Download Sequence elements of the fusion peptide of human respiratory

Journal of General Virology (2006), 87, 1649–1658
DOI 10.1099/vir.0.81715-0
Sequence elements of the fusion peptide of human
respiratory syncytial virus fusion protein required
for activity
Diana Martı́n,1 Lesley J. Calder,2 Blanca Garcı́a-Barreno,1 John J. Skehel2
and José A. Melero1
1
Centro Nacional de Microbiologı́a, Instituto de Salud Carlos III, Majadahonda, 28220 Madrid,
Spain
Correspondence
José A. Melero
2
[email protected]
National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA, UK
Received 27 November 2005
Accepted 14 February 2006
We have reported previously the expression and purification of an anchorless form of the human
respiratory syncytial virus (HRSV) F protein (FTM”) representing the ectodomain of the full-length F.
FTM” molecules are seen as unaggregated cones by electron microscopy but completion of
proteolytic cleavage of the F0 monomers in the FTM” trimer leads to a change in shape from cones to
lollipops that aggregate into rosettes. This aggregation apparently occurs by interaction of
the fusion peptides of FTM” molecules that are exposed after cleavage. Since exposure of the
fusion peptide is a key event in the process of membrane fusion, changes associated with FTM”
cleavage may reflect those occurring in full-length F during membrane fusion. Deletions or
substitutions that changed either the length, charge or hydrophobicity of the fusion peptide inhibited
aggregation of FTM”, and these mutants remained as unaggregated cones after cleavage. In
contrast, more conservative changes did not inhibit the change of shape and aggregation of FTM”.
When the same changes were introduced in the fusion peptide of full-length F, only the
mutations that inhibited aggregation of FTM” prevented membrane fusion. Thus, the conformational
changes that follow completion of cleavage of the FTM” protein require a functional fusion
peptide. These sequence constraints may restrict accumulation of sequence changes in the fusion
peptide of HRSV F when compared with other hydrophobic regions of the molecule.
INTRODUCTION
Human respiratory syncytial virus (HRSV) is an enveloped,
non-segmented negative-stranded RNA virus, classified
within the genus Pneumovirus of the family Paramyxoviridae (Collins et al., 2001). It is the main cause of severe
lower respiratory tract infections in very young children
(Glezen et al., 1986) and a pathogen of considerable importance in the elderly and high-risk adults (Falsey et al., 2005).
It is thought that HRSV enters the cell by attachment of the
G glycoprotein (Levine et al., 1987) to the cell membrane,
followed by fusion of the viral and cell membranes at
neutral pH promoted by the fusion (F) glycoprotein (Walsh
& Hruska, 1983) at the cell surface (Srinivasakumar et al.,
1991). The F protein also mediates fusion of the membrane
of infected cells with that of adjacent cells to form characteristic syncytia. HRSV encodes a third, small hydrophobic
(SH) glycoprotein, of unknown function, that is expressed
to high levels at the surface of infected cells but is incorporated inefficiently in the virus particle (Collins & Mottet,
1993).
Many authors have reported that the attachment (HN or H)
glycoprotein and the F glycoprotein of paramyxoviruses
0008-1715 G 2006 SGM
are both needed for membrane fusion (review by Lamb,
1993). For instance, co-expression of HN (or H) and F in the
same transfected cell is required for syncytium formation. It
has been proposed that HN, on binding to the cell receptor,
undergoes conformational changes that in turn could induce
conformational changes in F, leading to its activation for
membrane fusion.
There have been reports that G and SH enhance the formation of syncytia mediated by HRSV F when the three
proteins are expressed in the same cell (Heminway et al.,
1994; Pastey & Samal, 1997). It was suggested that G and SH
were involved in activation of F in a manner similar to that
proposed for the activation of paramyxovirus F by HN.
However, spontaneous mutants (Karron et al., 1997) or
genetically engineered recombinants of HRSV that lack G
and/or SH (Bukreyev et al., 1997; Techaarpornkul et al.,
2001) infect certain cell types in culture and induce formation of syncytia. In addition, expression of F alone in
transfected cells promotes syncytium formation (GonzálezReyes et al., 2001). Thus, it is clear that, in the case of HRSV,
the activity for membrane fusion resides in the F protein,
and its activation for membrane fusion is not dependent on
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 10 Aug 2017 09:40:03
Printed in Great Britain
1649
D. Martı́n and others
the activity of other viral glycoproteins, at least in viruses
with F as the only surface glycoprotein or in transfected cells
expressing only F.
The HRSV F protein is a type I glycoprotein that is synthesized as an inactive precursor (F0) of 574 amino acids. This
precursor is cleaved by furin-like proteases during maturation to yield two disulfide-linked polypeptides, F2 from the
N terminus and F1 from the C terminus. The F0 precursor of
HRSV and the related bovine RSV are cleaved twice, after
residues 109 (site I) and 136 (site II), which are preceded
by furin recognition motifs (González-Reyes et al., 2001;
Zimmer et al., 2001) (see Fig. 1 for a diagram of the primary
structure). In contrast, the F0 precursor of other paramyxoviruses is cleaved only once, at a position equivalent to that
of site II of HRSV F (Lamb & Kolakofsky, 2001).
HRSV F shares structural features with the F protein of
other paramyxoviruses, despite limited sequence identity.
