Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Cytokinesis wikipedia , lookup
Cell growth wikipedia , lookup
Tissue engineering wikipedia , lookup
Cell encapsulation wikipedia , lookup
Extracellular matrix wikipedia , lookup
Organ-on-a-chip wikipedia , lookup
List of types of proteins wikipedia , lookup
Cell culture wikipedia , lookup
CHARACTERIZATION OF ADULT AND EMBRYONIC STEM CELL PROLIFERATION, DIFFERENTIATION, AND INTEGRATION IN VITRO AND IN A NIGROSTRIATAL SLICE CULTURE SYSTEM By SEAN M. KEARNS A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2006 Copyright 2006 by Sean M. Kearns I would like to thank my wife, family and friends without whose help all of this would not have been possible. ACKNOWLEDGMENTS I would like to thank my family (Mom, Dad, and Kelly) for all the love and support they have given me growing up. I thank my friends for all the good times that made life worth living. I would also like to thank Dr. Dennis Steindler, Dr. Eric Laywell, and the rest of the Steindler and Laywell labs for teaching me how to do science, and for helping me to find why I do science. Finally I thank my wife Debbie. Her love and support have made me complete, and I am eternally grateful that she is a part of my life. iv TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................................................................................. iv LIST OF FIGURES .......................................................................................................... vii ABSTRACT....................................................................................................................... ix CHAPTER 1 STEM CELL BIOLOGY..............................................................................................1 Stem Cell Characterization ...........................................................................................1 Embryonic Stem Cells ..................................................................................................2 Adult Stem Cells...........................................................................................................4 Adult Neural Stem Cell Differentiation........................................................................6 Stem Cell Niches and Extracellular Matrix ..................................................................7 2 PARKINSON’S DISEASE ..........................................................................................9 Overview and Anatomy................................................................................................9 Genetic Links To Parkinson’s Disease .......................................................................11 Alpha-Synuclein Mutations.................................................................................11 Parkin Mutations .................................................................................................13 PTEN Induced Kinase-1 Mutations.....................................................................14 Environmental Links To Parkinson’s Disease............................................................14 Rural Living Conditions ......................................................................................14 Pesticides and Parkinson’s Disease .....................................................................15 Heavy Metal Exposure and Parkinson’s Disease ................................................16 Modeling Parkinson’s Disease ...................................................................................17 Current Therapies for Parkinson’s Disease ................................................................18 Pharmacological Therapies .................................................................................18 Surgical Therapies ...............................................................................................19 Cell Replacement Therapies................................................................................19 3 MATERIALS AND METHODS ...............................................................................22 Neurosphere Culture and Asteron Cell Characterization ...........................................22 Generation of Neurospheres ................................................................................22 Differentiation and Immunolabeling of Spheres .................................................22 v In Situ Hybridization with GFAP cDNA.............................................................23 Analysis of Cell Death.........................................................................................24 Electrophysiology................................................................................................25 ECM Effects on Neurosphere Migration....................................................................26 Slice Culture Preparation............................................................................................27 6-Hydroxy Dopamine Nigrostriatal Lesions .......................................................27 Embryonic Stem Cell Neural Precursor Transplants...........................................28 Immunocytochemistry and Quantification ..........................................................28 Electrophysiology of Slice Culture Transplants..................................................29 4 RESULTS ...................................................................................................................31 Neural Stem Cell Differentiation and the Asteron Phenotype....................................31 Combination of Asteron Markers........................................................................32 Analysis of Cell Death.........................................................................................32 Physiological Properties of Hybrid Asterons ......................................................33 Extracellular Matrix Influence on Neurosphere Migration ........................................34 Nigrostriatal Slice Culture ..........................................................................................36 6-Hydroxy Dopamine Lesions of Nigrostriatal Slice Cultures ...........................37 Real