* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Poster - Department of Entomology
Genomic library wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Epigenomics wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
DNA supercoil wikipedia , lookup
Genome evolution wikipedia , lookup
Molecular cloning wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Designer baby wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Non-coding DNA wikipedia , lookup
Metagenomics wikipedia , lookup
Microsatellite wikipedia , lookup
Koinophilia wikipedia , lookup
Genome editing wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
History of genetic engineering wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Microevolution wikipedia , lookup
ATCCCGCTTTGATATCCGGCTTGAGTCGGTGTGTGCCAACGCGATATGACGGACGTGTGTGCGAGGGTCTCAACTACAGGGATTAGATAGATGATATT TTAGATATTAGAGGAAAAGAGAGGGGAGCGACGAGGCGAGGGCGAGCTGTAGCTACGGGATCATGCATGCGAAGGGATCGAGCTGACCCACACAC mtDNA Barcoding for Taxonomic Identification within the Genus Agrilus CCGCGGCGCGGCATATGCATCTCTCTCAGCGAGAGACATATATATACGATTTTTTATGAGAGTAGCAGGAGGCGAGGCCCCGAGCGCGAGATATATAA John T. Shukle and Jeffrey D. Holland AATATAGAGAATAGTATTTTTTAGATATACGCCGCGAGCGCGCGGCGCGCTATATATATATTCTCGCTACGATGTAGCATCGATGCAGATGCGATTATATAT Department of Entomology, College of Agriculture, Purdue University, 901 West State Street, West Lafayette, IN 47907, USA (4/04/07) ATGATTATTGGCTAGCTATGCGCGGCGATGGAGACATATATATACGATTTTTTATGAGAGTAGCAGGAGGCGAGGCCCCGAGCGCGAG Introduction Taxonomic Relationships Sequence Variation 0.01 H. memnonius H_memnonius fuscipennis % Occurrence A. fuscipennis Between Species Within Species 60 A. cephalicus cephalicus1 A. cyanescens Concepts of Barcoding % Occurrence Ecological studies are constantly refining our image of what an ecosystem is and how it works; however, these studies are often complicated and time consuming due to several limiting factors, one of which is the need for species level identifications. Studies involving insects especially rely on fast and accurate identification. Unfortunately, many groups of insects require a high level of expertise to identify to the species level. Insects have a major effect on natural ecosystems, either by driving ecosystem services or as disruptive invasive species. There is a clear need for a faster method of species identification within these important groups of organisms. The main objectives of my research are: 1. Test the hypothesis that a standard DNA sequence can differentiate species within the genus Agrilus, and 2. Develop a searchable DNA barcode database for the genus in the Midwest. % Sequence Variation cyanescens % Sequence Variation 61 DNA barcoding uses sequences of DNA to identify species based on base pair comparisons. While the concepts behind DNA barcoding should work for most rapidly evolving genes, mitochondrial genes have become the preferred choice because of their maternal inheritance, low recombination potential, and Mitochondrial lack of insertions and deletions. Within the DNA strands mitochondrial genome the cytochrome c oxidase I (COI) gene was chosen as a standard for DNA barcoding because of the presence of robust primer locations. One of the main advantages of DNA barcoding is the ability to identify an individual to species using very small amounts of tissue, for example, a single insect leg or the base of a bird’s feather. While initial studies have proven the effectiveness of barcoding as a tool for Fig. 1. Mitochondria contain large numbers species identification, the validity of the technique still of replicates of their circular genomes. This provides an excellent amount of needs to be tested at finer resolutions. I chose to test starting template for PCR reactions. this technique within the genus Agrilus. 100 A. lacustris A. celti 60 A. planipennis DNA was extracted from three legs of specimens collected on purple sticky traps or from museum specimens, using either a Qiagen DNeasy kit or a modified version of the method of Lis et al. (1983). Some museum specimens were more than forty years old. PCR reactions followed the protocol described by Hebert et al. (2002). Forward and reverse primers from Hebert et al. (2002) were used to amplify the full 708 bp barcoding region. For amplification from degraded DNA, degenerate 1 Fresh 2 Dried versions of primers from Simon et al. (1994) were used to recover 369 bp and 480 bp 1 Kb 1 Kb A A overlapping fragments internal to the barcoding B B C C region (Fig. 3). DNA was direct sequenced bidirectionally through either MWG Biotech or the low throughput genomics facility at Purdue. Fig. 3. The success of PCR amplification depended Pairwise sequence comparisons were done in on the quality of the template DNA: 1. Fresh PAUP. The