was found in putative promoter consensus elements and coding region motifs, including motifs involved in developmental regulation (AbaA, BrlA), regulation of nitrogen source utilization (AreA), and pH regulation (PacC), and in coding region PEST domains. Some of these elements may affect expression of aflJ, a gene divergently transcribed from aflR, that also is required for aflatoxin accumulation. Comparisons of phylogenetic trees obtained with either aligned aflR intergenic region sequence or coding region sequence and the observed divergence in regulatory features among the taxa provide evidence that regulatory signals for aflatoxin production evolved to respond to a variety of environmental stimuli under differential selective pressures. Phylogenetic analyses also suggest that isolates currently assigned to the A. flavus morphotype SBG represent a distinct species and that A. nomius is a diverse paraphyletic assemblage likely to contain several species. Ó 2002 Elsevier Science (USA). All rights reserved. IDT: Aflatoxin; Aspergillus; aflR; aflJ; Transcription regulation; Phylogenetics; PEST domains; PacC; AreA; BrlA 1. Introduction Aspergillus section Flavi includes the species, A. parasiticus, A. flavus, A. nomius, A. bombycis, and A. pseudotamarii, which under certain conditions produce highly toxic and carcinogenic aflatoxins (Cotty and Cardwell, 1999; Egel et al., 1994; Ito et al., 2001; Peterson et al., 2001). In addition, more than 50 other species of filamentous fungi, including several species of Penicillium and a distantly related Chaetomium, have been reported to synthesize sterigmatocystin and other aflatoxin precursors (Barnes et al., 1994; Frisvad, 1985). Crops can become contaminated with aflatoxins when conditions favor growth of these fungi (Cotty et al., * Corresponding author. Fax: 1-504-286-4419. E-mail address: [email protected] (K.C. Ehrlich). 1994). Annual costs resulting from crop losses and the need to limit food contamination have been estimated to be more than $100 million (Robens, 2001). Of the aflatoxin-producing species, A. flavus and A. parasiticus are the most common species implicated as causal agents of aflatoxin contamination (Cotty et al., 1994). Roles of agriculture in structuring communities of aflatoxinproducing fungi are unclear (Bayman and Cotty, 1993). Aflatoxin-producing fungi are a mosaic of species that belong to divergent clades (Cotty et al., 1994). Within certain clades and along some lineages aflatoxinproducing ability is highly conserved, but in other clades aflatoxin production is either highly variable or lacking (Egel et al., 1994; Geiser et al., 2000). Aflatoxin-producing fungi reproduce in diverse ecological niches throughout warm climates (Cotty et al., 1994). Transcriptional regulation of aflatoxin biosynthesis might be contingent upon environmental signals particular to 1087-1845/02/$ - see front matter Ó 2002 Elsevier Science (USA). All rights reserved. PII: S 1 0 8 7 - 1 8 4 5 ( 0 2 ) 0 0 5 0 9 - 1 64 K.C. Ehrlich et al. / Fungal Genetics and Biology 38 (2003) 63–74 different niches. Nitrogen source, pH, and even antimicrobial agents are known to differentially influence aflatoxin biosynthesis among species, isolates, and strains (Cotty, 1988; Cotty and Cardwell, 1999). Variation in the molecular structure of aflatoxin regulatory genes and the molecular basis for divergent regulation of aflatoxin synthesis among strains has not been described. The 23 genes involved in aflatoxin biosynthesis in A. flavus and A. parasiticus are part of a 75 kb cluster (Trail et al., 1995; Yu et al., 1995). Most of the genes are coregulated by a single pathway-specific, DNA-binding protein, AflR (Ehrlich et al., 1999b). The gene encoding AflR resides in the cluster between early and late-acting genes involved in aflatoxin biosynthesis. AflR has a Cys6 Zn2 DNA-binding domain and C-terminal transcription activation domain typical of GAL4-type fungal and yeast transcription factors. AflR binds to the partially palindromic consensus sequence 50 -TCGN5 CGR-30 found in promoters of most of the aflatoxin biosynthesis genes (Chang et al., 1995; Ehrlich et al., 1999b). A gene, aflJ, is divergently transcribed from aflR. This gene encodes a protein, AflJ, which also appears to be involved in aflatoxin gene regulation (Meyers et al., 1998). Although an exact function for this protein has not yet been identified, preliminary evidence suggests that it modulates AflR activity (P.-K. Chang, unpublished results). AflJ was found to be necessary for accumulation of some of the early precursor metabolites involved in the aflatoxin biosynthetic pathway (Meyers et al., 1998). In addition, transformants containing an extra copy of aflR but lacking an extra copy of aflJ have a reduced level of expression of aflR compared to transformants containing a second copy of both genes (Chang et al., 1995). In this report, we compared the nucleotide sequences of the aflJ/aflR intergenic region and aflR coding region in 28 isolates of five species of aflatoxin-producing fungi within Aspergillus section Flavi to deduce variations in regulatory region motifs and inferred protein structure, as well as phylogenetic relationships among these species. 2. Materials and methods 2.1. Fungal isolates Twenty-eight fungal isolates belonging to Aspergillus section Flavi and known to produce aflatoxins were used in this study (Table 1). Isolates thought to represent maximum divergence among aflatoxin producing species were chosen. A. flavus isolates included morphotypes which produce only B aflatoxins and either numerous small sclerotia (average diameter < 400 lm) or fewer, larger sclerotia (Cotty, 1989). The former type has been called the S strain of A. flavus (Cotty, 1989) or A. flavus var. parvisclerotigenus (Saito and Tsuruta, 1993), while the latter has been called the L strain of A. flavus (Cotty, 1989). Atypical A. flavus isolates which produce both B and G aflatoxins were also included. These were described previously as an unnamed taxon (Egel et al., 1994; Hesseltine et al., 1970), the SBG strain of A. flavus (Cotty and Cardwell, 1999), or A. flavus Group II (Geiser et al., 2000; Geiser et al., 1998). A. nomius isolates were chosen which show considerable morphological, physiological, and genetic divergence. Ex type cultures of A. nomius (Kurtzman et al., 1987), A. bombycis (Peterson et al., 2001), and A. pseudotamarii (Ito et al., 2001) were selected but not ex type cultures of A. flavus and A. parasiticus, because those isolates do not produce detectable quantities of aflatoxins. A. parasiticus CP-461, which produces the penultimate precursor, O-methylsterigmatocystin (OMST), but not aflatoxin, was included because of its importance in studies of the molecular biology of aflatoxin production (Bhatnagar et al., 1987). Active fungal cultures were maintained without light on 5/2 agar (5% V-8 vegetable juice, 2% agar, and pH 5.2) at 31 °C. Isolates were stored at 4 °C as 3-mm plugs of sporulating culture (5–7-daysold on 5/2 agar) in sterile distilled water. Aflatoxin production was assessed as previously described after growth of the fungi on a minimal medium of Adye and Mateles (1964) with 22.5 mM urea instead of ammonium sulfate as the sole nitrogen source (Cotty, 1997; Cotty and Cardwell, 1999). 