Thus, all F proteins have three main hydrophobic regions:
one, at the N terminus, which acts as the signal peptide for
translocation into the ER; another region, which is the
membrane anchor or transmembrane domain near the C
terminus; and a third region at the N terminus of the F1
chain that is called the fusion peptide because it is thought,
by analogy with other fusion peptides (Harter et al., 1989;
Durrer et al., 1996), to be inserted into the target membrane
during the process of membrane fusion. The mature F protein is a homotrimer in which heptad repeat sequences, HRA
and HRB, are adjacent to the fusion peptide and to the
transmembrane region of each monomer, respectively.
HRA and HRB peptides of Simian virus 5 (SV5) (Joshi et al.,
1998) or HRSV F (Lawless-Delmedico et al., 2000; Matthews
et al., 2000) form trimeric complexes in solution. X-ray
crystallography of these complexes revealed an internal core
of three HRA a-helices bounded by three antiparallel HRB
a-helices packed into the grooves of the HRA coiled-coil
trimer (Baker et al., 1999; Zhao et al., 2000).
We have reported that purified HRSV F protein forms
rosettes of rods with two different shapes: cones and lollipops (Calder et al., 2000). The rosettes are formed by
aggregation of individual rods through their transmembrane regions. A membrane-anchorless form of F that lacks
the transmembrane region and the cytoplasmic tail (FTM{ )
is seen mainly as unaggregated cones, although a significant
proportion (approx. 20 %) of rosetted lollipops can also be
observed. Preparations of both F and FTM{ contain, in addition to molecules cleaved to F1 and F2 chains, uncleaved F0
molecules and partially processed intermediates called
FD1–109 and F2*. FD1–109 is generated when F0 is cleaved
only at site I and F2* when F0 is cleaved only at site II
(González-Reyes et al., 2001). Site II immediately precedes
the fusion peptide (Fig. 1).
When cleavage of the monomers is completed in vitro by
controlled trypsin digestion of purified FTM{ , the trimer
cones aggregate in rosettes of lollipop-shaped spikes (RuizArgüello et al., 2002). Deletion of the first 10 amino acids of
the fusion peptide eliminates aggregation of FTM{ , lending
support to the hypothesis that, after completion of cleavage
in all the monomers, FTM{ undergoes a conformational
change (reflected in a change of shape) that exposes the
fusion peptide and leads to aggregation. We now provide
evidence that the conformational changes that follow
activation of HRSV F by proteolytic cleavage require a
functional fusion peptide.
Fig. 1. F protein primary structure and
mutants used in this study. The HRSV F
protein primary structure is represented by a
rectangle (top), denoting the hydrophobic
regions (filled boxes), heptad repeats A and
B (HRA and HRB; hatched boxes), cysteine
residues ($) and sites of proteolytic processing (sites I and II). The anchorless form of F
(FTM”), which lacks the C-terminal 50 amino
acids, is shown below. SP, Signal peptide;
FP, fusion peptide; TM, transmembrane
region. F1 and F2 are the polypeptide
chains generated after proteolytic cleavage
of the F0 precursor and that remain covalently linked by a disulfide bond (S–S), as
indicated. A partial sequence of the F protein (residues 106–155), including furin
cleavage sites I and II (in bold) and the
fusion peptide (bold and italic), is shown
below the protein diagram, as well as the
point mutations and amino acid deletions
made for this study.
1650
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 10 Aug 2017 09:40:03
Journal of General Virology 87
Sequence requirements of HRSV F protein
METHODS
Cells, viruses and plasmids. The recombinant vaccinia virus that
expresses a soluble form of the HRSV F protein (Long strain) lacking
the C-terminal 50 amino acids (FTM{ ) was described by Bembridge
et al. (1999). Plasmid pRB21 carrying a copy of the FTM{ gene
(pRB21/FTM{ ) was mutagenized using the Quick-Change site-directed
mutagenesis kit (Stratagene) and the oligonucleotides shown in
Table 1 to generate the mutants depicted in Fig. 1. Integrity of the
FTM{ insert and presence of the desired mutations was confirmed by
automatic sequencing.
The different pRB21 plasmids were used to rescue vaccinia viruses
expressing the corresponding F proteins by the method of Blasco &
Moss (1995). This is based on the recovery of recombinant viruses able
to form plaques from cells infected with the vaccinia virus vRB12,
which lacks the VP37 gene, and transfected with pRB21 plasmids that
provide the VP37 gene, in addition to the desired gene. Recombinant
vaccinia viruses were plaque-purified three times to ensure homogeneity of the virus stocks. These were prepared in CV-1 cells grown
in Dulbecco’s medium supplemented with 10 % fetal calf serum, as
described previously (Calder et al., 2000).
A pTM1-derived plasmid carrying a full-length cDNA insert of the
HRSV F protein gene (pTM1/F) under a T7 polymerase promoter has
also been described previously (González-Reyes et al., 2001). The same
mutations introduced in pRB21/FTM{ were introduced in pTM1/F
using the same kit and oligonucleotides.
Protein purification. HEp-2 cells grown in Dulbecco’s medium
with 4 % fetal calf serum were infected with vaccinia viruses (m.o.i.
