Download emboj7601526-sup

SUPPLEMENTARY MATERIALS
Responsiveness of COS-1 cells to different compounds
0.0
20
15
10
5
Relative response, %
0.5
20 M Glutamate
1.0
40 M ACh
1 M ATP +
100 M suramin
B
20 M Serotonin
Normalized ATP response
A
20 M GABA
I.
0
10-8
10-7
10-6
10-5
10-4
10-3
10-2
ATP, M
Figure 1. (A) Magnitude of Ca2+ transients in the COS-1 cytoplasm versus concentration of
bath ATP. Every COS-1 cell (n = 18) was stimulated first with 10 M ATP and then with the
nucleotide at several concentrations (n=3-5). For comparison, a Ca2+ response (R) at a given
ATP concentration ([ATP]) were normalized to the magnitude of the control response (R10)
elicited 10 M ATP. The continuous line corresponds to the equation:
R/R10 = Amax[ATP]/(1 + [ATP]/K0.5)
with Amax = 1.16 and K0.5 = 2.1 M. (B) Relative responsiveness of COS-1 cells to different
compounds (n=3-6). Every COS-1 cell was stimulated by 1 M ATP as a control prior to
application of other stimuli, and responses to the indicated compounds were normalized to
the magnitude of the control response.
II.
ATP release on serial depolarization of a taste cell with spike-like pulses.
Figure 2. Response of the
ATP-sensor elicited by serial
depolarization of a taste cell
with 7 ms pulses to 10 mV
(n=200) (upper insert). A
change
in
Fluo-4
fluorescence became visible
after application of 170
pulses.
1
III.
Fraction of gustducin-positive taste cells.
By introducing the population fraction for A type cells, fA = (number of type A cells)/(total
number of taste bud cells), and that for cells of the other types, the fraction of type A cells in the
GFP-negative (non-green) cell population can be written as:
F = (1-x)fA/((1-x)fA+fB+fC+fN)
where x is the fraction of GFP-positive cells in the A subcategory. Taking F = 12/43 = 0.28
(Fig.1E) and fA – fN equal to 0.52, 0.31, 0.13, and 0.04, respectively (Romanov & Kolesnikov,
2006), the above equation yields x = 0.64. Thus, in a mouse CV taste bud, nearly two of every
three cells of the type A are gustducin-positive.
IV. Linear T7-based aRNA amplification and PCR analysis.
The whole-cell patch-clamp technique was used to identify enzymatically dissociated taste cells.
First-strand cDNA was synthesized directly from cell lysates harvested via patch pipettes.
RNaseOUT RNase inhibitor (Invitrogen) was included in the patch pipette. After recording, the
cytoplasmic contents were drawn into the recording pipette by suction and expelled into a PCR
tube containing 100 ng of oligo(dT)15-T7 (5’AAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGCGCTTTTTTTTTTTTTTT3’) primer in water. A sample of 10 pooled cells was subjected to heat denaturation at 70°C for 5
min followed by snap cooling on ice. Reverse transcription was carried out in a 10 µl volume
containing 2 µl first-strand reaction buffer, 0.5 µl 0.1 M DTT, 0.5 µl 10 mM dNTPs, 20 U
RNaseOUT (Invitrogen), 100 U SuperScript III reverse transcriptase (Invitrogen) at 50ºC for 30
min. Second-strand cDNA was synthesized with 0.3 µl RNase H (Invitrogen) and 10 U DNA
polymerase I (Promega). The reaction was carried out at 12ºC for 30 min and then at 22ºC for 1
h. cDNA was blunt-ended by treatment with 20 U T4 DNA polymerase (Promega) for 10 min at
37ºC followed by inactivation at 80°C for 3 min. The antisense RNA (aRNA) amplification by in
vitro transcription was carried out in 100 µl reaction mixture for 3 h with the use of T7 RNA
polymerase (Promega) following the manufacturer’s instructions. After RNA amplification, the
DNA template was removed by incubation of the reaction with 4 U DNaseI (Sigma) for 15 min.