2.2. Sequence analysis Genomic DNA and RNA from 3- to 5-day fungal cultures was isolated (DNeasy and RNeasy Kits, Qiagen, Valencia, CA) from mycelia ground to a powder in liquid nitrogen (Ehrlich et al., 1999a). Polymerase chain reaction (PCR) on the genomic DNAs was done using the oligonucleotides shown in Table 2. Primers 1 and 5 overlapped the translational start sites of the A. parasiticus aflJ and aflR, respectively (Fig. 1) (Ehrlich et al., 1999a). PCR of coding regions of A. flavus and A. parasiticus aflRs used primers 6 and 15, whereas PCR of the other taxa used primers 7 and 16 which overlapped the coding region for highly conserved portions of the protein. Sense primers 2–4 in the aflJ/ aflR intergenic region were used with antisense primers 12–16 to complete the sequence at the 50 -end of the aflR-coding region. 30 -RACE PCR (SMART RACE cDNA amplification kit from Clonetech, Palo Alto, CA) with primer 11 and A. nomius and A. pseudotamarii DNAs was used to fill in the end of the 30 -coding region that was not obtainable by the genomic DNA amplifications. Other primers listed in Table 2 were used to fill in and verify sequence at the ends of the coding regions for some of the A. nomius, A. bombycis, K.C. Ehrlich et al. / Fungal Genetics and Biology 38 (2003) 63–74 65 Table 1 Strains of Aspergillus section Flavi used in this study Code Isolate Other name Species Type Location Substrate Citation B1 NRRL 25593 None bombycis NA Japan B2 NRRL 26010 Ex type, BPI 745225 bombycis NA Japan F3 F4 F5 F6 F7 F8 F9 F10 AF12 AF42 AF70 AF13 91075-K LA2-1 91083-A BN038G ATCC ATCC ATCC ATCC None ATCC None ATCC S, SB S, SB S, SB L L L L SBG Arizona Louisiana Arizona Arizona Arizona Arizona Alabama Benin Silkworm debris Silkworm debris Soil Soil Soil Soil Cottonseed Soil Cottonseed Soil F11 BN040B ATCC MYA-381 SBG Benin Soil F12 BN008R ATCC MYA-379 SBG Benin Soil N13 N14 N15 STV35-33 103B M93 NA NA NA Mississippi Mississippi Illinois Soil Cottonseed Wheat N16 N17 174 A181 NA O Brazil Calif Brazil nut Pistachio N18 A1 IMI-358752 IMI-358749 Ex type, NRRL13137, ATCC 15546 IMI-358751 nomius ATCC208928, nomius NRRL29212 None nomius O Calif Pistachio N19 A25 nomius O Calif Pistachio N20 N21 N22 N23 P24 P25 BN013P BN013Q BN016F L1A2 BN009-E CP-461 ATCC208927, NRRL 29213 None None None None None ATCC-62882, SRRC-2043 nomius nomius nomius nomius parasiticus parasiticus NA NA NA NA NA NA Benin Benin Benin Philippines Benin Georgia Soil Soil Soil Soil Soil Peanut P26 NRRL 2999 ATCC 26691 parasiticus NA Uganda Peanut PT27 NRRL 25517 Ex type, None NA Japan Soil PT28 NRRL 443 None pseudotamarii pseudotamarii Egel et al. (1994) Feibelman et al. (1998) Feibelman et al. (1998) Feibelman et al. (1998) None None None None None Dorner et al. (1984), Bhatnagar et al. (1987) Rambo et al. (1974) Ito et al. (2001) NA Argentina Unknown Ito et al. (2001) MYA-382 MYA-383 MYA-384 96044 208935 MYA-380 flavus flavus flavus flavus flavus flavus flavus flavus unnamed flavus unnamed flavus unnamed nomius nomius nomius A. flavus, and A. parasiticus strains. PCR products were cloned using the TA cloning kit from Invitrogen (Carlsbad, CA), and dye terminator dideoxy sequencing was done by standard methods. All sequences were determined in both directions. Selected sequences were obtained on several independent clones and found to be identical. Sequences for the combined aflJ/aflR intergenic region and coding regions were deposited in GenBank as accession numbers AF441414-41. Detection of regions rich in PEST motifs in the inferred AflR protein sequence was accomplished with the PEST find algorithm (http://www.at.embnet/embnet/tools/bio/ PESTfind/). Peterson et al. (2001) Peterson et al. (2001) Cotty (1989) Cotty (1989) Cotty (1989) Cotty (1989) None None None Cotty and Cardwell (1999) Cotty and Cardwell (1999) Cotty and Cardwell (1999) Egel et al. (1994) Egel et al. (1994) Kurtzman et al. (1987) Aflatoxins Type Yield (log ng/g) BG 1.3 BG 4.9 B B B B B B B BG 5.6 5.4 5.5 5.1 4.7 2.3 3.0 6.1 BG 5.6 BG 6.5 BG BG BG 6.5 6.1 6.5 BG BG 4.7 3.4 BG 3.3 BG 2.8 BG BG BG BG BG None 6.2 6.4 6.8 6.5 6.5 None BG 6.7 B 5.0 B 4.5 2.3. Alignments and phylogenetic analyses DNA sequences were aligned using ClustalW in DNAMAN (Lynnon Biosoft, Vandreuil, Canada). Data sets included aligned DNA sequences from the aflJ/aflR intergenic region and the aflR coding region. Sequence alignments have been deposited at TreeBASE (http://www.treebase.org/treebase/) under accession number SN745, matrix accession number M1177. Phylogenetic trees were obtained by parsimony analyses using heuristic search methods with stepwise sequence addition and the tree-bisection–reconnection (TBR) branch-swapping algorithm (PAUP*ver4.0b10 Macin- 66 K.C. Ehrlich et al. / Fungal Genetics and Biology 38 (2003) 63–74 Table 2 Oligonucleotides used for sequencing Primera Sequenceb 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 CATGGCTGAGGATAGCTCGTG TCCTGGGCTCAGTCAGAACC AAAAGGGCGGGCTACTCTCC AGKGCGAGGCAACGAAAAGGGC TCGTGGAGGTGAGGAAGGAAT CCACGATGGTTGACCATATC AAAGTGCGATGCACCAAGGAGAAACC CCAGTCCCCTTGAGCCAACT GCGACCCTCAGAGAGCCTTCCTTCA CCGACAAATCTCCTCCCAGG GGACTCCCATGATCGACCCGTTC TGCCTGACACAACGGTAATGG ACACGGTGGTGGGACTGTTG CACCGTGTCCAGTGGCTGTCT TCGGACACGGTGGCGGGACT ACTAGGSGGTGGTGCAGCACGCGCTCTTC CAGGTAATCAATAATGTCG TCATTCTTGCTGCAGGAAATT TCATTCTCGATGCAGGAAATC GTGTGTTGATCGATCGGCCAG Positionc )3 554 623 630 734 735 845 925 955 1199 1330 1413 1747 1759 1762 1765 2052 2062 2067 2301 Directiond Regione Homologyf s s s s as s s s s as s as as s as as as as as as JR intergenic JR intergenic JR intergenic JR intergenic JR intergenic JR intergenic Zn cluster R-coding R-coding R-coding R-coding R-coding R-coding R-coding R-coding R-coding R-coding R-coding R-coding 30 -noncoding AF/AP APT AB AF/AP AF/AP AF/AP AF/AP AN AB AB AN APT AN AF/AP AB AF/AP/AN AF/AP AN APT AF/AP a Oligonucleotide primer numbers correspond with the numbers shown in Fig. 1. Sequences are written 50 to 30 ; k ¼ G or T, s ¼ C or G. c Numbering is from the beginning of the aflJ ORF. d s ¼ sense, as ¼ antisense; orientation with respect to the aflR ORF. e JR intergenic ¼ the non-transcribed