~0?5 p.f.u. per cell) expressing the FTM{ proteins described in the
previous section. Culture supernatants were harvested 48 h postinfection, cleared of cell debris and concentrated 100-fold and bufferexchanged to PBS by filtration through polyethersulfone membranes
(Vivaflow; Sartorius) of 100 kDa exclusion pore size. The concentrates were loaded onto immunoaffinity columns made with an antiF mAb 2F (Garcı́a-Barreno et al., 1989) bound to Sepharose [~5?0 mg
antibody (g resin)21]. Columns were washed with 20 vols PBS and
eluted with 20 vols 0?1 M glycine/Tris, pH 2?5. Elution of F protein
was followed by absorbance at 280 nm. Column fractions were neutralized with saturated Tris and concentrated and buffer-exchanged
to buffer A (10 mM Tris/HCl pH 7?5, 150 mM NaCl) with Vivaspin
(Sartorius). Purity was assessed by SDS-PAGE and Coomassie blue
staining. Specific bands were visualized by Western blots with antisera raised against either an F1-derived peptide (aF255–275) or a peptide encompassing residues 104–117 (aF104–117) (González-Reyes
et al., 2001). The latter antiserum recognizes exclusively epitopes
located in the segment between the two cleavage sites (I and II) of
the F0 precursor. Protein concentration was estimated by absorbance
at 280 nm with a calculated absorbance coefficient of 0?7 for a
1 mg ml21 solution.
Trypsin digestion and sucrose-gradient centrifugation. Purified
FTM{ proteins in buffer A were incubated with TPCK-trypsin (Sigma)
for 1 h at 4 uC, at a ratio of 2?5 mg trypsin (mg protein)21. Mockdigested samples were included as controls. The proteins were then
Table 1. Oligonucleotides used for site-directed mutagenesis
Two complementary oligonucleotides were used for each PCR-based mutagenic reaction, but only those of positive polarity are shown in
the table for simplicity. Each oligonucleotide name denotes the F nucleotides included in its sequence, followed by the amino acid substitution(s) introduced after PCR-based mutagenesis. The altered residues are underlined in the oligonucleotide sequences. The last two oligonucleotides indicate the nucleotides deleted (D) and the corresponding amino acids (in parentheses).
Oligonucleotide
OF411-444/G139A
OF411-453/G139V
OF420-450/L141N
OF417-453/L141V
OF417-460/L142N
OF417-460/L142V
OF425-461/G143A
OF420-460/G143V
OF428-468/G145A
OF428-468/G145V
OF428-471/S146A
OF440-471/I148N
OF440-473/I148V
OF446-485/S150A
OF436-473/S146A/S150A
OF446-485/G151A
OF446-485/G151V
OF450-490/T152A
OF440-477/S146A/T152A
OF446-485/S150A/T152A
OF440-482/S146A/S150A/T152A
OF402-471/D422-451/(D137-146 aa)
OF411-485/D433-463/(D141-150 aa)
http://vir.sgmjournals.org
Sequence (5§–3§)
GGAAAAGAAGATTTCTTGCTTTTTTGTTAGGTG
GGAAAAGAAGATTTCTTGTTTTTTTGTTAGTTGTTGGATCTGC
GATTTCTTGGTTTTAACTTAGGTGTTGGATC
CTTCATTTCTTGGTTTTGTGTTAGGTGTTGGATCTGC
CTTCATTTCTTGGTTTTTTGAATGGTGTTGGATCTGCAATCGCC
CTTCATTTCTTGGTTTTTTGGTAGGTGTTGGATCTGCAATCGCC
CTTGGTTTTTTGTTAGCTGTTGGATCTGCAATCGCC
CATTTCTTGGTTTTTTGTTAGTTGTTGGATCTGCAATCGCC
GGTTTTTTGTTAGGTGTTGCATCTGCAATCGCCAGTGGCAC
GGTTTTTTGTTAGGTGTTGTATCTGCAATCGCCAGTGGCAC
GGTTTTTTGTTAGGTGTTGGAGCTGCAATCGCCAGTGGCACTGC
GGTGTTGGATCTGCAAACGCCAGTGGCACTGC
GGTGTTGGATCTGCAGTCGCCAGTGGCACTGCTG
GGATCTGCAATCGCCGCTGGCACTGCTGTATCTAAGGTCC
GTTAGGTGTTGGAGCTGCAATCGCCGCTGGCACTGCTG
GGATCTGCAATCGCCAGTGCGACTGCTGTATCTAAGGTCC
GGATCTGCAATCGCCAGTGTAACTGCTGTATCTAAGGTCC
CTGCAATCGCCAGTGGCGCTGCTGTATCTAAGGTCCTGCAC
GGTGTTGGAGCTGCAATCGCCAGTGGCGCTGCTGTATC
GGATCTGCAATCGCCGCTGGCGCTGCTGTATCTAAGGTCC
GGTGTTGGAGCTGCAATCGCCGCTGGCGCTGCTGTATCTAAGG
GCAAGAAAAGGAAAAGAAGAGCAATCGCCAGTGGCACTGC
GGAAAAGAAGATTTCTTGGTTTTGGCACTGCTGTATCTAAGGTCC
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 10 Aug 2017 09:40:03
1651
D. Martı́n and others
loaded onto preformed 10–25 % sucrose gradients in buffer A and
centrifuged in a Beckman SW40 rotor at 39 000 r.p.m. for 15 h at
4 uC. One millilitre fractions were collected from the top of the tube.
Aliquots of each fraction were analysed by SDS-PAGE and Western
blot with aF255–275 as described by González-Reyes et al. (2001).
Syncytium formation assay. BSR-T7/5 cells (Buchholz et al.,
1999) (a BHK-derived cell line that constitutively expresses the T7
RNA polymerase, a kind gift of K.-K. Conzelmann) growing in
microchamber culture slides were transfected with 0?5 mg of the
pTM1-derived plasmids indicated in the figure legends. Transfections were done by the calcium phosphate method (MBS, mammalian transfection kit; Stratagene). Forty-eight hours later, the cells
were fixed with cold methanol for 5 min followed by cold acetone
for 30 s. Fixed cells were then processed for indirect immunofluorescence as described using a pool of anti-F mAbs (Garcı́a-Barreno
et al., 1996).
