Download DNA Profile 911 - Bertino Forensics

DNA Profiling 911: How to Interpret the 911 Electropherogram
Teacher Notes for Act 7-4 STR Identification of a September 11 Victim 10.10.16
Forensic Science: Fundamentals and Investigations 2nd ed.
authors: Bertino & Bertino
www.BertinoForensics.com
Introduction
The lab entitled 911 by Patricia Nolan Bertino instructs students to determine the
identity of the remains of a victim found at the 911 site in New York City. It serves
as an introduction to how DNA STR technology is used for personal identification
of accident victims, plane crashes, paternity and forensic cases. This lab
provides an example of how DNA technology is being applied to solve real life
situations.
The 911 lab is an introductory lab that provides students with a background of
STRs and the graphic print-out of a STR profile known as an electropherogram.
This lab does not examine how electropherograms are made nor does it ask the
students to determine probability. At the end of this document, references to
other activities that provide additional background about DNA profiling and also
provided for more advanced students who want to go further.
Students use a photographed copy of an electropherogram given to the family of
the 911 victim. The victim's wife and her two sons wanted to confirm that their
husband's and their father's remains were those identified at the 911 site. To
understand how to interpret these results, it's important to first review STRs
(Short Tandems Repeats) and how they are used in personal identification.
Background Information
STRS
Short Tandem Repeats or STRs are highly variable regions of DNA. STRs
consist of short, repeating sequences of DNA found within the non-coding part of
DNA known as an Intron. The number of repeats for any given STR may vary
and these variations are known as alleles. The number of repeats within the gene
does not seem to affect the expression of the gene because the repeats occurred
in the non-coding section of the gene.
These highly variable repeating sequences of DNA were formerly known as
VNTRs: Variable Number of Tandem Repeats. STRs are shorter versions of
VNTRs that are used today to assist in personal identification.
For example:
A particular STR called TH01 is located on chromosome 11 and has a repeating
sequence of TCAT. The number of repeats of TCAT can vary among people.
There is a range of 3 to 14 repeats of TCAT for this STR.
A person may have a repeat of three TCAT - (TCAT), (TCAT),(TCAT)
Another person may have a repeat of six TCAT
(TCAT) (TCAT) (TCAT) (TCAT) (TCAT) (TCAT)
www.BertinoForensics.com Forensic Science: Fundamentals and Investigations, 2nd ed. Bertino &
Bertino
The different number of repeats are variations of the STRs or alleles of that STR.
When trying to identify someone from their DNA, their physical appearance is not
being examined. Instead, personal identification is based on their genes or
alleles for different STRs. The more STRs being examined, the more reliable is
the identification of the person. Today, DNA is analyzed using thirteen different
STRS markers.
STR Data Bases and Probability
To determine how likely that the DNA examined could have come from another
person, it is necessary to conduct population studies. Data bases of gene
frequencies for different STRs are produced from surveys that examine people
within a given population. Gene frequencies are calculated for how common a
particular STR allele appears in that population.
Using Hardy-Weinberg calculations, the probability of anyone in that population
having a particular genotype for a particular STR is calculated. Once the
probability is determined for each STR marker, one can determine the probability
of someone else having the same genotype of several different STR markers by
multiplying the individual probabilities. The more markers used, the greater, the
more reliable are the results.
Inheritance of STRs
Recall that you inherit one allele from your mother and the other allele from your
father. Each person usually has only two alleles for each trait, one coming from
each of the parents. Therefore for any given STR, you inherit one allele from your
mother and one allele from your father for each STR marker.