region between the translational start sites for aflJ and aflR; Zn cluster is the region encoding the Zn2 Cys6 binuclear cluster DNA binding domain of AflR; R-coding ¼ the coding region for aflR. The 30 -noncoding region is the region encompassing the translational termination signal and the polyadenylation site. f AF ¼ A. flavus, AP ¼ A. parasiticus, AB ¼ A. bombycis, AN ¼ A. nomius, APT ¼ A. pseudotamarii. b tosh, Sinauer Associates, Sunderland, MA). Node support was assessed with 1000 bootstrap replicates. Gaps were treated as missing. A. bombycis was chosen as the outgroup based on previously reported relationships among Aspergillus species (Peterson, 1997; Peterson et al., 2001). The partition homogeneity test (PHT) in PAUP* (Farris et al., 1994; Swofford, 1998) was performed on parsimony informative sites only, with 1000 randomized data sets using heuristic search methods with stepwise sequence addition. A two-tailed Kishino–Hasegawa (KH) test using 1000 RELL boot- strap replicates (Kishino and Hasegawa, 1989) in PAUP* was employed to further assess the likelihood of the different tree topologies. 3. Results 3.1. Aflatoxin production A. flavus L and SB and A. pseudotamarii isolates produced B aflatoxins only, whereas all of the other Fig. 1. Schematic diagram of the aflR/aflJ intergenic and aflR coding regions. The gene aflJ is divergently transcribed from aflR as indicated by the horizontal arrow. Shaded rectangles indicate the locations of putative coding region domains in the DNA. G1 to G5 shown below the aflJ/aflR intergenic region indicate HGATAR sites (putative AreA-binding sites). Other putative transcription factor binding sites are shown above the intergenic region sequence. Numbers in open arrows indicate the location and direction of oligonucleotides used for PCR (Table 2). K.C. Ehrlich et al. / Fungal Genetics and Biology 38 (2003) 63–74 aflatoxin-producing fungi produced both B and G aflatoxins (Table 1). On medium containing urea as the nitrogen source, aflatoxin production by the A. flavus SB and SBG isolates, the A. parasiticus isolates, and the seven typical A. nomius isolates (N13–15; 20–23) was consistently higher and less variable than that of the A. flavus L isolates, the A. bombycis isolates, the genetically divergent A. nomius (N16) (Egel et al., 1994), and the three A. nomius O isolates (N17–19) (Table 1). Aflatoxin production varied 4000-fold between the two A. bombycis isolates, and 1000-fold among the four A. flavus L isolates. A. pseudotamarii isolates produced approximately 3-fold lower levels of aflatoxin than did A. flavus SB isolates. 67 Tables 3 and 4). The intergenic regions of all of the isolates contained at least two HGATAR sites (Table 3). In A. parasiticus, A. flavus SB and L, N16, and A. pseudotamarii isolates two of the HGATAR sites were separated by 15 bp. Such adjacent sites have previously been shown to be sufficient to activate transcription by AreA (Ravagnani et al., 1997). A study previously showed that A. parasiticus AreA bound to DNA fragments from the A. parasiticus aflJ/aflR intergenic region that contained either GATA sites 1 and 2, or the single GATA site 5 (Chang et al., 2000). A sequence 68–78 bp upstream of the aflJ ORF was homologous to known binding sites for AflR (50 TCGN5 CGR-30 ) found in other aflatoxin pathway genes (Ehrlich et al., 1999b). This sequence (site 1) was present in all isolates except in most A. nomius (Table 4). A. bombycis, N16, and A. pseudotamarii were the only isolates with a second putative AflR-binding site further upstream from the aflJ ORF. The region 30- to 90-bp upstream of the A. parasiticus aflR transcription start site (at )33 bp) was previously found to be required for aflR promoter activity in reporter assays (Ehrlich et al., 1999a), but no sequence homologous to proven AflRbinding sites was present in this region. Sequences previously shown to be sufficient for binding BrlA, a transcription factor involved in developmental regulation in A. nidulans (Adams et al., 1988; Adams et al., 1990), were present in all isolates except A. flavus SB , and L. Some A. nomius isolates (Clade II) have two putative BrlA sites, whereas the others have only one site. BrlA site1 is within 100 bp of the aflJ ORF. Putative sites for another factor shown to be important for developmental regulation in fungi, AbaA (Andrianopoulos and Timberlake, 1994), were located upstream of the BrlA sites. The furthest upstream AbaA site (site 1) was conserved in all isolates, but the second AbaA site (site 2) was absent in A. flavus L, SB , SBG , and A. parasiticus isolates. 3.2. aflR Sequence comparison Comparison of aflR promoter and coding region sequences from 28 isolates of five aflatoxin-producing Aspergillus species showed differences in length and homology. The aflR/aflJ intergenic region ranged from 689 bp in A. pseudotamarii to 745 bp in A. flavus SBG isolates (Table 3), while the coding region varied from 1305 in A. flavus SBG to 1350 bp in A. pseudotamarii isolates. The aflR/aflJ intergenic region of A. parasiticus isolates was 98, 98, 92, 80, 75, and 78% identical to those of A. flavus L, A. flavus SB , A. flavus SBG , A. bombycis, A. nomius, and A. pseudotamarii isolates, respectively, whereas the A. parasiticus aflR coding region was 99, 99, 93, 87, 87, and 89% identical to the coding regions of these isolates. 3.3. aflR Promoter structure Alignment of the aflJ/aflR intergenic region (the sequence between the divergently transcribed aflJ and aflR ORFs) from the 28 isolates revealed putative binding sites for homologs of the known fungal transcription factors, AreA, AbaA, BrlA, PacC, and AflR (Fig. 1, Table 3 Presence of putative binding sites for AreA in the aflJ/aflR intergenic region Isolatea aflJ/aflR Length (bp) A. A. A. A. A. A. A. A. A. A. 739 739 740 745 689 719 719 714 713 719 flavus SB (F3–F5) flavus L (F6–F9) parasiticus (P24–P26) flavus SBG (F10–F12) pseudotamarii (PT27,PT28) bombycis (B1,B2) nomius (N16) nomius Clade I (N13,N14) nomius Clade II (N15,N17–19, N23) nomius Clade III (N20–N23) a GATA1b GATA2 GATA3 GATA4 GATA5 CTATCT TTATCT TTATCA CTATCA TTATCT )529 )528 )529 )508 )507 )508 — — — — — — — )493 )317 )316 )317 )319 )322 )312 )310 )310 )308 )312 )512 )509 — — — — — )441 — — )338 — — — )489 )487 )485 )489 — — — — — — — — Letters refer to the species and numbers to the isolates listed in Table 1. b Proven binding sites for AreA have the sequence HGATAR or YTATCD. Numbering is from the aflR ORF. A Ô—Õ indicates the site does not have the HGATAR binding motif. K.C. Ehrlich et al. / Fungal Genetics and Biology 38 (2003) 63–74 c — — — — )164 )155 — )505 )388 )422 — )402 )159 )160 — — )485 )484 )519 )424 — — — — — — — — Sites are