Download International Journal of Antimicrobial Agents Mechanism of drug

International Journal of Antimicrobial Agents 34 (2009) 220–225
Contents lists available at ScienceDirect
International Journal of Antimicrobial Agents
journal homepage: http://www.elsevier.com/locate/ijantimicag
Mechanism of drug resistance in a clinical isolate of Vibrio fluvialis:
involvement of multiple plasmids and integrons
Neha Rajpara a , Arati Patel a , Neha Tiwari a , Jyotsana Bahuguna a , Anita Antony a ,
Ipsita Choudhury a , Anuradha Ghosh b , Rakesh Jain b , Amit Ghosh a , Ashima Kushwaha Bhardwaj a,∗
a
Department of Human Health and Diseases, School of Biological Sciences and Biotechnology, Indian Institute of Advanced Research, Koba Institutional Area,
Gandhinagar 382 007, Gujarat, India
Institute of Microbial Technology, Sector 39-A, Chandigarh 160 036, India
b
a r t i c l e
i n f o
Article history:
Received 17 February 2009
Accepted 26 March 2009
Keywords:
Vibrio fluvialis
Vibrio cholerae
Plasmid
Integron
Multidrug resistance
Mobile genetic elements
a b s t r a c t
The role of mobile genetic elements in imparting multiple drug resistance to a clinical isolate of Vibrio
fluvialis (BD146) was investigated. This isolate showed complete or intermediate resistance to all of the
14 antibiotics tested. Polymerase chain reaction (PCR) revealed the presence of a class 1 integron and the
absence of the SXT element in this isolate. The strain harboured a 7.5 kb plasmid and a very low copy
number plasmid of unknown molecular size. Transformation of Escherichia coli with plasmid(s) from
BD146 generated two kinds of transformants, one that harboured both of these plasmids and the other
that harboured only the low copy number plasmid. PCR and antibiogram analysis indicated the association
of the class 1 integron with the low copy number plasmid, which also conferred all the transferable
resistance traits except trimethoprim to the parent strain. A BLAST search with the sequence of the 7.5 kb
plasmid showed that it was 99% identical to plasmid pVN84 from Vibrio cholerae O1 in Vietnam, indicating
that these two plasmids are probably one and the same. To the best of our knowledge, this is the first
report of horizontal transfer of a plasmid between V. fluvialis and V. cholerae.
© 2009 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.
1. Introduction
Vibrio fluvialis, a Gram-negative bacterium, is a food-borne
pathogen that causes gastroenteritis that is clinically indistinguishable from cholera [1–4]. Information regarding this human
pathogen is limited because the enteritis caused by this organism
is not as frequent as that caused by Vibrio cholerae [5]. However,
in recent years it is being isolated with greater frequency from
patients with cholera-like illness, many of which display multiple drug resistance [5–8]. There are several different mechanisms
by which bacteria are known to acquire drug resistance, and bacteria often combine more than one mechanism to increase the
efficacy of their defensive shield against an antibiotic. The genes
responsible often reside on mobile genetic elements for easy dissemination of drug resistance to other organisms. Integrons, which
are the gene capture systems that integrate gene cassettes, usually
antibiotic resistance genes, often reside on chromosomes or plasmids [9–11]. The role of integrons in the capture and dissemination
of antibiotic resistance genes has been well documented in Gramnegative bacteria [12–14]. Class 1 integrons are found to be most
∗ Corresponding author. Tel.: +91 79 3051 4235; fax: +91 79 3051 4110.
E-mail address: [email protected] (A.K. Bhardwaj).
frequently associated with clinical isolates. Besides integrons, conjugative transposons, such as the SXT element [15,16], have been
shown to be vehicles for drug resistance markers for sulfamethoxazole, trimethoprim, chloramphenicol and streptomycin in many
isolates of vibrios, including V. fluvialis [7,8,17–20]. Although a few
reports on multiple drug resistance due to these mobile genetic
elements exist in V. cholerae, there is a paucity of information in V.
fluvialis [5–8]. Until now there has been no report on the role of
plasmids in multiple drug resistance in V. fluvialis. It is in this context that we investigated the role of plasmids, integrons and SXT
in the drug resistance of a clinical isolate of V. fluvialis isolated in
Kolkata, India, in 2002. This paper describes the results of these
studies.