Time Analysis of Nigrostriatal Degeneration .............................................38 Nigrostriatal Slice Culture Applications.....................................................................38 Embryonic Stem Cell Neural Precursor Transplants into Nigrostriatal Slice Cultures ............................................................................................................39 Embryonic Stem Cell Neural Precursor Integration and Maturation in Slice Cultures ............................................................................................................39 Dopaminization of Transplantable Cell Populations..................................................40 Dopamine Neuron Generation from ESNP Culture In Vitro...............................40 Dopamine Neuron Generation from ESNP Cultures in Slice Culture ................40 Dopaminization of Adult Stem Cell Cultures .....................................................41 5 DISCUSSION AND CONCLUSIONS ......................................................................67 LIST OF REFERENCES...................................................................................................77 BIOGRAPHICAL SKETCH .............................................................................................88 vi LIST OF FIGURES Figure page 4-1. Combined β-III tubulin and GFAP immunolabeling reveals the temporal progression of the asteron phenotype.......................................................................42 4-2. Antibodies against β-III tubulin and GFAP reveal three immunophenotypes, and label separate sub-cellular elements within asterons................................................43 4-3. Asterons co-express β-III tubulin with S100β, and transcribe GFAP mRNA. .......44 4-4. Asteron appearance corresponds with neuronal reduction that is not attributable to apoptotic cell loss.................................................................................................45 4-5. Caspase 3 analysis of cell death accords well with TUNEL data. ...........................46 4-6. Physiology of neurons, astrocytes, and asterons. .....................................................47 4-7. Phenotype immunostaining of neurosphere derived cells. .......................................48 4-8. Velocity plot of neurosphere derived cells on different ECM substrates..................49 4-9. Migration distances of neurosphere derived cells on ECM substrates.....................50 4-10. Neurosphere derived cell migration patterns and measurements. ...........................51 4-11. Slice culture viability and nigrostriatal circuit maintenance. ..................................52 4-12. 6-Hydroxy Dopamine lesion of nigrostriatal slice cultures.....................................53 4-13. Nova-red staining of TH reveals control and lesioned nigrostriatal circuitry.. .......54 4-14. Cytoarchitectural changes in 6-OHDA lesion slice.................................................55 4-15. Nova-red labeling of striatal TH shows effect of exposure to 6-OHDA. ...............56 4-17. Real time analysis of TH-GFP.................................................................................58 4-18. ESNP transplants into slice cultures........................................................................59 4-19. Long term ESNP transplants in slice cultures. ........................................................59 vii 4-20. Laminin enhances ESNP migration through slice cultures After 6 days in cultures.. ...................................................................................................................60 4-21. Laminin enhances process outgrowth of ESNP’s in slice cultures. ........................60 4-22. Green fluroescent protein Positive ESNP striatal transplant.. .................................61 4-23. Electrophysiological Characterization of Transplanted Cells. ................................62 4-24. ESNP’s located near the substantia nigra. ...............................................................62 4-25. Increase in TH+ neurons derived from ESNP’s exposed to ventralizing agents.....63 4-26. In vitro ESNP dopaminization.................................................................................63 4-27. Dopaminized ESNP’s implanted into slice cultures................................................64 4-28. Adult neural stem cells exposed to dopaminzing cytokines express TH. ...............65 4-29. Induced TH+ adult stem cells. Adult neural stem cells exposed to FGF8, SHH, and pleiotrophin........................................................................................................66 viii Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy CHARACTERIZATION OF ADULT AND EMBRYONIC STEM CELL PROLIFERATION, DIFFERENTIATION, AND INTEGRATION IN VITRO AND IN A NIGROSTRIATAL SLICE CULTURE SYSTEM By Sean M. Kearns August 2006 Chair: Dennis A. Steindler Major department: Medical Sciences—Molecular Cell Biology Stem cell therapy holds great promise in repairing brain damage caused by neurodegenerative diseases, such as Parkinson’s disease. To fully use these cells, a better understanding is needed of the mechanisms and processes that control their proliferation, migration, and differentiation. Our study used both in vitro and slice culture techniques to examine adult neural and embryonic stem cells. Our initial experiments showed that adult neural stem cells can generate hybrid cells (asterons) in culture. These asterons appear to be hybrid cells that express both markers of immature neurons and astrocytes, and appear to be the result of transdifferentiation from a neuron to an astrocyte. We also examined the effects of different extracellular matrix molecules on the migration of adult neurosphere derived cells. Our results showed that laminin and fibronectin are permissive for migration and enhance outgrowth. In contrast, chondroitin sulfate proteoglycan inhibits migration and impedes outgrowth. ix Finally, to better assess stem cell integration into the central nervous system, we devised a novel slice-culture system that recreates the degeneration seen in Parkinson’s disease. Using this slice culture model, we showed that