shown schematically in Fig. 1. Sequences are written 50 to 30 and the numbering is from the aflR ORF. A Ô—Õ indicates the site does not have the correct binding motif. c A possible BrlA site (50 -CAAGGGA-30 ) overlaps the PacC site. b a )229 — — )681 678 )683 )152 )342 )321 )316 )313 )318 — — — — )707 )710 )654 — — — — — CCTGGC — MAAGGGA AGAGGGG — — CATTCC CATTCT )462 )462 )462 )464 )444 )445 )439 )436 )441 — TCGNNNN GCGG TCGCCGTGCGGb )666 )666 )666 )669 )613 )647 flavus SB (F3–F5) flavus L (F6–F9) parasiticus (P24–P26) flavus SBG (F10–F12) pseudotamarii (PT27,PT28) bombycis (B1,B2) and N16 nomius Clade I (N13, N14) nomius Clade II (N15,N17–N19,N23) nomius Clade III (N20-N22) BrlA site1 AbaA site2 AbaA site1 AflR site2 AflR site1 Isolatea Table 4 Putative binding sites for transcription factors other than AreAa A sequence identical to binding sites for the transcription factor involved in pH-regulation of gene expression in fungi, PacC (Espeso and Arst Jr, 2000), was found near the aflR ORF (PacC site 2) in A. parasiticus, A. flavus L, and A. bombycis and A. pseudotamarii isolates, but not in the A. nomius, or the A. flavus SB and SBG isolates. Another PacC site (site 1) was near the aflJ ORF. This site was present in most of the isolates, except for A. parasiticus, A. pseudotamarii, and the A. nomius isolates from Benin (N20–22). 3.4. aflR Coding region structure A. A. A. A. A. A. A. A. A. PacC site1 BrlA site2 PacC site2 GCCAAG 68 Comparison of the deduced AflR protein sequence showed the presence of highly conserved domains homologous to nuclear localization signal sequences (RRARK, aa20–24) (Boulikas, 1993), the Cys6 Zn2 motif (aa29–56), and a linker region necessary for sequencespecific DNA-binding (aa57–66) (Reece and Ptashne, 1993). Several of the most variable features in the protein sequence that might influence protein activity and/ or abundance are listed in Table 5. The AflR protein sequences of A. flavus SB , A. pseudotamarii, and A. parasiticus isolates contained longer histidine-rich motifs (HAHTQAHTHAHSH, aa103–113) than did the other isolates. This motif was on the carboxy-terminal side of the DNA-recognition domain (Fig. 1). AflRs from A. flavus SBG isolates had only two of the six histidine residues, whereas the AflRs from A. bombycis and A. nomius had four of the His residues. In all isolates, a proline-rich region was adjacent to this site on the Cterminal side. AflR in A. nomius isolates had 11–12 proline residues while A. flavus and A. parasiticus isolates had eight. A key distinguishing feature shared by A. nomius and A. bombycis isolates is a serine-rich sequence, NSSDSSGSSRSSSSSSNSP, approximately 100 amino acids from the AflR C-terminus and immediately preceding a conserved domain rich in acidic amino acids. Seven serine residues were present in the homologous region from A. pseudotamarii and four in A. flavus and A. parasiticus. Using the PESTfind algorithm (Rogers et al., 1986) the proline-rich sequence in A. nomius isolates had a score of +15 while the serine-rich sequence in A. nomius and A. bombycis isolates had scores of +18 and +12, respectively. In all isolates the final 20 amino acids at the AflR C-terminus, which may be part of the transcription activation domain (Matsushima et al., 2001), is divided into an Arg-rich region (RH/QRLRA/ VVSS) and a region (D/NIID/NY/FLQ/HR/QE) containing both basic and acidic amino acids. 3.5. Phylogenetic analysis The trees based on the aligned nucleotide data sets for the aflJ/aflR intergenic region and coding region K.C. Ehrlich et al. / Fungal Genetics and Biology 38 (2003) 63–74 69 Table 5 Main differences in coding region motifs in AflRs from different Aspergillus species Taxon A. A. A. A. A. A. A. A. flavus, SB and L (F3–F9) parasiticus (P24–P26) flavus, SBG (F10–F12) pseudotamarii (PT27,PT28) bombycis (B1,B2) and N16 nomius Clade I (N13–14) nomius Clade II (N15,17–19,23) nomius Clade III (N20–22) a b Coding region motifa His-rich site 103b Pro-rich site 116 Ser-rich site 329 C-terminal sequence 427 hahtqahthahsh hahtqahthahsh hah hahtqapthshshsh hahshrh hahshsh hvhshsh hahshsh pqphpqshpqsnqpphalptp pqphpqshpqsnqpphalptp pqprpqshpqsnqpphalptp pqphpqpqpqsdqppnalptp pqppaqrqppsdqpphalptp pqphpppplqpdqpphalptp pqphpppppqsdqpphalptp pqphppppprpdqpphalptp nsgscsnsp nsgscsnsp nsgscgnsp ntssgsssscgnsp nssdssgssrgssssssnsp nssdssgssrssssssnsp nssdssgssrssssssnsp nssdssgssrssssssnsp rhrlravssdiidylhre rhrlravssdiidylhre rhrlravssdiidylhre rhrlrvvsadiidfl hre rhrlravssdiinflqqe rhrlravssniinflqqe rhrlravssdiinflqqe rqrlravssniinflqqe Consensus sequence is shown. Sites are shown schematically in Fig. 1. Positions are the approximate number of amino acids from the proteinÕs amino terminus. sequence (Fig. 2) showed similarities in clades of taxa at distal nodes. In the tree based on intergenic region sequence, A. nomius isolates only separated into two distinct clades within which many of the affiliations were found to be polytomous (Fig. 2A) whereas in the tree obtained with coding region sequence (Fig. 2B), A. nomius isolates (excluding N16) were resolved into three well-supported clades. When partitions consisting of the aflJ/aflR intergenic region and the aflR coding region sequence data sets were examined using the PHT, these regions were only significantly incongruent (P < 0:05) when specific A. nomius and A. bombycis isolates were included in the analysis (Table 6). The KH test (Kishino and Hasegawa, 1989) was used to compare the likelihood of the intergenic region sequence data given the topologies of the trees based on this data with the likelihood of the intergenic region data given the topologies of the trees based on the coding region sequence. The eight most parsimonious (MP) trees for the intergenic region were significantly less likely topologies for the coding region data set than any of the MP trees for the coding region (P < 0:001, ln L ¼ 4502:72, and diff ln L ¼ 154). Similarly, the six MP trees for the coding region had less likely topologies for the intergenic region data set than did the MP trees for the intergenic region (P < 0:05; ln L ¼ 2771:29, and diff ln L ¼ 32). Using a simplified data set consisting of only one member of each taxon (B1,F3, F6, F10, P24, N15, and PT27), an attempt was made to determine if a phylogeny based on transcription factor binding sites maps to a phylogeny based on all parsimony informative aflJ/aflR intergenic region sites. All of the variable transcription factor binding site domains probably resulted from single nucleotide changes within the site. By PHT, the trees based on the transcription factor binding sites were Fig. 2. Phylogenetic analysis. (A) Phylogenetic tree for the aflJ/aflR intergenic sequence. One of three most parsimonious (MP) trees calculated from a heuristic search of the aligned sequence data using PAUP* (Version 4.0b10). Of 725 total characters, 257 were parsimony informative. Tree length is 377 steps, consistency index (CI) ¼ 0.908, homoplasy index (HI) ¼ 0.092, retention index (RI) ¼ 0.948, and rescaled consistency index (RC) ¼ 0.889. The tree is unrooted. A. bombycis is designated as the outgroup. The number of nucleotide changes occurring in the branch are given below the line. Bootstrap values based on 1000 replicates are shown above the line. (B) Phylogenetic tree based on aflR coding sequence. One of six most parsimonious trees generated by heuristic search of the aligned data set. Of 1313 total characters 301 were parsimony informative. The tree length is 459 steps, CI ¼ 0.839, HI ¼ 0.161, RI ¼ 0.960, and RC ¼ 0.805. 