Amplified aRNA was purified using RNeasy MinElute Kit (Qiagen) and reverse-transcribed with
200 U SuperScript III (Invitrogen) and 200 ng random hexanucleotides in a 20 µl reaction at
50°C for 1 h. The experiment was performed in triplicate. Control in vitro transcription reaction
contained no template but 100 ng oligo(dT)15-T7 primer. Reaction condition for PCR were 95ºC
for 2 min, followed by 40 cycles at 95ºC for 40s, 56ºC for 40s (or 60º for PLCβ2), and 72ºC for
50 s with the use of PCR Master Mix (Promega). Primers for Cx 26 were 285-306
2
(CAAGAATGTATGCTACGACCAC) sense and 484-501 (CAGGGACCCTTCGATACG)
antisense oligonucleotides (GenBank M81445), yielding a 217 bp product; primers for Cx 30.3
were 371-390 (TCACCTGTCCTTCCCTGTTA) sense and 640-657
(TCGGGCGATGTAACAGTC) antisense oligonucleotides (GenBank M91443), yielding a 287
bp product; primers for Cx 31.1 were 124-144 (AACTGGAGTGTTTTTGAGGGA) sense and
842-862 (AGATGAGGTCGCATGAGAGGA) antisense oligonucleotides (GenBank M91236),
yielding a 739 bp product; primers for Cx 32 were 217-240
(TCCTCTTTCATCTGTAACACCCTC) sense and 796-820
(TGTTGATCTCATTCTGCTTGTATTC) antisense oligonucleotides (GenBank M63802),
yielding a 604 bp product; primers for Cx 33 were 1980-1998 (GCCTATTCTCTTATACCTG)
sense and 2370-2389 (CCAAGACAAAAGACACCACT) antisense oligonucleotides (GenBank
AY465183), yielding a 410 bp product; primers for Cx 36 were 336-353
(ATCTTGGAGAGGCTGCTG) sense and 1867-1886 (ATCTTCTCGTTTGCTCCCTC)
antisense oligonucleotides (GenBank AF016190), yielding a 411 bp product; primers for Cx 43
were 377-401 (CTATGTGATGAGAAAGGAAGAGAAG) sense and 882-901
(GAGCAGCCATTGAAGTAAGC) antisense oligonucleotides (GenBank X61576), yielding a
525 bp product; primers for Cx 45 were 530-550 (TCACTGTGCTGATTGTCTTTC) sense and
1013-1031 (AGAAAGCCCACCTCAAACA) antisense oligonucleotides (GenBank X63100),
yielding a 502 base product; primers for Cx 47 were 641-660
(GTGGCTCAGCTGGTGGTTAG) sense and 1285-1302 (TCTCTGCTGCCTGTACTG)
antisense oligonucleotides (GenBank AJ276435), yielding a 662 bp product; primers for
pannexin 1 were 763-784 (TTCTTCCCCTACATCCTACTGC) sense and 1478-1498
(TGTTCTCCAGCACCTTCAGAC) antisense oligonucleotides (GenBank BC049074 ), yielding
a 736 bp product; primers for TRPM5 were 2411-2430 (TCACAGATGAGGACACGCAC)
sense and 2841-2864 (AGCAGAGGGTGAAGAGAACAGTTC) antisense oligonucleotides
(GenBank AY280364), yielding a 435 bp product; primers for phospholipase C beta 2 were 521544 (CCCCTTACCATGCCAGCTCTCTTC) sense and 833-853
(CACCACGCCCTTCAGTTCCCA) antisense oligonucleotides (GenBank BC038048), yielding
a 333 bp product.
V. Immunohostochemistry
Paraffin embedded sections (4m thick) from mouse circumvallate papillae were incubated
overnight at 4°C with the indicated primary antibodies. Primary antibodies were diluted in
blocking solution (2% goat serum, 0.1% Triton X-100 in PBS) as follows: 1:500 for rabbit antiTRPM5 (Damak et al., 2005); 1:500 for chicken anti-Panx1 (Diatheva); 1:500 for rabbit anti3
PLC2 (Santa Cruz). For double immunostaining, sections were incubated with anti-Panx1 along
with either anti-TRPM5 or anti- PLC2. Sections were then washed three times for ten minutes
each in PBS at room temperature, then incubated for two hours at room temp with the indicated
secondary antibodies. Secondary antibodies were diluted in blocking solution as follows: 1:500
for alexa fluor 594 goat anti-rabbit IgG (Molecular probes); 1:500 for fluorescein conjugated
goat anti chicken IgY antibody (Aves). Following incubation with the secondary antibody,
sections were washed three times for ten minutes each in PBS, then mounted. Images were taken
using confocal microscopy. Imunostaining controls consisted of (a) omitting the primary
antiserum and (b) omitting the secondary antibody. No staining was seen under these control
conditions.
4