Electron microscopy (EM). Protein samples in buffer A were
absorbed onto carbon films and stained with 1 % sodium silicotungstate (pH 7?0). A JEOL 1200 electron microscope, operated at
100 kV, was used to view the samples. Micrographs were taken
under minimum-dose, accurate defocus conditions to preserve
details to ~1?5 nm (Wrigley et al., 1986).
RESULTS
Design of mutations in the F protein fusion
peptide
Deletion of the first 10 amino acids of the fusion peptide
(D137–146) eliminated aggregation of FTM{ after trypsin
cleavage, suggesting that aggregation occurred through
interactions of the fusion peptides of several FTM{ molecules. The D137–146 deletion also inhibited syncytium
formation in transfected cells that expressed full-length
F (Ruiz-Argüello et al., 2004).
To detail the sequence requirements of the fusion peptide
for both FTM{ aggregation and F-induced membrane fusion,
two types of additional mutations were designed.
Deletions. In addition to the previously reported deletion
D137–146 (Ruiz-Argüello et al., 2004), two other deletions
were engineered that eliminated either 10 internal residues
(D141–150) or the entire sequence of the predicted fusion
peptide (D137–155) (Fig. 1). The latter deletion, however,
inhibited the expression of FTM{ and could not be analysed further.
Amino acid substitutions. Following the proposal of
Bordo & Argos (1991) for ‘safe’ substitutions in protein
families, the amino acid substitutions illustrated in Fig. 1
were designed to: (i) reduce the hydrophobicity of the
fusion peptide and alter the chemical character of the
amino acid side chain (L or I to N), (ii) change the sidechain length of the mutated amino acid (G to V), (iii)
maintain the chemical properties of the mutated residue
(L or I to V) or (iv) eliminate the polar character of certain amino acids (S or T to A).
1652
Effect of mutations in the fusion peptide on
aggregation of FTM” after trypsin cleavage
The mutations described in the previous section were introduced into recombinant vaccinia viruses to express the corresponding FTM{ proteins. Wild-type and mutant proteins
were purified from culture supernatants of cells infected
with the corresponding vaccinia virus recombinants by
immunoaffinity chromatography. Purity was checked by
SDS-PAGE followed by Coomassie blue staining of the
purified proteins. Fig. 2(a) shows results obtained with
representative mutants. In all cases, a major band with the
mobility of the fully processed F1 chain and variable
amounts of a contaminating ~20 kDa band were observed.
However, minor bands of lower mobility than F1 were also
present in all preparations, as reported before (GonzálezReyes et al., 2001). These bands were identified as the
uncleaved F0 precursor and the intermediate FD1–109
(cleaved only at site I), based on reactivity with two antisera:
one raised against a peptide of the F1 chain (aF255–275)
(Fig. 2b) and the other against a peptide spanning residues
104–117 (aF104–117) (Fig. 2c), which recognizes only epitopes
located between cleavage sites I and II of the F polypeptide
(González-Reyes et al., 2001). The latter antiserum also
recognizes an F2* band, corresponding to an intermediate
of the F2 chain cleaved only at site II (Fig. 2c). In some
mutants, the relative proportions of F0, FD1–109 and F2* to
F1 were essentially the same as in the wild-type, but in others
there were significant quantitative differences. For instance,
wild-type proportions were maintained in the L141V mutant
but the relative intensities of F0, FD1–109 and F2* to F1 were
reduced in the G151V mutant. This might reflect changes in
the accessibility to furin of cleavage sites I or II as a consequence of local changes introduced by certain mutations
in the FTM{ structure.
To test the effect of the different mutations on aggregation
of FTM{ , the purified proteins were treated with limited
amounts of trypsin to complete cleavage at sites I and II, as
described previously (Ruiz-Argüello et al., 2002). The proteins were then analysed either before or after trypsin digestion by sedimentation in 10–25 % sucrose gradients and by
EM. The results obtained are shown in Figs 3 and 4 for the
wild-type FTM{ protein and for five representative mutants.
Wild-type FTM{ sedimented mainly in fractions 5 and 6 of
the gradient, although trailing towards higher-density fractions was also observed. After trypsin treatment, there was a
clear shift in the sedimentation profile of FTM{ towards
fractions of higher sucrose concentration (Fig. 3). These
results correlated with observations made by EM. While
FTM{ was seen mainly as unaggregated cone-shaped rods
in mock-digested samples, this protein was aggregated in
rosettes of lollipop-shaped spikes after trypsin cleavage
(Fig. 4). It should be noted that, while F0 and FD1–109 were
observed in the gradient fractions before trypsin treatment
of FTM{ , they were not present after trypsin digestion. This
indicated completion of cleavage of those intermediates at
sites I and II to generate mature F1 chain (Fig. 3), although
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 10 Aug 2017 09:40:03
Journal of General Virology 87
Sequence requirements of HRSV F protein
Fig. 2. Electrophoretic analysis of purified FTM” proteins. The wild-type FTM” protein and the different anchorless mutant
proteins indicated above each lane were purified by immunoaffinity chromatography as indicated in Methods. Purified proteins
were resolved by SDS-PAGE under reducing conditions and revealed by either Coomassie blue staining (a) or Western
blotting with antisera aF255–275 (b) or aF104–117 (c), as indicated. Lane M, molecular mass markers. The positions of the F1
band and the proteolytic intermediates F0, FD1–109 and F2* are indicated. The asterisk (*) denotes a contaminating band
observed by Coomassie blue staining.