70 K.C. Ehrlich et al. / Fungal Genetics and Biology 38 (2003) 63–74 Table 6 Summary of partition homogeneity test resultsa A B C D E F G H I J K Taxa included in analysis Number of taxa Pb MP tree lengthc Min. tree lengthd All taxa All taxa excluding A. nomius All taxa excluding N20–22 All taxa excluding N13, N14 All taxa excluding N15,17–19, 23 All taxa excluding N16, B1, B2 A. nomius (excluding N16) G + A. bombycis and N16 A. flavus L and SB I + A. parasiticus J + A. flavus SBG + A. pseudotamarii 28 19 25 26 23 25 10 13 7 10 15 0.026 0.291 0.492 0.682 0.054 0.097 0.280 0.012 1.000 0.301 0.630 730 648 697 702 677 602 104 312 18 66 335 723 646 694 699 674 594 103 307 18 63 331 a Partitions are aflJ/aflR intergenic region and aflR coding region. Probability is based on 1000 bootstrap replicates. c MP, most parsimonious. d Tree lengths include phylogenetically informative sites only. Min., minimum. b congruent with trees based on the entire intergenic region (P ¼ 1:000). However, the KH test indicated that the topology of the MP tree for the transcription factor sites was not as good a description of the entire intergenic region data set as any of the MP trees based on the entire intergenic region data set (P < 0:001 and diff ln L ¼ 93). 4. Discussion Although no study has demonstrated that aflatoxin production confers a selective advantage on producing organisms (Cotty et al., 1994), diverse Aspergillus species retain the ability to produce either aflatoxin or its precursors, a process that requires conservation of a gene cluster containing at least 23 different genes (Yu et al., 1995). Considerable differences in aflatoxin production among Aspergillus lineages have been found (Cotty and Bhatnagar, 1994). Both A. parasiticus and A. flavus SB belong to clades in which aflatoxin-producing ability is highly conserved whereas A. nomius and A. flavus L isolates belong to clades in which aflatoxin production is highly variable (Cotty, 1989; Geiser et al., 2000). The radiation of ancestral Aspergillus species required adaptation to diverse animal and plant-associated niches in geographically isolated environments (Bayman and Cotty, 1993; Cotty and Bhatnagar, 1994). Considerable variability in numerous traits, including aflatoxin production, probably developed during this radiation. This report describes how the structure of aflR, the pathwayspecific regulatory gene for aflatoxin biosynthesis, has evolved during divergence of aflatoxin-producing taxa within Aspergillus section Flavi, as inferred from 28 representative isolates. Sequence differences in the aflR coding and promoter regions provide a basis for predicting the roles of environmental and developmental cues in differential regulation of aflatoxin production among aflatoxin-producing fungi. 4.1. Promoter sequence diversity Adaptation to different environmental niches is evidenced by the diversity in binding sites for transcription factors sensitive to environmental stimuli in the promoter regions of the two regulatory genes involved in aflatoxin production, aflR and aflJ. Inhibition or stimulation of aflatoxin production by different nitrogen sources may vary with species, depending on the presence or absence of AreA-binding sites in their aflJ/aflR intergenic regions (Ehrlich and Cotty, 2000). Nitrate increases the availability of AreA, which affects the expression of genes depending on the number and position of promoter GATA sites (Muro-Pasteur et al., 1999). The variability of GATA sites in the aflJ/aflR intergenic region (Table 3) and differences among fungi in aflatoxin production (Table 1) provides a way to test the role of nitrogen sources on transcriptional regulation of aflatoxin biosynthesis genes. Transcription factors AbaA and BrlA may mediate expression of genes involved in development-specific processes in fungi (Sewall, 1994), but have not yet been directly implicated in regulation of secondary metabolite biosynthesis. Putative BrlA-binding sites were present in the aflJ/aflR intergenic region of all isolates, except A. flavus SB and L. Developmentally regulated genes in fungi, for example the Pcl-like cyclin gene involved in Aspergillus sporulation (Schier et al., 2001), have multiple sites for binding BrlA and AbaA. Presence of such sites in the aflJ/aflR intergenic region may reflect coregulation of developmental processes and aflatoxin biosynthesis in certain species. Previous work suggested possible interrelationships between regulation of aflatoxin biosynthesis and regulation of such developmental K.C. Ehrlich et al. / Fungal Genetics and Biology 38 (2003) 63–74 processes as sporulation or sclerotial morphogenesis (Cotty, 1988; Hicks et al., 1997). High aflatoxin production has been associated with phenotypes having increased sclerotial formation, particularly in the A. flavus SB morphotype (Cotty, 1997; Geiser et al., 2000). Aflatoxin biosynthesis also is markedly influenced by pH (Cotty, 1988; Keller et al., 1997). Presence or absence of PacC-binding sites in the aflJ/aflR intergenic region could partly account for differential sensitivity of aflatoxin production to pH in different species of Aspergillus (Ehrlich et al., 1999a). Precedent for interference by PacC in the expression of acid-expressed genes has been reported for the gabA gene in A. nidulans (Espeso and Arst Jr, 2000). The proximity of PacC site1 to the aflJ ORF and PacC site 2 to the aflR ORF suggests that they may be involved in pH regulation of expression of these genes. Variation among Aspergillus isolates in retention of these PacC sites provides an opportunity for empirical evaluation of the role of PacC in transcriptional control of aflR. A consensus AflR-binding site near the aflJ ORF (Table 5) is present in all isolates except A. nomius, suggesting that, aflJ, like most of the genes in the aflatoxin biosynthetic pathway, is usually regulated by AflR. A. bombycis and A. pseudotamarii isolates have a second AflR recognition site slightly further upstream. Since aflJ is also involved in regulation of aflatoxin pathway biosynthesis (Chang et al., 2000; Ehrlich et al., 1999b; Meyers et al., 1998), variability in regulation of aflJ could serve as an important checkpoint on production of aflatoxins. 