program Clustal X was used for collected A. planipennis; 2. Dried specimen of A. multiple sequence alignments and to generate a bilineatus. Three sets of primers were used to neighbor-joined tree. Overlapping fragments amplify either (A) the whole 708 bp barcoding were merged using the Merger tool in EMBOSS. region, or two overlapping internal fragments of (B) 480 bp and (C) 369 bp respectively. A. bilineatus While DNA barcoding is primarily a tool for species identification, barcode-based trees can provide a preliminary phylogenetic placement for species. The number of taxa (species) supported by a tree based on barcode sequence data is related to the number of determining characters within the sequence. Therefore, the longer the sequence the more taxa can be successfully placed. cladrastis1 planipennis A. ferrisi 41 DNA barcoding using the cytochrome c oxidase I (COI) gene will allow species identification within the genus Agrilus. This will allow the positive identification of not only Agrilus males but females, larvae, and eggs. celti A. cladrastis Biology of the Agrilus Methods Conclusions 58 60 The genus Agrilus is the largest genus within the family Buprestidae, order Coleoptera, and contains nearly 3,000 described species. Agrilus larvae are borers that feed on the living tissue of their host. Most species attack the cambial tissue of woody trees or shrubs, although a few species do feed on herbaceous plants, generally attacking root or stem tissue. In native habitats Agrilus target stressed or dying host plants, providing an ecosystem service by eliminating diseased individuals of a population. However, when introduced into ecosystems where host plants lack co-evolutionary resistance, or where natural predators and parasites are absent, they can Fig. 2. Galleries in oak caused become severe pests. The recent infestation of Emerald Ash by A. bilineatus. High levels of infestation girdle the host tree. Borer, Agrilus planipennis, is an excellent example of this. lacustris1 ferrisi Availability of good quality specimens for initial DNA extraction seems to be a major limiting factor in studies of this kind. The ability to amplify DNA from archived specimens provides a large sample size to begin barcoding, along with demonstrating the value of collections. bilineatus 37 A. ruficollis Future research will involve expanding the number of species within the database. Currently I have sequence data for 31 of the approximately 70 species of Agrilus native to Indiana and the surrounding Midwest. Once complete, a DNA barcode database of native Agrilus species could be used to identify unknown samples or facilitate ecological studies. ruficollis 67 SCALE 1.0% A. vittaticollis Divergence vittaticollis B A Fig. 4. Phylogram showing the taxonomic relationships of 11 species of Agrilus based on full (708 bp) and micro (369 bp) mtDNA barcodes. For distance/neighbor-joining analysis 1000 bootstrap replicates were performed. The values at nodes refer to the percentage of replications supporting each node. The click beetle H. memnonius was used as an outgroup. LCOF 1490* 5` 1401 Ag1718F° COI 708 bp Barcoding Region Ag1859R° Fig. 6. Larva of A. bilineatus showing the characteristic morphology for the genus 3` 2942 Summary Recent studies have shown the efficacy of mtDNA barcoding to differentiate morphologically similar species. I used a 708 bp fragment internal in the cytochrome c oxidase I (COI) gene to evaluate the effectiveness of this technique within the genus Agrilus. Results indicate that mtDNA barcoding using the COI gene will provide a viable method to distinguish between species in the genus. Acknowledgements HCOR 2198* Barcoding Region This work was supported through undergraduate research scholarships from the Purdue College of Agriculture. Additional financial support came from the Department of Entomology. Specimens and identification material were generously provided by Arwin Provonsha. Gene Coding Regions Forward Primer Reverse Primer tRNA Coding Regions Control Region Fig. 5. The order of genes on the mitochondrial genome of Tribolium. The enlarged region shows the position of the barcoding region within the COI gene and positions of forward and reverse primers. * Indicates primers from Hebert et al. (2002). ° Indicates degenerate versions of primers from Simon et al. (1994). mtDNA Genome References Hebert, Paul D. N, et al. 2002. “Biological identifications through DNA barcodes.” Proc. R. Soc. Lond. Online. Lis, J. T., et al. 1983. “New heat shock puffs and β-galactosidase activity from transformation of Drosophila with an hsp70lacZ hybrid gene.” Cell 35:403-410. Simon, N., et al. 1994. “Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann. Entomol. Soc. Am. 87:651-70.