Fig. 3. Sucrose-gradient centrifugation of the wild-type anchorless F protein and fusion peptide mutants. Immunoaffinitypurified wild-type FTM” and mutant anchorless proteins (shown in Fig. 1) were either left untreated (”) or treated with TPCKtrypsin (+) as indicated in Methods. Aliquots of each protein (~100 mg) were loaded on linear 10–25 % sucrose gradients
and centrifuged at 39 000 r.p.m. for 15 h at 4 6C. Thirteen 1 ml fractions were collected from the top of the tube and 30 ml of
each fraction was analysed by Western blot with aF255–275. A partial hydrophobicity plot (residues 120–180), including the
predicted fusion peptide (FP), obtained with the algorithm of Kyte & Doolittle (1982) is shown to the right of each blot. The
hydrophobicity plot of the wild-type sequence (dotted line) is included in each panel for comparison.
http://vir.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 10 Aug 2017 09:40:03
1653
D. Martı́n and others
Fig. 4. EM of the wild-type FTM” and the fusion peptide mutants. Aliquots of the same proteins analysed in Fig. 3 were
negatively stained and observed by EM either before (”) or after (+) trypsin treatment. Bars, 50 nm.
other, minor, faster-migrating bands were also observed.
The efficiency of cleavage by trypsin of the F0 and FD1–109
intermediates in FTM{ preparations of the mutants was
similar to that of the wild-type (see other panels of Fig. 3).
The FTM{ mutant D141–150 also sedimented in fractions
5–7 of the sucrose gradient (Fig. 3) but, in contrast to the
wild-type anchorless protein, the sedimentation profile did
not change after trypsin digestion. In the EM, the mutant
D141–150 was seen unaggregated after both mock and
trypsin treatment (Fig. 4).
L141 was replaced with either V or N in two different
mutants (Fig. 1). The L141V substitution shortened the side
chain of the residue by a methyl group and did not change
the hydrophobicity profile of the fusion peptide significantly. In contrast, the L141N substitution led to a moderate
decrease in the hydrophobicity of the first half of the fusion
peptide (Fig. 3). The purified L141V FTM{ mutant protein
sedimented mainly in fractions 5–8 of the sucrose gradient
(Fig. 3) and it was seen as unaggregated cones by electron
microscopy (Fig. 4). However, after trypsin treatment, this
mutant sedimented in fractions of higher density towards
the bottom of the tube (Fig. 3) and it was seen aggregated in
1654
rosettes of lollipop-shaped spikes under the EM (Fig. 4).
The L141N FTM{ protein also sedimented in fractions 5–8 of
the sucrose gradient but, in contrast to the L141V mutant,
trypsin digestion did not alter its sedimentation profile
(Fig. 3). In addition, the L141N FTM{ molecules remained
as unaggregated cone-shaped spikes after trypsin treatment
(Fig. 4).
Fig. 3 also shows the sedimentation behaviour of another
pair of FTM{ mutants, G151A and G151V, in which the
hydrophobicity of the fusion peptides was marginally
increased. The sedimentation properties of the G151A FTM{
mutant resemble those of the wild-type protein both before
and after trypsin digestion (Fig. 3). Thus, completion of
cleavage by trypsin led to a shift of its sedimentation profile
towards the bottom of the tube. This behaviour correlated
with a change in shape from unaggregated cones before
trypsin treatment to aggregated lollipops after trypsin digestion (Fig. 4). In contrast, neither the sedimentation profile
nor the shape of the G151V FTM{ mutant was changed after
completion of cleavage by trypsin (Figs 3 and 4). In this case,
the mutant molecules sedimented in fractions 5–8 of the
gradient and were seen to be unaggregated irrespective of
trypsin treatment.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 10 Aug 2017 09:40:03
Journal of General Virology 87
Sequence requirements of HRSV F protein
In all cases in which FTM{ was observed to aggregate after
trypsin treatment, the subsequent change of shape, from
cones to lollipops, was also noticed. In these mutants, a small
proportion of molecules were already cleaved and aggregated in small rosettes before trypsin treatment. However,
mutations that inhibited aggregation of FTM{ after trypsin
treatment also inhibited the change of shape.
Effect of mutations in the fusion peptide on
syncytium formation
The mutations shown in Fig. 1 were also introduced in the
full-length F gene, inserted in the pTM1 vector under a T7
promoter. As reported previously (González-Reyes et al.,
2001), transfection of BSR-T7/5 cells (which express the T7
RNA polymerase constitutively) with the wild-type pTM1/F
plasmid led to expression of F and formation of large
syncytia that were visualized by immunofluorescence 48 h
after transfection (Fig. 5). The mutants L141V and G151A
also induced large syncytia after transfection of BSR-T7/5
cells (Fig. 5). These two mutations did not inhibit aggregation of FTM{ after trypsin treatment. In contrast, BRS-T7/
5 cells transfected with pTM1 plasmids carrying the F gene
with the deletion D141–150 or the amino acid substitutions
L141N or G151V expressed high levels of the corresponding
F proteins, detected by immunofluorescence, but formation
of syncytia was not observed. Thus, the same mutations that
inhibited FTM{ aggregation after trypsin treatment (Figs 3
and 4) eliminated the formation of syncytia by the fulllength F protein (Fig. 5).