Mother has two alleles for a particular STR
One allele had10 tandem repeats of CAT
ex. CATCATCATCATCATCATCATCATCATCAT (10 repeats)
The other allele in the mother may contain 5 tandem repeats of CAT
ex. CATCATCATCATCAT (5 repeats)
The mother's genotype for this STR is written as (5,10)
Father has two alleles for a particular STR
One allele contain 6 repeats:
ex. CATCATCATCATCATCAT (6 repeats)
The other allele contains 12 repeats
Ex. CATCATCATCATCATCATCATCATCATCATCATCAT (12 repeats)
The father's genotype is written as (6,12)
Possible Genotypes in their child
A child from those parents must have one allele from each parent. Different
genotypes for that particular STR would include:
One allele with 10 repeats from the Mom and an allele with 6 repeats from the
Dad. (6,10)
Or one allele with 10 repeats from Mom an allele with 12 repeats from the Dad
(10,12)
Or one allele with 5 repeats from Mom and allele with 12 repeats from Dad
(5,12)
Finally, the child could inherit an allele with 5 repeats from Mom and an allele
with 6 repeats from Dad (5,6)
Teacher Directions for 911 lab.
1. Pre-assess student knowledge and correct misconceptions by first doing a
carousel brainstorming activity. Suggested questions could include:
1. Where and when did 911 occur?
2. What happened during 911?
3. Who was responsible for 911?
4. How many people died as a result of 911?
5. What health issues resulted in the first responders of 911?
6. How were the remains of the victims of 911 identified?
7. How did 911 affect us as a country?
8. What are measures taken today in the US to block future terrorist
attacks?
2. Describe the real life situation of a family being presented with the
photograph of the 911 STR Profile of an unknown sample of DNA. It is believed
that the unknown victim was the husband and father of a family of two sons.
Students are asked to examine the 911 STR profile and determine if the
unknown victim was or was not the father of the two sons.
3. Provide a brief explanation of STRs
a. What is an STR?
b. Where are STRs found in our genome?
c. Provide examples of STRs
d. What are STR alleles?
e. How do you inherit STRs? (independent assortment)
f. Provide a demonstration or example of the different genotypes that can be
produced from two heterozygous parents. (Example Mom (5,10) and Dad (6,12))
4. Distribute the 911 STR Profile to students. State that the top line represents
the Mother's DNA (labeled M on the right). The second line is the unknown DNA
found at the 9/11 site that is believed to be the father's DNA. The third and fourth
line represents the DNA of the two sons, labeled S1 and S2. If possible, project
this image.
5.Examine the 9/11 STR Profile
Without any instructions, ask the students to review the profile and look for
anything that they might be able to interpret.
a. Many students will notice the XX, XY in the electropherogram and note that
gender of the sample was identified. Confirm the gender with the labels on the
right for Mom, unknown (father) and son 1 and son 2.
b. Students may notice that some of the peaks are higher than others? Ask
them to hypothesize as to why there is a difference in the height of the
peaks.(These peaks represent the quantity of the DNA sample measured by the
amount of fluorescence. It has nothing to do with the size of the repeat)
c. Students may notice that some peaks are paired and some are singular
peaks. (If there is one peak, the person is homozygous for that pair of alleles. If
there are two peaks, then the person is heterozygous for that pair of alleles.)
6. How to Interpret the 911 STR Profile Analysis
a. Ask students to count how many different STRs were tested (13 STRs and
one additional test (AMEL) to determine gender)
b. Observe the Mother's STR profile on the top line.
- What is her genotype for the first STR marker? (14,16)
- What is her genotype for the second marker? (11,13)
- What is her genotype for the third marker? (17,18)
c. Observe the unknown (father's) STR profile on the second line
-Note that some alleles only have one peak . ex. midway across (8)
- Ask students to provide an explanation. (Homozygous for that STR, the
person inherited two alleles with 8 repeats from each of his parents, one peak)
d. Observe the Mother's STR profile. The peaks to the right of the sex
chromosomes shows alleles of (6, 9.3). Ask students to hypothesize why an STR
allele would be written in decimal form. (This is a partial repeat. If the repeat was
TCAT, the 9.3 means that that person has 9 full repeats of TCAT, but only had a
partial repeat with only 3 bases thus the allele is written 9.3)
e. Examine the last line, the STR profile for Son # 2.