2. Materials and methods
2.1. Bacterial strains
Vibrio fluvialis strains BD146, BD81 and PL78/6, isolated from
patients with acute cholera-like diarrhoea admitted to the Infectious Diseases Hospital, Kolkata, India, between 1998 and 2002
were kindly provided by Dr T. Ramamurthy [National Institute of
Cholera and Enteric Diseases (NICED), Kolkata, India]. Escherichia
coli JM109 was used for electroporation experiments.
0924-8579/$ – see front matter © 2009 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.
doi:10.1016/j.ijantimicag.2009.03.020
N. Rajpara et al. / International Journal of Antimicrobial Agents 34 (2009) 220–225
221
Table 1
Primers used in the study.
Primer
Sequence (5 → 3 )
Accession no.
Primer position
Reference
L2
L3
qacE1-F
Sul1-B
In-F
In-B
SXT-F
SXT-B
Vcint-F
Vcint-R
GACGATGCGTGGAGACC
CTTGCTGCTTGGATGCC
ATCGCAATAGTTGGCGAAGT
GCAAGGCGGAAACCCGCC
GGCATCCAAGCAGCAAGC
AAGCAGACTTGACCTGAT
TTATCGTTTCGATGGC
GCTCTTCTTGTCCGTTC
CCTAGCTCTTGAGAAATAATCG
CTCACGAATGTAAACAAAGC
M73819
M73819
X15370
X12869
U12338
U12338
AF099172
AF099172
EU574928
EU574928
910–926
1206–1190
211–230
1360–1341
1416–1433
4831–4814
129–144
915–931
194–215
851–832
[22]
[22]
[23]
[23]
[23]
[23]
[20]
[20]
This study
This study
2.2. Antimicrobial susceptibility testing and minimal inhibitory
concentration (MIC) determination
Vibrio fluvialis BD146 and its transformants were tested for
susceptibility to 14 antibiotics by the disk diffusion method
using commercial disks (HiMedia, Mumbai, India) in accordance
with Clinical and Laboratory Standards Institute (CLSI) standards
[21]. The antibiotics tested were ampicillin (10 ␮g), chloramphenicol (30 ␮g), co-trimoxazole (1.25 ␮g trimethoprim/23.75 ␮g
sulfamethoxazole), ciprofloxacin (5 ␮g), gentamicin (10 ␮g), streptomycin (10 ␮g), sulfisoxazole (300 ␮g), trimethoprim (5 ␮g),
tetracycline (30 ␮g), neomycin (30 ␮g), nalidixic acid (30 ␮g), norfloxacin (10 ␮g), kanamycin (30 ␮g) and rifampicin (5 ␮g). MIC
determination was performed using the HiComb MIC test (HiMedia) as per the manufacturer’s instructions. Interpretation of the
results for both experiments was done using the criteria recommended by the CLSI. Escherichia coli ATCC 25922 was used for
quality control. Experiments were performed in triplicate.
2.3. Bacterial genomic and plasmid DNA extraction
Genomic and plasmid DNA extraction was performed as
described previously [20]. For large-scale purification of DNA, a QIAGEN Plasmid Maxi Kit (QIAGEN GmbH, Hilden, Germany) was used
exactly as described by the manufacturers.
2.4. Bacterial transformation
Transformation of E. coli JM109 was carried out by electroporation (Gene Pulser XCell; Bio-Rad Laboratories, Richmond, CA)
with 150 ng of Qiagen-purified DNA from V. fluvialis. Transformants
were selected on Luria–Bertani (LB) plates containing ampicillin
(25 ␮g/mL). A single colony from glycerol stock of the transformants streaked on LB + ampicillin (25 ␮g/mL) plates, or the
parent Vibrio strain streaked on an LB plate, was grown in liquid
medium and tested for its antibiotic resistance profile as described
above.