ES cell-derived neurons can survive in culture, and integrate synaptically. We also were able to dopaminize these ES derived neurons and show that they maintain their dopamine phenotype in the slice. To enhance transplant integration, we examined the effect of adding extracellular matrix to the cell transplant. Our results suggest that laminin enhances the integration of these cells into the slice. Our study examined the plasticity of adult and embryonic stem cells in culture and showed that these cells are responsive to environmental factors that interact with their differentiation and migration. Development of a slice culture model system that recreates the neuronal environment allows the development and future use of transplant enhancements for stem cell grafts into the brain. x CHAPTER 1 STEM CELL BIOLOGY Stem Cell Characterization To understand the potential of using stem cells, one must first understand what a stem cell is. A variety of definitions have been proposed, but a common set of terms and properties emerged that serves as a starting point. By focusing on embryonic stem cells and neural stem cells we compared and contrast the two most common “types” of stem cells: embryonic and adult stem cells. The minimal definition of a stem cell is a cell that can divide to renew itself and give rise to a more committed progenitor (Morrison et al., 1997). Some argued that self-renewal may be present in mature cell types (e.g., lymphocytes) and have pushed for a definition based on the plasticity of the stem cell (Zipori, 2005). Those against self-renewal as a stem cell trait argue that plasticity is the main defining characteristic separating stem cells from other types of cells. A stem cell functions to generate mature, committed cell types to create or repair tissues and organs. Embryonic stem cells (ES) in vivo contribute to all body tissues when implanted into a blastocyst (Bradley et al., 1984). In vitro ES cells have been shown to create almost all of the mature cell types found in the body (Keller, 1995; Draper and Andrews, 2002). Adult stem cells have been found in most adult tissues and organs. Functionally they are an integral part of normal operation of the system (e.g., the hematopoitic and nervous system) or they play a role in tissue repair and regeneration (e.g., the hepatic system). Evidence also shows that adult stem cells (whose in vivo distribution is limited to their target tissues) may in vitro be capable 1 2 of transdifferentiating into other types of mature adult cells. This potential is still controversial and may not exist in all adult stem cell types, but it further argues that stemness is a function of its plasticity, and not its renewal capability. While still under debate, self renewal and plasticity are likely both key components of a stem cell definition. More information about stem cell functions will refine their definition. Embryonic Stem Cells Embryonic stem cells (ES) are derived from the intracellular mass (ICM) of a developing blastocyst. This region of the blastocyst gives rise to all of the cell types found in the adult organism. ES cells were first derived from rodents and were shown to be pluripotent (Bradley et al., 1984). Human ES cells were generated later and were shown to have properties similar to those of rodent ES cells, while requiring a different set of culture conditions (Thomson et al., 1998). The primary focus for ES cells has been keeping them undifferentiated in long-term cultures, and in the exact protocols needed to differentiate ES cells into adult cell types in an easy and reliable manner. Mouse ES cells initially had to be grown on mouse fibroblast feeder layers to remain undifferentiated. Further studies identified leukemia inhibitory factor (LIF) as one of the primary molecules secreted by feeder-cell layers that maintained ES cells in their undifferentiated state (Smith et al., 1988). With the discovery of LIF as a mediator of differentiation, downstream transcriptional targets of LIF were identified that appear to regulate the pluripotency of ES cells. Transcription factors such as Nanog and Oct3/4 were found to be expressed in ES cells, and their expression decreased as cells differentiated into mature phenotypes (Niwa et al., 2000; Chambers et al., 2003) . Human ES cells (hES) have been shown to behave slightly differently from rodent ES cells. Human ES cells do not maintain a pluripotent state when treated with LIF, 3 though hES cells can be maintained on feeder layers, or on laminin-coated culture plates when fed with feeder-layer conditioned media (Thomson et al., 1998; Xu et al., 2001). The use of feeder layers was questioned because of the possibility of cross-contamination from animal cells. Recent evidence suggested the presence of a rodent glycopolysacarrhide in hES cultured on mouse feeder layers (Martin et al., 2005). This foreign molecule could induce an immune response to these cells that would likely kill them if transplanted. Research on feeder layer and conditioned media-free cultures shows promising results, suggesting that hES cells can be maintained in an environment that minimizes cross contamination. Differentiation of ES cells can be performed in a few ways. One way is to culture ES cells in an aggregate colony form, known as embryoid bodies (EBs) (Keller, 1995). The EBs can be maintained in culture for some time, and provide cell-cell interactions important for ES cell survival. The EBs can be plated to generate a monolayer of cells that can be treated with various cytokines and other factors to induce a specific lineage in the cells. For example, ES cells can be induced to a neuroectoderm lineage through a sequential EB culture protocol that adds (then removes) serum from the cultures, and allows the EBs to attach and generate a monolayer (Okabe et al. 1996). All three major neural cell types (neurons, astrocytes, and oligodendrocytes) can be produced from ES cell cultures, and in relatively pure populations. Further manipulations of neuronal cultures can yield subtypes of neurons, such as dopaminergic or GABAergic neurons. Dopaminergic neuron generation is being heavily studied as a possible way to replace the neurons lost