Location of mutations in a putative a-helical
fusion peptide
The mutations introduced in the full-length F and tested for
syncytium formation are shown in the a-helical wheel of
Fig. 6. Irrespective of their position on the helical wheel,
mutations that drastically altered the chemical properties of
the amino acid side chain (shown in dark grey) inhibited
syncytium formation. In contrast, those changes that maintained the chemical properties of the amino acid side chain
(shown in light grey) induced syncytium formation in
transfected cells. In addition to the single mutants shown in
Fig. 6, double and triple mutants in which S146, S150 and
T152 were replaced by A were also made. This was done to
eliminate partially or completely all the polar amino acids of
the fusion peptide. All these double and triple mutants also
induced syncytium formation in transfected cells (Fig. 7),
indicating that a peptide without polar residues is still
capable of mediating membrane fusion. Thus, at least for
this activity, as assessed in the syncytium formation assay,
the polar character of those residues is dispensable.
Only a subset of fusion peptide mutants were tested for
FTM{ aggregation after trypsin treatment (enclosed in
squares in Fig. 6). In all cases, mutations that drastically
altered the properties of the particular amino acid side chain
inhibited the conformational change and the aggregation of
FTM{ and correlated with inhibition of syncytium formation
http://vir.sgmjournals.org
Fig. 5. Syncytium formation by full-length wild-type F or by
fusion peptide mutants. BSR-T7/5 cells were transfected with
pTM1 plasmids carrying inserts encoding full-length F with
either the wild-type sequence (Fwt) or the indicated fusion
peptide mutants. Forty-eight hours later, the cells were fixed
and processed for immunofluorescence with mAb 2F, as indicated in Methods.
by full-length F. Mutants that maintained the chemical
character of the substituted amino acid allowed the conformational change and aggregation of FTM{ and syncytium
formation by full-length F.
DISCUSSION
Previous studies have addressed the sequence requirements
of the F protein fusion peptides of other paramyxoviruses,
such as Newcastle disease virus (Sergel et al., 2001) or SV5
(Russell et al., 2004), for membrane fusion. However, while
sharing structural features with other paramyxovirus F
proteins, HRSV F also shows important differences. For
instance, HRSV F is cleaved twice during the maturation
process, while other paramyxovirus F proteins are cleaved
only once. Furthermore, HRSV F is capable of inducing
syncytium formation in the absence of other viral proteins
(González-Reyes et al., 2001), while most paramyxovirus F
proteins require co-expression of the attachment (HN or H)
protein for membrane fusion (Lamb, 1993). Thus, findings
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 10 Aug 2017 09:40:03
1655
D. Martı́n and others
for other paramyxovirus F proteins may not be directly
applicable to HRSV F.
In addition, this study addresses the sequence requirements
of the fusion peptide for the conformational changes that
follow completion of cleavage of an anchorless form of
HRSV F (FTM{ ). Since these changes apparently involved
exposure of the fusion peptide (Ruiz-Argüello et al., 2004), a
key step during the process of membrane fusion, they may
reflect changes in the full-length F during the process of
membrane fusion. This hypothesis is strengthened by the
correlation reported here between the sequence requirements for aggregation and change of shape of FTM{ and
induction of syncytium formation by full-length F. An
explanation of the inhibition of FTM{ aggregation by mutations in the fusion peptide is not available, but it may be
that the mutations cause local structural disturbances
which prevent exposure of the fusion peptide. Whether
fusion peptide mutations that inhibit syncytium formation
mediated by other paramyxovirus F proteins also inhibit
the conformational changes that follow activation of those
molecules has not been reported.
Fig. 6. Representation of the F protein fusion peptide in an
a-helical wheel. The residues of the HRSV F protein fusion
peptide (a) are represented in an a-helical wheel (b). The
amino acid substitutions tested in the full-length F for syncytium
formation are shown next to the corresponding wild-type residues. Mutations enclosed in squares were also tested for
aggregation of FTM” after cleavage by trypsin. Mutations that
inhibited either of those activities are shaded dark grey while
those that displayed wild-type phenotypes are shaded light
grey.
Our findings differ substantially from those reported for
other viral glycoproteins involved in membrane fusion. For
instance, exposure of the purified ectodomain of influenza
virus haemagglutinin (HA) to acidic pH, a key event in
triggering HA-mediated membrane fusion (Skehel et al.,
1982), induces conformational changes in HA that expose
its fusion peptide and result in HA aggregation. However,
acidification of HA fusion peptide mutants that are inactive
for membrane fusion also induces conformational changes
Fig. 7. Syncytium formation by F protein mutants with changes in polar residues of the fusion peptide. Plasmids encoding
either wild-type F or single, double or triple substitutions of S146, S150 and T152 by A were used to transfect BSR-T7/5
cells, as indicated in each panel. Forty-eight hours later, the cells were fixed and processed for immunofluorescence with mAb
2F.
1656
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 10 Aug 2017 09:40:03
Journal of General Virology 87
Sequence requirements of HRSV F protein
and aggregation of the HA ectodomain (Cross et al., 2001).
Thus, while aggregation of the HA ectodomain after exposure to low pH does not require an active fusion peptide,
the structural changes that follow completion of cleavage of
HRSV FTM{ and lead to its aggregation are inhibited in
mutants with an inactive fusion peptide.