2.5. Polymerase chain reaction (PCR)
Genomic DNA (100–200 ng) or plasmid DNA (10–50 ng) was
used as the template in PCR. Each PCR involved an initial denaturation at 95 ◦ C for 4 min, followed by 25–30 amplification cycles
each consisting of an initial denaturation at 95 ◦ C for 0.5 min followed by annealing and extension steps. Final polymerisation was
carried out at 72 ◦ C for 10 min. Four sets of primers [20,22,23] were
used in the PCR for analysis of class 1 integrons (Table 1) and amplifications were carried out as described previously [20], except for
the primer pair In-F/In-B where annealing was carried out at 60 ◦ C
for 2 min. For primers Vcint-F/Vcint-R, annealing (52 ◦ C, 1 min) and
extension (72 ◦ C, 1 min 30 s) steps were carried out. For SXT PCR,
primers based on SXT integrase were used (Table 1). Similar conditions were used for PCR except for annealing (50 ◦ C, 2 min) and
extension (72 ◦ C, 1 min 30 s). PCR reactions were performed using a
PTC-225 DNA Engine TetradTM Cycler (MJ Research Inc., Waltham,
MA). Recombinant Taq polymerase (Fermentas International Inc.,
Burlington, Ontario, Canada) was used along with the buffer containing ammonium sulphate, and magnesium chloride was added
at a final concentration of 2 mM.
2.6. Sequencing of the plasmid DNA or the integron cassettes
Native plasmid from BD146 (pBD146) was sequenced by subcloning in the pBluescript vector at the KpnI site as a single insert.
Primer walking was carried out to cover the whole sequence and the
sequence was assembled. For sequencing of gene cassettes amplified from the variable region of the integrons using the In-F/In-B
primer pair, the amplicon (0.4 kb) was cloned in pDrive vector (Qiagen) whereas direct sequencing of the 4.0 kb amplicon was carried
out by primer walking.
2.7. Analysis of DNA sequences
The assembled sequence of pBD146 was analysed by a BLAST
search. The ORF (Open Reading Frame) Finder tool at the
National Center for Biotechnology Information (NCBI) website
(http://www.ncbi.nlm.nih.gov/gorf/gorf.html) was used to predict
all the possible ORFs in the pBD146 sequence or the integron cassettes (4.0 kb and 0.4 kb).
3. Results
3.1. Characterisation of strain BD146 and its plasmids
The antimicrobial resistance pattern of strain BD146 revealed
that it was resistant to 12 of the 14 antibiotics and showed
intermediate resistance to the remaining 2 (chloramphenicol and
tetracycline) (Table 2). To see whether these markers were carried
by plasmid(s), experiments were carried out to detect the presence
of plasmids in this strain. Agarose gel analysis of genomic DNA isolated from BD146 (Fig. 1, lane gBD146) revealed that it contained a
plasmid of 7.5 kb, which was named pBD146. The plasmid (Fig. 1,
lane pBD146) was purified using a Qiagen column. Escherichia
coli JM109 was electroporated with the plasmid preparation and
transformants were selected on ampicillin plates. Two types of
ampicillin-resistant clones were obtained. One was found to contain the 7.5 kb plasmid, designated 7.5 kb+ (Fig. 1, lanes B2/JM109
and B5/JM109), whilst the other type, designated 7.5 kb−, did not
(Fig. 1, lanes B44/JM109 and B51/JM109) even though the clones
showed ampicillin resistance after several rounds of streaking on
fresh ampicillin plates.
222
N. Rajpara et al. / International Journal of Antimicrobial Agents 34 (2009) 220–225
was resistant to nalidixic acid and had intermediate resistance to
neomycin. From these results, it appeared that the presence of
the 7.5 kb plasmid could confer resistance only to trimethoprim in
JM109 and that resistance to the other drugs was possibly due to
another plasmid. The fact that a plasmid could not be visualised on
agarose gel with the plasmid preparation from the 7.5 kb− transformants indicated that the plasmid was present in BD146 in a
very low copy number. Resistance to nalidixic acid and intermediate resistance to neomycin were apparently JM109-derived. That
the trimethoprim resistance in 7.5 kb+ transformants was due to the
7.5 kb plasmid was later confirmed upon sequencing, which showed
the presence of the dfrVI gene encoding trimethoprim resistance
on this plasmid. It thus appeared that the 7.5 kb+ transformants
in JM109 carried two plasmids: a very low copy number plasmid
carrying the drug markers for ampicillin, chloramphenicol, gentamicin, kanamycin, tetracycline and rifampicin; and a more abundant
7.5 kb plasmid.