4.2. Coding region diversity As expected, several portions of the coding region were highly conserved among all of the isolates examined. These included the DNA-binding domain [Cys6 Zn2 sequence and linker region (Ehrlich et al., 1998)] and domain(s) within 60 amino acids of the carboxy terminus shown to be required for transcription activation (Chang et al., 1999; Matsushima et al., 2001). The His-rich region that occurs after the linker region varies in size among the different species. Such histidine repeat regions are found in a number of eukaryotic transcription factors and may be involved in pH-controlled protein–protein interactions (Janknect et al., 1991). Differences in length of these repeats among AflRs could be important in determining AflR activity at different pHs. The serine-rich region (Fig. 1, Table 5) in AflRs from A. nomius and A. bombycis is a distinct PEST (proline, glutamine, serine, and threonine-rich region) sequence that may be a target for phosphorylation and ubiquitin-mediated proteolysis (Rechsteiner, 1988). A. nomius isolates (except N16) have a second PEST domain (HPPPPPQSDQPPH, PEST score ¼ +15). No comparable region exists in AflRs from other 71 species. PEST scores for these regions (+12 to +18) were comparable to scores of +10 to +13 for known PEST domains in other transcription factors (Suske, 1999). Most proteins with PEST sequences are regulatory molecules that require fast turnover for proper function. The PEST sequences in A. nomius and A. bombycis either may reflect regulatory mechanisms different from other aflatoxin-producing taxa or may be non-functional remnants of an ancestral mechanism to regulate cellular levels of AflR at the post-transcriptional level. Ancestors of A. flavus and A. parasiticus may have developed strategies to control protein production at the transcriptional level by developing in their promoter regions increased numbers of certain transcriptional modulatory sites sensitive to the environment, such as GATA and PacC sites. The latter strategy avoids the production of excess protein and may provide an energy advantage over fungi lacking such sites. 4.3. Phylogenetic analysis In general, phylogenetic analyses inferred clades corresponding to previously described species and/or strains (Cotty and Cardwell, 1999; Ito et al., 2001; Peterson et al., 2001). Similar distal monophyletic groupings were obtained with either the aflJ/aflR intergenic region sequence or inferred AflR protein sequence data sets. Comprehensive surveys of phylogenetic relationships in Aspergillus section Flavi (using 5S RNA internal transcribed spacer, ITS, sequence data and a distantly related species as the outgroup) suggested that A. nomius diverged prior to A. parasiticus, A. pseudotamarii, and A. flavus (Peterson, 1997; Ito et al., 2001; Peterson et al., 2001). A comparison of A. bombycis and A. nomius in which the non-aflatoxin producing species A. carbonarius was chosen as the outgroup, suggested that A. bombycis diverged prior to A. nomius (Peterson et al., 2001). Based on these comparisons we chose A. bombycis as the outgroup in the present study. If A. parasiticus was selected as the outgroup, the trees obtained showed phylogenetic relationships for A. flavus isolates closely resembling those previously found (Geiser et al., 1998, 2000). Tree topologies for the aflJ/aflR intergenic and the aflR coding regions were significantly incongruent based on the PHT, but only when certain A. nomius clades and A. bombycis were included in the analysis. Incongruence was not found when A. nomius isolates were examined independently from the other taxa (Table 6). In a study of incongruence and phylogenetic accuracy, Cunningham found that when the PHT resulted in P > 0:01, the combined data better reflected the phylogenetic signal than the data of the individual partitions (Cunningham, 1997). Thus, from the present PHT results (Table 6), trees based on the combined coding region and intergenic region data sets are probably the best representation of 72 K.C. Ehrlich et al. / Fungal Genetics and Biology 38 (2003) 63–74 the phylogenetic signal within the examined data. The apparent incongruence observed here between the coding region and intergenic region data sets with PHT was supported by the results of the KH test. The KH test indicated that the topology of the intergenic region tree was not a good fit for the coding region data set. These tests suggest that there may be differences between the phylogenetic signals within the two data sets. The differences may have resulted from differential convergence or transfer of genetic material between closely related clades of A. nomius and possibly, between A. nomius and A. bombycis. Peterson had previously made similar observations within A. nomius (Peterson et al., 2001). The need to express genes for aflatoxin biosynthesis in new environments may require adaptation via changes in promoter sequence that allow recognition by transcription factors that mediate response to environmental signals. Indeed, the topology of the MP tree for transcription factor recognition sites is not a good fit for the entire intergenic region data set by the KH test. Convergence among promoter elements may have occurred while the non-regulatory portions of the intergenic region retained divergent characters. Phylogenetic affiliations not described by current taxonomic schemes were also discovered in our analyses. An example is isolate N16 from Brazil nut imported into the US. This isolate was previously reported as a divergent A. nomius (Egel et al., 1994). Sequence comparison indicates that N16 is more closely related to A. bombycis. However, it is not clear that isolate N16 fits entirely within the A. bombycis species concept. Although N16 has smooth stipes and spores similar to A. bombycis, it produces large, elongate sclerotia (illustrated in Cotty et al., 1994)), whereas A. bombycis produces no sclerotia (Peterson et al., 2001). N16 would be the only A. bombycis isolate from a plant and the only one originating from South America. Isolate N16 shares highly supported clades with the A. bombycis isolates in both the intergenic region DNA and protein sequence trees, but differs in some regulatory features such as having seven GATA sites versus the five in A. bombycis isolates. Isolate N16 may belong to a South