Download emboj7601952-sup

Supplemental Information
Supplemental Figure 1. The MURF gene family and the KO mouse models used in this
study.
(A) MuRFs (brief for Muscle specific RING Finger; see Spencer 2000) correspond to a gene
family coding for three highly homologous RING fingers proteins, referred to as MuRF1,2
and 3; also called RNF 28-30; or TRIM 63, 55, 54). The three MuRFs share highly conserved
N-terminal RING finger domains, followed C-terminally by a MuRF family conserved motif
(MFC), a B-box, and a coiled-coil region. The MuRF1Bcc fragment expressed in E. coli
corresponds to residues 109-315, MuRFcc corresponds to residues 146-315.
(B) MuRF1 and MuRF2 were inactivated by a homologous recombination into exon 2 and
exon 5 respectively (stop codons in all three frames are provided by the Neo cassette; gene
targeting essentially as described in Witt et al., 2006).
(C) Genotyping with the primer pairs indicated in (B).
(D) RT-PCR detects loss of MuRF1 and MuRF2 transcription in KO mice. MuRF3
transcription is intact. Aldolase: Control for input mRNA/cDNA quantity and quality. Primer
for RT-PCR: MuRF1 for: AGAAGTCGGGGGTCAGGGGACG; MuRF1 rev:
GGTCCATGATCACTTCATGGCGGCACGAGG; MuRF2 for:
GAGCACTTCTCTGAATTACAAGTCTTTCTCC; MuRF2 rev:
GCTGAGAGCCAATGGGCACCACCTCCCC; MuRF3 for:
GCCCCATCTGCCTGGAGATGTTCTCCAAGCC; MuRF3 rev:
GCCGCTCCTCCTCCAGCCCCGCATTGCCC
Aldolase for: AGCTGTCTGACATCGCTCACCG; Aldolase rev:
CACATACTGGCAGCGCTTCAAG
1
Supplemental Figure 2. Post mortem histology of the lung of dKO animals.
dKO mice at day 13-15 of age found dead in their cages were histologically examined post
mortem.
A. Left: Wildtype mice show intact alveoles and no signs of lung compression and edema.
Right: Young dKO animals show a partial compression of the lung (arrow) while the
peripheral parts of the lung which are not hypostatic are filled with air.
B. Left: Severe congestion (Hyperemia) in dKO lungs with acute edema (arrow) and partial
effacement of the alveolar cells. Right: The myocardium shows microthombi (arrow) but no
areas of necrosis and no signs of fibrosis.
Supplemental Figure 3. Comparison of WT and dKO heart at months 14-18.
ECG Eindthoven scans of one WT (A), one MuRF1KO (B), and one dKO mouse (D)
indicates intact excitation conduction in dKO hearts. Studied mice were 12 months old (n=2
for each genotype).
Supplemental Video 4-7. Time-resolved MRI imaging of a WT (Video Sup_4 and Sup_5)
and a dKO mouse (Video Sup_6 and Sup_7), showing massive ventricular hypertrophy in
dKO.
Supplemental Figure 8. Absolute weights of bodies, hearts (ventricles) and quadriceps.
Mean absolute weights of WT and dKO mice are compared in three groups: young animals (2
month, WT: n=4, dKO: n=3), adult animals (6-8 months, WT: n=15, dKO: n=10), old animals
(16-18 months, WT: n=14, dKO: n=5; significant p-values: BW old animals p=0.003, HW
young animals p=0.001, HW adult animals p=0.003, HW old animals p=0.009).
Supplemental Table 9. Summary of microarray data.
2
The table shows 40 upregulated genes including those genes mentioned in the text (red: alphaactin, ANP type A and B, Myosin Light Chain, CARP, p62/sequestosome1, and
atogrin/MafBx. MuRF1 is the most downregulated gene in the microarray. MuRF2 is not
represented on the chip (Affymetrix Mouse Genome 430 2.0). Genes described in the text but
showing no dysregulation are presented in the bottom.
Supplemental Figure 10.
(A) Western Blots of young mice hearts. As in old mice (figure 5) the MuRF1/MuRF2
binding protein CARP is upregulated. No clear trend can be seen with FHL2 antibody. In
agreement with the results in old mice, cTroponin I does not show differential expression in
our MuRF1/MuRF2 KO panel. In contrast, the hypertrophy marker ANP is strikingly
upregulated in young dKO mice.
(B) In immunofluorescence, the protein level of the early response gene c-fos (stained with
Cy3, red color) is found elevated in the nuclei (blue DAPI staining) of dKO mice. Size bar is
10 µm.
3