-What is his genotype for the first STR? (14,15)
- Which of the two alleles 14 or 15 could have been inherited from the
mother? (14)
- Was it possible that the 15 allele could have been inherited from the
unknown (father's DNA)? Yes, because the father has an allele of 15.
- Using a pink or red pencil, circle the allele in the son #2 STR profile that
was inherited from the mother. (14)
- Using a blue pencil, circle the allele in son # 2 STR profile that could
have been inherited from the unknown (father) (15)
- Do this for all of the son # 2 STR markers.
f. Repeat this process using the pink and blue pencils to determine if son #1
has at least one allele from the mother and at least one allele from the father.
g. Repeat this process for son # 2.
h. Analysis/Discussion/ Further Study
- Based on the evidence, is the unknown sample of DNA the DNA from the
father?
- How reliable are these results?
-How is it possible to determine how common are these alleles?
-How could you calculate the probability that the unknown DNA was from
the father and not someone else?
-How large of a sample of DNA is needed?
-Describe the method used to amplify a small sample of DNA.
- If the father is no longer alive, how could the family provide a known
sample of his DNA for comparison?
Additional References
View Paul Andersen's video clip on DNA Fingerprinting found on You Tube.
This 6 minute video provides a brief overview of how DNA is used to identify a
person using FRLPs, VNTR and STRs.
Before you do the STR 911 Lab, have students do How Many CATS Activity
If you have the students do the How Many CATs activity cited below, they will
have a better understanding of how DNA probes used on gel electrophoresis is
used to help identify a person. This activity provides the background information
so that they can better understand DNA STR Profiles.
Anthony (Bud) Bertino coauthored with Ellen Mayo the lab entitled "Where's the
Cat" This original lab can be found on Access Excellence. In this lab, Bertino
uses "CAT" as the short repeating sequence of DNA or the STR found with a
gene.
http://www.accessexcellence.org/AE/AEC/AEF/1995/mayo_dna.php
This activity is a paper simulation of DNA Profiling and explains what is meant by
Short Tandem Repeats (or earlier VNTRs Variable Number of Tandem Repeats),
the role of radioactive probes and how it is used to identify a person.
CIBT later modified the lab and renamed it "How Many CATS"
That lab can be found at http://cibt.bio.cornell.edu/labs/dl/HCAT.PDF
If you have the student do the How many Cats labs cited above, they will easily
understand DNA profiles and how this was used to identify a person.
Electropherogram Tutorial and Animations
Today much of the DNA STR analysis is done by computer analysis. To better
understand how to interpret an electropheragram or how a DNA STR Profile is
derived, refer to the animations found on the National Institute of Justice,
Multimedia Resources from DNA.gov
http://www.nij.gov/nij/training/dna-multimedia.htm
Animation Showing Electropherogram Interpretation
Interactive animation that goes through each section of an electropherogram —
the graphic representation of the separation of molecules by electrophoresis or
other means of separation.
Animation Showing How a Profile Is Derived from an Electropherogram
Interactive animation that shows details of an electropherogram, the graphic
representation of the separation of molecules by electrophoresis or other means
of separation.
Reference Textbook
Butler, John M., Fundamentals of Forensic DNA Typing, Academic Press, US. 2010
Probability and STR Analysis Activity
To better understand how to calculate the probability that the STRs
combinations found in one person could belong to anyone else, I suggest you
consider doing a CIBT lab called Statistics and Probability in Evaluation of
DNA Evidence. This lab explains binning and how allele frequencies for a given
STR are calculated based on population studies and data bases. This is an
activity more suited for students with better math skills and AP biology students.
http://cibt.bio.cornell.edu/labs/dl/STAT.PDF
This activity provides information on how to calculate the probability or frequency
of STR alleles within a particular group of people. This incorporates more math
and will provide statistics about the evidence reliability using information from an
actual forensic case in upstate New York. BertinoForensics has modified and
improved this lab. Contact me if you would like the revised format.
Patricia Nolan Bertino www.BertinoForensics.com [email protected]
www.BertinoForensics.com Forensic Science: Fundamentals and Investigations, 2nd ed. Bertino & Bertino