Fig. 1. Agarose gel analysis of different DNA samples of Vibrio fluvialis strain BD146
on a 1% agarose gel. Lanes from left: 1 kb molecular weight standard (Fermentas
International Inc., Burlington, Ontario, Canada), with fragment sizes indicated on the
left; gBD146, total genomic DNA; pBD146, Qiagen-purified plasmid; B2/JM109, clone
B2 of JM109 transformant; B5/JM109, clone B5 of JM109 transformant; B44/JM109,
clone B44 of JM109 transformant; B51/JM109, clone B51 of JM109 transformant;
JM109, plasmid preparation from JM109; pPL78/6, Qiagen-purified plasmid from V.
fluvialis strain PL78/6.
3.2. Antimicrobial susceptibility of BD146 transformants
Both kinds of transformants (7.5 kb+ and 7.5 kb−) were analysed for drug resistance as described in Section 2.2. The 7.5 kb+
clones were resistant to ampicillin, chloramphenicol, gentamicin, trimethoprim, tetracycline, nalidixic acid and rifampicin
and showed intermediate resistance to neomycin and kanamycin
(Table 2). The 7.5 kb− clones showed a similar resistance profile to 7.5 kb+ clones except that they did not carry trimethoprim
resistance. The host used for the transformation reactions (JM109)
3.3. Minimal inhibitory concentration determination
The MIC values for the antibiotics tested against BD146 and
its two types of JM109 transformants are given in Table 3. For
most of the drugs tested, the MIC was in the range of 0.25–10 ␮g
for BD146. For the drugs co-trimoxazole, nalidixic acid, sulfisoxazole, sulfamethizole, trimethoprim and rifampicin, the MIC was
very high (≥240 ␮g). Comparison of MIC values between the parent strain and its transformants clearly indicated that the majority
of transferable resistance traits were contributed by the low copy
number plasmid.
3.4. Presence of class 1 integrons and SXT elements in BD146
To look for the presence of the above elements as carriers of drug
resistance genes, PCR reactions were performed with the primers
specific for each kind of element. Class I integron/integrase (intI1)
Table 2
Antibiotic susceptibility pattern for Vibrio fluvialis strain BD146 and its transformants in the Escherichia coli host JM109.
Isolate
Antibiogram
E. coli JM109
V. fluvialis BD146
Transformant 7.5 kb+/JM109a
Transformant 7.5 kb−/JM109a
Resistance
Intermediate resistance
NAL
AMP, CIP, GEN, STR, SUL, TMP, NEO, NAL, NOR, KAN, CO-TRI, RIF
AMP, CHL, GEN, TMP, TET, NAL, RIF
AMP, CHL, GEN, TET, NAL, RIF
NEO
CHL, TET
NEO, KAN
NEO, KAN
AMP, ampicillin; CHL, chloramphenicol; CIP, ciprofloxacin; GEN, gentamicin; KAN, kanamycin; NAL, nalidixic acid; NEO, neomycin; NOR, norfloxacin; RIF, rifampicin; STR,
streptomycin; SUL, sulfisoxazole; CO-TRI, co-trimoxazole; TET, tetracycline; TMP, trimethoprim.
a
Antibiograms of E. coli JM109 after transformation with plasmid preparations from V. fluvialis BD146.
Table 3
Determination of minimal inhibitory concentrations (MICs) for Vibrio fluvialis strain BD146 and its Escherichia coli JM109 transformants.