It has been postulated that the fusion peptides of viral type I
fusion proteins adopt an a-helical conformation, at least
after their insertion into the target membrane (Durrer et al.,
1996). However, the effects of the mutations analysed in this
study were independent of their location in an a-helical
wheel representing the putative a-helix structure of the
HRSV F fusion peptide. Furthermore, those effects were
closely related to changes in the chemical properties of
specific residues, irrespective of changes in hydrophobicity
or polar character. Thus, although the fusion peptide of
HRSV F may need a certain hydrophobic character for insertion into the target membrane, there are other sequence
requirements for its activity. These requirements may
restrict the accumulation of changes in this part of the
molecule, consistent with its sequence conservation among
related pneumoviruses and among paramyxoviruses in
general (reviewed by Collins et al., 2001).
Calder, L. J., González-Reyes, L., Garcı́a-Barreno, B., Wharton, S. A.,
Skehel, J. J., Wiley, D. C. & Melero, J. A. (2000). Electron micros-
copy of the human respiratory syncytial virus fusion protein and
complexes that it forms with monoclonal antibodies. Virology 271,
122–131.
Collins, P. L. & Mottet, G. (1993). Membrane orientation and oligo-
merization of the small hydrophobic protein of human respiratory
syncytial virus. J Gen Virol 74, 1445–1450.
Collins, P. L., Chanock, R. M. & Murphy, B. R. (2001). Respiratory
syncytial virus. In Fields Virology, 4th edn, pp. 1443–1485. Edited by
D. M. Knipe & P. M. Howley. Philadelphia: Lippincott Williams &
Wilkins.
Cross, K. J., Wharton, S. A., Skehel, J. J., Wiley, D. C. & Steinhauer,
D. A. (2001). Studies on influenza haemagglutinin fusion peptide
mutants generated by reverse genetics. EMBO J 20, 4432–4442.
Durrer, P., Galli, C., Hoenke, S., Corti, C., Glück, R., Vorherr, T. &
Brunner, J. (1996). H+-induced membrane insertion of influenza
virus hemagglutinin involves the HA2 amino-terminal fusion peptide
but not the coiled coil region. J Biol Chem 271, 13417–13421.
Falsey, A. R., Hennessey, P. A., Formica, M. A., Cox, C. & Walsh, E. E.
(2005). Respiratory syncytial virus infection in elderly and high-risk
adults. N Engl J Med 352, 1749–1759.
Garcı́a-Barreno, B., Palomo, C., Peñas, C., Delgado, T., PerezBreña, P. & Melero, J. A. (1989). Marked differences in the antigenic
structure of human respiratory syncytial virus F and G glycoproteins.
J Virol 63, 925–932.
Garcı́a-Barreno, B., Delgado, T. & Melero, J. A. (1996). Identification
ACKNOWLEDGEMENTS
We are grateful to Rafael Blasco (INIA, Madrid) for the pRB21 plasmid
and the vRB12 virus and to Karl-Klaus Conzelmann (Munich) for the
BSR-T7/5 cells. This work was supported in part by grants PM99-9014
from Ministerio de Educación y Ciencia and 01/24 from ISCIII (to
J. A. M.) and by the Medical Research Council (to J. J. S and L. J. C.).
D. M. was the recipient of a predoctoral fellowship from ISCIII.
of protein regions involved in the interaction of human respiratory
syncytial virus phosphoprotein and nucleoprotein: significance for
nucleocapsid assembly and formation of cytoplasmic inclusions.
J Virol 70, 801–808.
Glezen, W. P., Taber, L. H., Frank, A. L. & Kasel, J. A. (1986). Risk of
primary infection and reinfection with respiratory syncytial virus.
Am J Dis Child 140, 543–546.
González-Reyes, L., Ruiz-Argüello, M. B., Garcı́a-Barreno, B.,
Calder, L., López, J. A., Albar, J. P., Skehel, J. J., Wiley, D. C. &
Melero, J. A. (2001). Cleavage of the human respiratory syncytial
virus fusion protein at two distinct sites is required for activation of
membrane fusion. Proc Natl Acad Sci U S A 98, 9859–9864.
REFERENCES
Harter, C., James, P., Bachi, T., Semenza, G. & Brunner, J. (1989).
Baker, K. A., Dutch, R. E., Lamb, R. A. & Jardetzky, T. S. (1999).
Structural basis for paramyxovirus-mediated membrane fusion.
Mol Cell 3, 309–319.
Bembridge, G. P., López, J. A., Bustos, R., Melero, J. A., Cook, R.,
Mason, H. & Taylor, G. (1999). Priming with a secreted form of
the fusion protein of respiratory syncytial virus (RSV) promotes
interleukin-4 (IL-4) and IL-5 production but not pulmonary
eosinophilia following RSV challenge. J Virol 73, 10086–10094.
Blasco, R. & Moss, B. (1995). Selection of recombinant vaccinia
viruses on the basis of plaque formation. Gene 158, 157–162.
Bordo, D. & Argos, P. (1991). Suggestion for ‘‘safe’’ residue substitu-
tions in site-directed mutagenesis. J Mol Biol 217, 721–729.
Buchholz, U. J., Finke, S. & Conzelmann, K.-K. (1999). Generation
of bovine respiratory syncytial virus (BRSV) from cDNA: BRSV NS2
is not essential for virus replication in tissue culture, and the human
RSV leader region acts as a functional BRSV genome promoter.
J Virol 73, 251–259.
Hydrophobic binding of the ectodomain of the influenza hemagglutinin to membranes occurs through the ‘‘fusion peptide’’. J Biol
Chem 264, 6459–6464.
Heminway, B. R., Yu, Y., Tanaka, Y., Perrine, K. G., Gustafson, E.,
Bernstein, J. M. & Galinski, M. S. (1994). Analysis of respiratory syn-
cytial virus F, G and SH proteins in cell fusion. Virology 200, 801–805.