American lineage that has a relatively recent ancestor in common with A. bombycis. Differences in potentially adaptive traits (sclerotial morphology, aflatoxin regulation) may indicate that the lineage of N16 was exposed over time to different selective pressures than the lineage leading to the previously described A. bombycis isolates, as might be expected for an isolate from plant compared to isolates from insect debris. A. nomius isolates, other than N16, formed several distinct clades in both trees. In agreement with previous observations (Feibelman et al., 1998), the three A. nomius O-strain isolates (N17–19), which are morphologically and physiologically distinct from other A. nomius strains, were placed in the same clade as the ex- type A. nomius (N15). However, the O-strain isolates accumulate less aflatoxin than the other isolates in this clade. Some of the North American isolates are more closely related to isolates from either the Philippines (N23) or West Africa (N20–22) than to two isolates from Mississippi (N13 and N14). Although, delineation of a clade solely occupied by the three A. nomius from West Africa (N20–22) reveals geographic structure and possible allopatric speciation, not all of the cladal separations of A. nomius are clearly allopatric. Aflatoxin-producing species are commonly divided into those producing both B and G aflatoxins and those producing only B aflatoxins (Table 1). Our phylogenetic analysis suggests that the ability to produce both B and G aflatoxins is the ancestral trait and that loss of G aflatoxin production occurred at two separate times among extant Aspergillus lineages. Loss occurred once in the lineage leading to A. pseudotamarii and a second time in the lineage leading to A. flavus L and SB . From the current data, we cannot determine if failure to produce G aflatoxins is through similar mechanisms for the two lineages. The phylogenetic analyses presented here separate A. flavus SB and L isolates into distinct clades in agreement with previous analyses (Bayman and Cotty, 1991; Cotty, 1997; Geiser et al., 2000), and also reinforce previous observations that these A. flavus morphotypes are far less closely related to the SBG isolates than to each other or to A. parasiticus (Egel et al., 1994). RAPD polymorphisms, sclerotial morphology, and the differential ability to produce aflatoxins (Bayman and Cotty, 1991; Cotty, 1997) have also supported delineation of S and L isolates into separate clades. Results of the current study concur with previous results which suggested that the SBG isolates are distinct from A. flavus (Hesseltine et al., 1970; Egel et al., 1994; Geiser et al., 2000). Efforts should be made to place SBG isolates into a systematically distinct taxon. Acknowledgments The authors wish to thank Pamela Harris, Darlene Downey, and Kerrilee Kobbeman for their excellent technical assistance. Thanks are also extended to Dr. Bruce Campbell, USDA-Western Regional Research Center, and anonymous reviewers for their helpful advice in preparing the manuscript. References Adams, T.H., Boylan, M.T., Timberlake, W.E., 1988. brlA Is necessary and sufficient to direct conidiophore development in Aspergillus nidulans. Cell 54, 353–362. K.C. Ehrlich et al. / Fungal Genetics and Biology 38 (2003) 63–74 Adams, T.H., Deising, H., Timberlake, W.E., 1990. brlA Requires both zinc fingers to induce development. Mol. Cell. Biol. 10, 1815– 1817. Adye, J., Mateles, R.I., 1964. Incorporation of labelled compounds into aflatoxins. Biochim. Biophys. Acta 86, 418–420. Andrianopoulos, A., Timberlake, W.E., 1994. The Aspergillus nidulans abaA gene encodes a transcriptional activator that acts as a genetic switch to control development. Mol. Cell. Biol. 14, 2503– 2515. Barnes, S.E., Dola, T.P., Bennett, J.W., Bhatnagar, D., 1994. Synthesis of sterigmatocystin on a chemically defined medium by species of Aspergillus and Chaetomium. Mycopathologia 125, 173– 178. Bayman, P., Cotty, P.J., 1991. Vegetative compatibility and genetic diversity in the Aspergillus flavus population of a single field. Can. J. Bot. 69, 1707–1711. Bayman, P., Cotty, P.J., 1993. Genetic diversity in Aspergillus flavus: association with aflatoxin production and morphology. Can. J. Bot. 71, 23–31. Bhatnagar, D., McCormick, S.P., Lee, L.S., Hill, R.A., 1987. Identification of O-methylsterigmatocystin as an aflatoxin B1 and G1 precursor in Aspergillus parasiticus. Appl. Environ. Microbiol. 53, 1028–1033. Boulikas, T., 1993. Nuclear localization signals (NLS). Crit. Rev. Eukaryot. Gene Express. 3, 193–227. Chang, P.-K., Ehrlich, K.C., Yu, J., Bhatnagar, D., Cleveland, T.E., 1995. Increased expression of Aspergillus parasiticus aflR, encoding a sequence-specific DNA-binding protein, relieves nitrate inhibition of aflatoxin biosynthesis. Appl. Environ. Microbiol. 61, 2372– 2377. Chang, P.K., Yu, J., Bhatnagar, D., Cleveland, T.E., 1999. The carboxy-terminal portion of the aflatoxin pathway regulatory protein AFLR of Aspergillus parasiticus activates GAL1::lacZ gene expression in Saccharomyces cerevisiae. Appl. Environ. Microbiol. 65, 2508–2512. Chang, P.K., Yu, J., Bhatnagar, D., Cleveland, T.E., 2000. Characterization of the Aspergillus parasiticus major nitrogen regulatory gene, areA. Biochim. Biophys. Acta 1491, 263–266. Cotty, P., 1988. Aflatoxin and sclerotial production by Aspergillus flavus: influence of pH. Phytopathology 78, 1250–1253. Cotty, P.J., 1989. Virulence and cultural characteristics of two Aspergillus flavus strains pathogenic on cotton. Phytopathology 79, 808–814. Cotty, P.J., 1997. Aflatoxin-producing potential of communities of Aspergillus section Flavi from cotton producing areas in the United States. Mycol. Res. 101, 698–704. Cotty, P.J., Bayman, D.S., Egel, D.S., Elias, K.S., 1994. Agriculture, aflatoxins and Aspergillus. In: Powell, K. (Ed.), The Genus Aspergillus. Plenum Press, New York, pp. 1–27. Cotty, P.J., Bhatnagar, D., 1994. Variability among atoxigenic Aspergillus flavus strains in ability to prevent aflatoxin contamination and production of aflatoxin biosynthetic pathway enzymes. Appl. Environ. Microbiol. 60, 2248–2251. Cotty, P.J., Cardwell, K.F., 1999. Divergence of West African and North American communities of Aspergillus section Flavi. Appl. Environ. Microbiol. 