Antibiotic
Chloramphenicol
Ciprofloxacin
Co-trimoxazole
Gentamicin
Kanamycin
Nalidixic acid
Neomycin
Norfloxacin
Streptomycin
Sulfisoxazole
Sulfamethizole
Tetracycline
Trimethoprim
Rifampicin
MIC (␮g)
BD146
7.5 kb+/JM109
7.5 kb−/JM109
JM109
1.0
10.0
>240
1.0–2.0
3.0–7.5
>240
1.0
4.0
10.0–30.0
>240
>240
0.25–0.5
>240
120–240
30.0
0.25
0.5
2.0–5.0
3.0–7.5
60.0–120.0
0.1
1.0
3.0
1.0–3.0
1.0–3.0
30.0–60.0
2.0
>240
30.0
0.01
0.1
2.0
3.0–7.5
60.0–120.0
0.1
0.5
3.0
1.0–3.0
1.0–3.0
30.0–60.0
0.1
>240
5.0
0.08
0.1
0.1
0.1
60.0–120.0
0.1
0.05
0.1
1.0–3.0
1.0–3.0
1.0–3.0
0.1
8.0
N. Rajpara et al. / International Journal of Antimicrobial Agents 34 (2009) 220–225
223
with In-F/In-B primers resulted in the amplification of a 4.0 kb and
a 0.4 kb band (Figs. 2 and 3c). Sequence analysis of the 0.3 kb amplicons obtained with both types of transformants as well as from the
parent V. fluvialis strain confirmed the homology of this integrase
with that from Pseudomonas aeruginosa (GenBank accession no.
M73819). Clearly, the integron segments having sequence similarity with the 5 conserved segment (5 CS) and 3 conserved segment
(3 CS) of the pVS integron from P. aeruginosa resided on the low copy
number plasmid. Subsequent to sequence elucidation of the 7.5 kb
plasmid, which carried integrase identical to the integrase (GenBank accession no. BAD88722) present in plasmid pVN84 derived
from a V. cholerae O1 strain (GenBank accession no. AB200915.1),
primers specific to this integrase were designed. As expected, PCR
with these primers resulted in a 657-bp amplicon only in the 7.5 kb+
transformants (Fig. 3d). SXT-specific PCR did not show the 0.8 kb
amplicon in any of the samples, although the positive control BD81
showed this band (data not shown).
3.5. Sequence analysis
Fig. 2. Schematic representation of the class 1 integron. The 59 base elements are
represented by solid circles. Arrows indicate the positions of primers.
could be detected in different PCR reactions as described in Section 2.5 and depicted in Fig. 2. For the PCR reactions, plasmid
preparation from JM109 cells was taken as a negative control and
plasmid/genomic DNA preparations from other strains of V. fluvialis (PL78/6 and BD81) were taken as positive controls for class 1
integrons and SXT elements, respectively. When the plasmid DNA
obtained from 7.5 kb+ and 7.5 kb− clones were used as templates,
a band of 0.3 kb was obtained with L2/L3 primers (Figs. 2 and 3a),
and a band of 0.8 kb was amplified with qacE1-F/Sul1-B primer
pair (Figs. 2 and 3b), indicating the presence of the class 1 integron
in both types of clones. The attempt to amplify the variable region
The sequence of pBD146 was found to have 7472 bp and was submitted to GenBank under accession number EU574928. A BLAST
search revealed that pBD146 had 99% identity with the plasmid
pVN84 (7126 bp) from V. cholerae O1 biotype El Tor serotype Inaba
(GenBank accession no. AB200915.1). The ORF search revealed
that, similar to pVN84, pBD146 also carried genes for dihydrofolate reductase isotype VI (dfrVI), replicase, ORF1, integrase 1,
plasmid stabilisation system protein and a hypothetical UPF0156
protein/putative transcriptional regulator. Some ORFs bearing ca.
60% homology with pentapeptide repeat proteins from Vibrio fischeri and many other species were also located on pBD146. The
presence of a plasmid in V. fluvialis with similarity to a plasmid
from V. cholerae O1 strain was interesting as this indicated a possible
exchange of this plasmid between the two vibrios. The sequences
Fig. 3. Polymerase chain reaction (PCR) amplification of class 1 integron/integrase-specific regions. Agarose gel analysis showing amplification with: (a) primer pair L2/L3;
(b) primer pair qacE1-F/Sul1-B; (c) primer pair In-F/In-B; and (d) primer pair Vcint-F/Vcint-R. All the DNA samples used as templates are indicated on top of each lane (see
legend to Fig. 1).