Joshi, S. B., Dutch, R. E. & Lamb, R. A. (1998). A core trimer of the
paramyxovirus fusion protein: parallels to influenza virus hemagglutinin and HIV-1 gp41. Virology 248, 20–34.
Karron, R. A., Buonagurio, D. A., Georgiu, A. F. & 8 other authors
(1997). Respiratory syncytial virus (RSV) SH and G proteins are
not essential for viral replication in vitro: clinical evaluation
and molecular characterization of a cold-passaged, attenuated RSV
subgroup B mutant. Proc Natl Acad Sci U S A 94, 13961–13966.
Kyte, J. & Doolittle, R. (1982). A simple method for displaying the
hydrophobic character of a protein. J Mol Biol 157, 105–132.
Lamb, R. A. (1993). Paramyxovirus fusion: a hypothesis for changes.
Bukreyev, A., Whitehead, S. S., Murphy, B. R. & Collins, P. L. (1997).
Virology 197, 1–11.
Recombinant respiratory syncytial virus from which the entire SH
gene has been deleted grows efficiently in cell cultures and exhibits
site-specific attenuation in the respiratory tract of mouse. J Virol 71,
8973–8982.
Lamb, R. A. & Kolakofsky, D. (2001). Paramyxoviridae: the viruses
http://vir.sgmjournals.org
and their replication. In Fields Virology, 4th edn, pp. 1305–1340.
Edited by D. M. Knipe & P. M. Howley. Philadelphia: Lippincott
Williams & Wilkins.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 10 Aug 2017 09:40:03
1657
D. Martı́n and others
Lawless-Delmedico, M. K., Sista, P., Sen, R. & 7 other authors (2000).
Heptad-repeat regions of respiratory syncytial virus F1 protein form a
six-membered coiled-coil complex. Biochemistry 39, 11684–11695.
Levine, S., Klaiber-Franco, R. & Paradiso, P. R. (1987). Demon-
stration that glycoprotein G is the attachment protein of respiratory
syncytial virus. J Gen Virol 68, 2521–2524.
Matthews, J. M., Young, T. F., Tucker, S. P. & Mackay, J. P. (2000).
The core of the respiratory syncytial virus fusion protein is a trimeric
coiled coil. J Virol 74, 5911–5920.
Pastey, M. K. & Samal, S. K. (1997). Analysis of bovine respiratory
syncytial virus envelope glycoproteins in cell fusion. J Gen Virol 78,
1885–1889.
activity of the Newcastle disease virus fusion protein. J Virol 75,
7934–7943.
Skehel, J. J., Bayley, P. M., Brown, E. B., Martin, S. R., Waterfiels,
M. D., White, J. M., Wilson, I. A. & Wiley, D. C. (1982). Changes in the
conformation of influenza hemagglutinin at the pH optimum of
virus-mediated membrane fusion. Proc Natl Acad Sci U S A 79,
968–972.
Srinivasakumar, N., Ogra, P. L. & Flanagan, T. D. (1991).
Characteristics of fusion of respiratory syncytial virus with HEp-2
cells as measured by R18 fluorescence dequenching assay. J Virol 65,
4063–4069.
Techaarpornkul, S., Barretto, N. & Peeples, M. E. (2001). Functional
Ruiz-Argüello, M. B., González-Reyes, L., Calder, L. J., Palomo, C.,
Martı́n, D., Saı́z, M. J., Garcı́a-Barreno, B., Skehel, J. J. & Melero, J. A.
(2002). Effect of proteolytic processing at two distinct sites on shape
analysis of recombinant respiratory syncytial virus deletion mutants
lacking the small hydrophobic and/or attachment glycoprotein gene.
J Virol 75, 6825–6834.
and aggregation of an anchorless fusion protein of human respiratory syncytial virus and fate of the intervening segment. Virology
298, 317–326.
Walsh, E. E. & Hruska, J. (1983). Monoclonal antibodies to
respiratory syncytial virus proteins: identification of the fusion
protein. J Virol 47, 171–177.
Ruiz-Argüello, M. B., Martı́n, D., Wharton, S. A. & 7 other authors
(2004). Proteolytic cleavage of a soluble form of human respiratory
Wrigley, N. G., Brown, E. B. & Skehel, J. J. (1986). Electron
syncytial virus fusion protein leads to exposure of the fusion peptide
without changing the protein thermostability: implications for the
membrane fusion mechanism. J Gen Virol 85, 3677–3687.
Russell, C. J., Jardetzky, T. & Lamb, R. A. (2004). Conserved glycine
residues in the fusion peptide of the paramyxovirus fusion protein
regulate activation of the native state. J Virol 78, 13727–13742.
Sergel, T. A., McGinnes, L. W. & Morrison, T. G. (2001). Mutations in
the fusion peptide and adjacent heptad repeat inhibit folding or
1658
microscopy of influenza virus. In Electron Microscopy of Proteins,
vol. 5, Viral Structure, pp. 103–163. Edited by J. R. Harris & R. W.
Horne. London: Academic Press.
Zhao, X., Singh, M., Malashkevich, V. N. & Kim, P. S. (2000).
Structural characterization of the human respiratory syncytial virus
fusion protein core. Proc Natl Acad Sci U S A 97, 14172–14177.
Zimmer, G., Budz, L. & Herrler, G. (2001). Proteolytic activation of
respiratory syncytial virus fusion protein. Cleavage at two furin
consensus sequences. J Biol Chem 276, 31642–31650.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 10 Aug 2017 09:40:03
Journal of General Virology 87