65, 2264–2266. Cunningham, C.W., 1997. Can three incongruence tests predict when data should be combined? Mol. Biol. Evol. 14, 733–740. Dorner, J.W., Cole, R.J., Diener, U.L., 1984. The relationship of Aspergillus flavus and Aspergillus parasiticus with reference to production of aflatoxins and cyclopiazonic acid. Mycopathologia 87, 13–15. Egel, D.S., Cotty, P.J., Elias, K.S., 1994. Relationships among isolates of Aspergillus sect. flavi that vary in aflatoxin production. Phytopathology 84, 906–912. Ehrlich, K.C., Cary, J.W., Montalbano, B.G., 1999a. Characterization of the promoter for the gene encoding the aflatoxin biosynthetic 73 pathway regulatory protein AFLR. Biochim. Biophys. Acta 1444, 412–417. Ehrlich, K.C., Cotty, P.J., 2000. Variability in nitrogen regulation of aflatoxin production by Aspergillus flavus strains. In: 101st General Meeting, Orlando, FL, May 20–24. American Society of Microbiology, p. 533. (Abst O1). Ehrlich, K.C., Montalbano, B.G., Bhatnagar, D., Cleveland, T.E., 1998. Alteration of different domains in AFLR affects aflatoxin pathway metabolism in Aspergillus parasiticus transformants. Fungal Genet. Biol. 23, 279–287. Ehrlich, K.C., Montalbano, B.G., Cary, J.W., 1999b. Binding of the C6-zinc cluster protein, AFLR, to the promoters of aflatoxin pathway biosynthesis genes in Aspergillus parasiticus. Gene 230, 249–257. Espeso, E.A., Arst Jr., H.N., 2000. On the mechanism by which alkaline pH prevents expression of an acid-expressed gene. Mol. Cell. Biol. 20, 3355–3363. Farris, J.S., Kallersjo, M., Kluge, A.G., Bult, C., 1994. Testing significance of incongruence. Cladistics 10, 315–320. Feibelman, T.P., Cotty, P.J., Doster, M.A., Michailides, T.J., 1998. A morphologically distinct strain of Aspergillus nomius. Mycologia 90, 618–623. Frisvad, J.C., 1985. Secondary metabolites as an aid to Emericella classification. In: Samson, R.A., Pitt, J.I. (Eds.), Advances in Penicillium and Aspergillus Systematics. Plenum Press, New York, pp. 430–437. Geiser, D.M., Dorner, J.W., Horn, B.W., Taylor, J.W., 2000. The phylogenetics of mycotoxin and sclerotium production in Aspergillus flavus and Aspergillus oryzae. Fungal Genet. Biol. 31, 169– 179. Geiser, D.M., Pitt, J.I., Taylor, J.W., 1998. Cryptic speciation and recombination in the aflatoxin-producing fungus, Aspergillus flavus. Proc. Natl. Acad. Sci. USA 95, 388–393. Hesseltine, C.W., Sorenson, W.G., Smith, M., 1970. Taxonomic studies of the aflatoxin-producing strains in the Aspergillus flavus group. Mycologia 62, 123–132. Hicks, J.K., Yu, J.H., Keller, N.P., Adams, T.H., 1997. Aspergillus sporulation and mycotoxin production both require inactivation of the FadA G alpha protein-dependent signaling pathway. EMBO J. 16, 4916–4923. Ito, Y., Peterson, S.W., Wicklow, D.T., Goto, T., 2001. Aspergillus pseudotamarii a new aflatoxin producing species in Aspergillus section Flavi. Mycol. Res. 105, 233–239. Janknect, R., Sander, C., Pongs, O., 1991. (HX)n repeats: a pHcontrolled protein–protein interaction motif of eukaryotic transcription factors. FEBS Lett. 295, 1–2. Keller, N.P., Nesbitt, C., Sarr, B., Phillips, T.D., Burow, G.B., 1997. pH regulation of sterigmatocystin and aflatoxin biosynthesis in Aspergillus spp. Phytopathology 87, 643–648. Kishino, H., Hasegawa, M., 1989. Evaluation of the maximum liklihood estimate of the evolutionary tree topologies from DNA sequence data, and the branching of the Hominoidea. J. Mol. Evol. 29, 170–179. Kurtzman, C.P., Horn, B.W., Hesseltine, C.W., 1987. Aspergillus nomius, a new aflatoxin-producing species related to Aspergillus flavus and Aspergillus tamarii. Antonie Van Leeuwenhoek 53, 147– 158. Matsushima, K., Chang, P.K., Yu, J., Abe, K., Bhatnagar, D., Cleveland, T.E., 2001. Pre-termination in aflR of Aspergillus sojae inhibits aflatoxin biosynthesis. Appl. Microbiol. Biotechnol. 55, 585–589. Meyers, D.M., Obrian, G., Du, W.L., Bhatnagar, D., Payne, G.A., 1998. Characterization of aflJ, a gene required for conversion of pathway intermediates to aflatoxin. Appl. Environ. Microbiol. 64, 3713–3717. Muro-Pasteur, M.I., Gonzalez, R., Strauss, J., Narendja, F., Scazzocchio, C., 1999. The GATA factor AreA is essential for chromatin 74 K.C. Ehrlich et al. / Fungal Genetics and Biology 38 (2003) 63–74 remodelling in a eukaryotic bidirectional promoter. EMBO J. 18, 1584–1597. Peterson, S.W., 1997. Phylogenetic relationships in Aspergillus based on rDNA sequence analysis. In: Samson, R.A., Pitt, J.I. (Eds.), Classification of Penicillium and Aspergillus: Integration of Modern Taxonomic Methods. Harwood Publishers Reading, UK, pp. 323– 356. Peterson, S.W., Ito, Y., Horn, B.W., Goto, T., 2001. Aspergillus bombycis, a new aflatoxigenic species and genetic variation in its sibling species, A. nomius. Mycologia 93, 689–703. Rambo, G.W., Tuite, J., Crane, P., 1974. Preharvest Inoculation and infection of Dent corn ears with Aspergillus flavus and A. parasiticus. Phytopathology 64, 797–800. Ravagnani, A., Gorfinkiel, L., Langdon, T., Diallinas, G., Adjadj, E., Demais, S., Gorton, D., Arst Jr., H.N., Scazzocchio, C., 1997. Subtle hydrophobic interactions between the seventh residue of the zinc finger loop and the first base of a HGATAR sequence determine promoter-specific recognition by the Aspergillus nidulans GATA factor AreA. EMBO J. 16, 3974–3986. Rechsteiner, M., 1988. Regulation of enzyme levels by proteolysis: the role of PEST regions. Adv. Enzyme Regul. 27, 135–151. Reece, R.J., Ptashne, M., 1993. Determinants of binding-site specificity among yeast C6 zinc cluster proteins. Science 261, 909–911. Robens, J., 2001. The costs of mycotoxin management to the USA: management of aflatoxins in the United States. APSnet Feature http://www.apsnet.org/online/feature/mycotoxin/top.html 2–8. Rogers, R., Wells, R., Rechsteiner, M., 1986. Amino acid sequences common to rapidly degraded proteins: the PEST hypothesis. Science 234, 364–368. Saito, M., Tsuruta, O., 1993. A new variety of A. flavus from tropical soil in Thailand and its aflatoxin productivity. Proc. Jpn. Assoc. Mycotoxicol. 37, 31–36. Schier, N., Liese, R., Fischer, R., 2001. A Pcl-like cyclin of Aspergillus nidulans is transcriptionally activated by developmental regulators and is involved in sporulation. Mol. Cell. Biol. 21, 4075–4088. Sewall, T.C., 1994. Cellular effects of misscheduled brlA, abaA, and wetA expression in Aspergillus nidulans. Can. J. Microbiol. 40, 1035–1042. Suske, G., 1999. The Sp-family of transcription factors. Gene 238, 291–300. Swofford, D.L., 1998. PAUP*. Phylogenetic analysis using parsimony (*and other methods). Sinauer Associates, Sunderland, MA. Trail, F., Mahanti, N., Rarick, M., Mehigh, R., Liang, S.H., Zhou, R., Linz, J.E., 1995. Physical and transcriptional map of an aflatoxin gene cluster in Aspergillus parasiticus and functional disruption of a gene involved early in the aflatoxin pathway. Appl. Environ. Microbiol. 61, 2665–2673. Yu, J., Chang, P.K., Cary, J.W., Wright, M., Bhatnagar, D., Cleveland, T.E., Payne, G.A., Linz, J.E., 1995. Comparative mapping of aflatoxin pathway gene clusters in Aspergillus parasiticus and Aspergillus flavus. Appl. Environ. Microbiol. 61, 2365– 2371.