224
N. Rajpara et al. / International Journal of Antimicrobial Agents 34 (2009) 220–225
for the three primer pairs (L2/L3, qacE1-F/Sul1-B and In-F/InB) for integron amplification could not be located in this 7472 bp
sequence, suggesting that the class 1 integron was not associated
with this plasmid. This observation lent further support to the
inference that, besides the 7.5 kb plasmid, a very low copy number plasmid was present in BD146 and that the integron-specific
signals in the PCR that were obtained in the plasmid preparation
from JM109/7.5 kb+ were actually due to this very low copy number
plasmid.
ORF analysis of the 4.0 kb cassette amplified from the integron
resident on the low copy number plasmid revealed the presence of genes (Fig. 2) for rifampicin ADP-ribosylating transferase
(GenBank accession no. FJ462717), a hypothetical protein (GenBank accession no. FJ705852), extended-spectrum ␤-lactamase
OXA-142 (GenBank accession no. FJ705851) and aminoglycoside3 -adenyltransferase (GenBank accession no. FJ462718). The 0.4 kb
amplicon that could only be obtained with genomic and plasmid
DNA coded for a putative exporter protein (GenBank accession no.
FJ462719).
4. Discussion
In the scenario of emerging drug resistance and its spread
between different genera, it becomes particularly interesting to
study the acquisition and transfer of genes encoding the drug resistance traits through mobile genetic elements. Such elements have
been implicated in the drug resistance phenotypes of many diseasecausing microbes [12,13,17]. The studies aimed at unravelling the
molecular mechanisms of multiple drug resistance in V. fluvialis are
somewhat limited, although a few studies have been carried out
[6–8], besides the cytotoxic and cell-vacuolating potential of this
organism [5]. However, there is no report on the plasmid characterisation in relation to multidrug resistance in the literature for
this vibrio. A very recent report has described a fluvialis plasmid
isolated from salt marsh sediment [24], which appears to indicate
that vibrio genomes are in a state of continuous flux due to genetic
exchanges between vibrio plasmids, phages and chromosomes. The
results presented in this paper provide the first evidence that plasmid exchange has taken place between V. fluvialis and V. cholerae
O1 strains.
In this study, an attempt was made to analyse a clinical isolate of V. fluvialis (BD146) with respect to its resistance to various
antibiotics and to elucidate the mechanisms underlying multidrug
resistance with particular reference to mobile genetic elements.
This isolate showed complete or intermediate resistance to all
the antibiotics tested, seven of which could be transferred to E.
coli JM109 through electroporation, pointing to the possibility of
the involvement of plasmids. A transformable plasmid pBD146 of
7.472 kb could be detected in the strain. However, this plasmid
could not transfer resistance to six drugs and the plasmid sequence
revealed the presence of only the trimethoprim resistance gene,
which was not carried on an integron. This is reminiscent of an
earlier observation, where only a fraction of the resistance markers were located on integrons in a 150 kb plasmid that harboured
resistance markers to eight antibiotics [23].
As this strain showed resistance to streptomycin, trimethoprim
and sulfamethoxazole, a drug resistance phenotype associated with
the SXT element, the SXT element could have been present in
BD146. However, search for the presence of mobile genetic elements using PCR revealed the presence of a class 1 integron and
the absence of SXT integrase in BD146. Since the DNA sequence of
pBD146 clearly showed that the class 1 integron was not associated with the plasmid, the positive amplification in the PCR with
L2/L3 (for 5 CS) and qacE1-F/Sul1-B (for 3 CS) with the plasmid DNA template could be due to the presence of chromosomal
DNA contamination in plasmid preparations. This kind of chromosomal DNA contamination in a purified plasmid preparation has
also been observed earlier in the plasmid preparation from V. fluvialis [6]. However, amplification of these signals (5 CS and 3 CS) in
a JM109 transformant that showed resistance to ampicillin, chloramphenicol, gentamicin, tetracycline, nalidixic acid, kanamycin
and rifampicin but not trimethoprim, and that did not harbour the
7.5 kb plasmid and apparently no other plasmid, appeared to indicate that the integron(s) was located on a very low copy number
plasmid that carried drug resistance markers for the abovementioned antibiotics. Comparison of the antibiograms of the parent
strain and the transformants with the low copy number plasmid
corroborated this observation that the majority of the resistance
traits observed in the parent strain BD146 were contributed by
the low copy number plasmid. Analysis of the 4.0 kb integron
cassette resident on this low copy number plasmid revealed a
battery of drug resistance cassettes. The presence of a resistance
gene for rifampicin in this 4.0 kb variable region is especially noteworthy as this drug is not used for the treatment of cholera and
has probably crept through the vibrio genome from some other
genus, probably mycobacterium/Pseudomonas/Klebsiella. Another
interesting feature was the presence of an efflux pump-like gene in
the 0.4 kb region of the integron that possibly resides on the chromosome. This kind of gene could account for resistance to many
drugs. Thus, in the present study we have shown that multiple
plasmids and integrons contributed significantly to the drug resistance phenotype of this clinical isolate. Carriage of this integron
(with the battery of drug resistance genes) on a plasmid possibly
aids in the faster dissemination of these traits between pathogenic
organisms.
A BLAST search with the sequence of pBD146 revealed that this
plasmid had 99% identity with plasmid pVN84 isolated from a
V. cholerae O1 clinical strain in 2004 from Vietnam, indicating a
possible exchange of plasmid between V. fluvialis and V. cholerae.
Although such exchanges are well documented in the literature
within environmental isolates [24], this is the first record of an
exchange of plasmid between clinical isolates of V. cholerae and V.
fluvialis. In this context, it is noteworthy that such horizontal transmission of the SXT element has also been speculated between these
two vibrios isolated from the same region, Kolkata [7].
Acknowledgments
The authors are grateful to Dr T. Ramamurthy, National Institute
of Cholera and Enteric Diseases (NICED), Kolkata, India, for providing the vibrio strains. The authors acknowledge the technical help
provided by Dr Rochika Singh and Ms Jyoti Tak in this work.
Funding: This work was supported by The Puri Foundation for
Education in India, Gandhinagar, India.
Competing interests: None declared.
Ethical approval: Not required.
References
[1] Furniss AL, Lee JV, Donovan TJ. Group F, a new Vibrio? Lancet 1977;10:565–6.
[2] Lee JV, Shread P, Furniss AL, Bryant TN. Taxonomy and description of Vibrio fluvialis sp. nov. (synonym Group F vibrios, Group EF-6). J Appl Bacteriol
1980;50:73–94.
[3] Huq MI, Alam AKMJ, Brenner DJ, Morris GK. Isolation of Vibrio-like group EF-6
from patients with diarrhea. J Clin Microbiol 1980;11:621–4.
[4] Bellet J, Klein B, Alteri M, Ochsenschlager D. Vibrio fluvialis, an unusual pediatric
enteric pathogen. Pediatr Emerg Care 1989;5:27–8.
[5] Chakraborty R, Chakraborty S, De K, Sinha S, Mukhopadhyay AK, Khanam J, et al.
Cytotoxic and cell vacuolating activity of Vibrio fluvialis isolated from paediatric
patients with diarrhoea. J Med Microbiol 2005;54:707–16.
[6] Ahmed AM, Nakagawa T, Arakawa E, Ramamurthy T, Shinoda S, Shimamoto T.
New aminoglycoside acetyl transferase gene, aac(3)-Id, in a class 1 integron
from a multiresistant strain of Vibrio fluvialis isolated from an infant aged 6
months. J Antimicrob Chemother 2004;53:947–51.
N. Rajpara et al. / International Journal of Antimicrobial Agents 34 (2009) 220–225
[7] Ahmed AM, Shinoda S, Shimamoto T. A variant type of Vibrio cholerae SXT element in a multidrug-resistant strain of Vibrio fluvialis. FEMS Microbiol Lett
2005;242:241–7.
[8] Srinivasan VB, Virk RK, Kaundal A, Chakraborty R, Datta B, Ramamurthy T, et al.
Mechanism of drug resistance in clonally related clinical isolates of Vibrio fluvialis isolated in Kolkata, India. Antimicrob Agents Chemother 2006;50:2428–32.
[9] Stokes HW, Hall RM. A novel family of potentially mobile DNA elements
encoding site-specific gene-integration functions: integrons. Mol Microbiol
1989;3:1669–83.
[10] Stokes HW, O’Gorman DB, Recchia GD, Parsekhian M, Hall RM. Structure and
function of 59-base element recombination sites associated with mobile gene
cassettes. Mol Microbiol 1997;26:731–45.
[11] Rowe-Magnus DA, Mazel D. Resistance gene capture. Curr Opin Microbiol
1999;2:483–8.
[12] Correia M, Boavida F, Grosso F, Salgado MJ, Lito LM, Cristino JM, et al. Molecular
characterization of a new class 3 integron in Klebsiella pneumoniae. Antimicrob
Agents Chemother 2003;47:2838–43.
[13] Conza JD, Ayala JA, Porto A, Mollerach M, Gutkind G. Molecular characterization
of InJR06, a class 1 integron located in a conjugative plasmid of Salmonella
enterica ser Typhimurium. Int Microbiol 2005;8:287–90.
[14] Rowe-Magnus DA, Guerout A-M, Biskri L, Bouige P, Mazel D. Comparative
analysis of superintegrons: engineering extensive genetic diversity in the Vibrionaceae. Genome Res 2007;13:428–42.
[15] Waldor MK, Tschape H, Mekalanos JJ. A new type of conjugative transposon
encodes resistance to sulfamethoxazole, trimethoprim, and streptomycin in
Vibrio cholerae O139. J Bacteriol 1996;178:4157–65.
[16] Beaber JW, Hochhut B, Waldor MK. Genomic and functional analyses of SXT,
an integrating antibiotic resistance gene transfer element derived from Vibrio
cholerae. J Bacteriol 2002;184:4259–69.
225
[17] Dalsgaard A, Forslund A, Sandvang D, Arntzen L, Keddy K. Vibrio cholerae O1
outbreak isolates in Mozambique and South Africa in 1998 are multiple-drug
resistant, contain the SXT element and the aadA2 gene located on class 1 integrons. J Antimicrob Chemother 2001;48:827–38.
[18] Hochhut B, Lotfi Y, Mazel D, Faruque SM, Woodgate R, Waldor MK. Molecular
analysis of the antibiotic resistance gene clusters in the Vibrio cholerae O139
and O1 SXT constins. Antimicrob Agents Chemother 2001;45:2991–3000.
[19] Amita, Chowdhury SR, Thungapathra M, Ramamurthy T, Nair GB, Ghosh A.
Class I integrons and SXT elements in El Tor strains isolated before and after
1992 Vibrio cholerae O139 outbreak, Calcutta, India. Emerg Infect Dis 2003;9:
500–2.
[20] Thungapathra M, Amita, Sinha KK, Chaudhuri SR, Garg P, Ramamurthy T, et al.
Occurrence of antibiotic resistance gene cassettes aac(6 )-Ib, dfrA5, dfrA12 and
ereA2 in class I integrons in non-O1, non-O139 Vibrio cholerae strains in India.
Antimicrob Agents Chemother 2002;46:2948–55.
[21] Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing. Eighteenth informational supplement. Document
M100-S18. Wayne, PA: CLSI; 2008.
[22] Maguire AJ, Brown DF, Gray JJ, Desselberger U. Rapid screening technique for
class 1 integrons in Enterobacteriaceae and non-fermenting gram-negative bacteria and its use in molecular epidemiology. Antimicrob Agents Chemother
2001;45:1022–9.
[23] Dalsgaard A, Forslund A, Petersen A, Brown DJ, Dias F, Monteiro S, et al. Class 1
integron-borne, multiple-antibiotic resistance encoded by a 150-kilobase conjugative plasmid in Vibrio cholerae O1 strains isolated in Guinea-Bissau. J Clin
Microbiol 2000;38:3774–9.
[24] Hazen TH, Wu D, Eisen JA, Sobecky PA. Sequence characterization and comparative analysis of three plasmids isolated from environmental Vibrio spp. Appl
Environ Microbiol 2007;73:7703–10.