in Parkinson’s disease. (Jung et al., 2004; Zeng et al., 2004; Takagi et al., 2005) provided a working paradigm for efficient generation of dopamine-producing 4 neurons, and provides a useful example of how ES cell manipulation is carried out. The initial protocol relied on treating ES cells with cytokines, such as sonic hedgehog and FGF8, that have been linked to endogenous dopamine cell generation during development. Adult Stem Cells Unlike ES cells, which are generated from the inner cell mass of a developing blastocyst, adult stem cells have been isolated from numerous adult tissue types, including brain, bone marrow, liver, and skin (Weiss et al., 1996). Like ES cells, adult stem cells are capable of asymmetric division, producing a relatively undifferentiated copy of themselves, and a more-committed daughter cell. Initial isolation and characterization of these adult stem cells showed them to be multipotent, capable of giving rise to only certain cell types of the tissue they were isolated from. Further studies introduced the idea that under certain conditions, these cells could transdifferentiate, or turn into mature cells from other tissue types (Brazelton et al., 2000; Theise et al., 2000; Ianus et al., 2003). These findings remain controversial, but evidence supports at least a limited potential for adult stem cell transdifferentiation. Because so many tissues appear to have adult stem cells associated with them, we have limitd the scope of this overview to discussing adult neural stem cells. Stem cells in the CNS have been hypothesized for more than 4 decades. Evidence of neurogenesis in rodent hippocampus was described by (Altman and Das, 1965, 1966; Altman, 1969a, b). They described postnatal neurogenesis and suggested that undifferentiated cells existed within the mature CNS; and that they gave rise to new neurons, and to new glial cells. The early 1990s began a push to isolate and expand the neural stem cell. A key discovery was the primary niches of adult neural stem cells 5 (NSCs): the subventricular zone (SVZ) of the lateral ventricles and the subgranular layer of the hippocampus. (Lois and Alvarez-Buylla, 1993; Kuhn et al., 1996). The SVZ stem cells generate new neuron progenitors that migrate along the rostral migratory stream to the olfactory bulb, where they integrate into the periglomerular and granule cell layers of the olfactory bulb in the rodent. When cells from these regions were cultured in clonal conditions with suitable growth factors, they gave rise to a sphere that contained both stem cells and lineage-restricted progenitor cells. Later studies of these cells from the SVZ, cultured as neurospheres, identified a multipotent astrocyte as the neural stem cell (Doetsch et al., 1999b; Laywell et al., 2000). In the SVZ a dynamic relationship exists between NSCs and more restricted progenitors. Early experiments on rodents found several different cell types in the SVZ (Doetsch et al., 1999a): the B cell, the multipotent astrocyte stem cell (NSC), the C cells (a rapidly dividing precursor cell), and the A cell (a restricted neuronal progenitor cell). Evidence for this model came from studies using cytosine arabinoside (Ara-C) to kill rapidly proliferating cells in the SVZ. Examining which cells were killed by Ara-C allowed the relative cell-cycle times of SVZ cell types to be established. The C cells showed the shortest cell-cycle time and were almost completely destroyed by Ara-C treatment. Type A cells also were almost completely eliminated by the treatment. Type B cells showed the least effect from Ara-C treatment. After only 2 days, regeneration of cell types had begun. After 4.5 days, A and C cells were almost at normal levels. In addition, giving a second treatment of Ara-C during this regenerative period killed a large number of the B cells, which had been activated and were dividing to try and reconstitute the SVZ, and led to no significant regeneration of the cell types in the SVZ. 6 This evidence of postnatal neurogenesis mediated through NSCs brought a great push to harness this innate potential to regenerate damaged regions in the brain. Currently there is no evidence that massive regeneration occurs in the CNS as a result of lesion or injury (Rakic, 1985). Some evidence suggests that endogenous stem cell populations contribute to repair in damaged regions such as the cortex (Magavi et al., 2000). However, this repair seems limited to small, specific lesions that do not create large glial scars, or large amounts of cell necrosis or apoptosis. Additional debate centers on whether neurogenesis occurs in regions outside the olfactory bulb and hippocampus. Reports of neurogenesis in the adult monkey (Gould et al., 1999) suggested that primates and possibly humans might generate new neurons in their cortex. However, evidence for this was challenged, based on confocal analysis that suggested cells appearing to be newly generated neurons were actually a neuron closely associated with a satellite glial cell (Kornack and Rakic, 2001) Adult Neural Stem Cell Differentiation By definition, the NSC must be able to generate the three distinct cell types of the central nervous system; neurons, astrocytes, and oligodendrocytes. Microglial cells, although restricted to the CNS, are believed to be developmentally derived from the hematopoietic system and do not constitute a neural lineage. On plating, NSCs have been observed to give rise to the three neural cell types. What remains poorly understood is the mechanisms of this differentiation and how static the process is. Recent evidence in the CNS suggested that cells exist along a continuum of differentiation, and that cell groups are much more fluid than previously proposed. This idea is supported by the life cycle of the NSC, which initially exists as a type of specialized astrocyte that (through cell division and differentiation) can give rise to neurons. Our results also suggest that 7 neuronal cells derived from these NSCs are in a state of phenotypic flux and may turn from neuronally committed to glial cells in vitro (Laywell, 2005). Stem Cell Niches and Extracellular Matrix An important concept in stem cell biology is that of the stem cell niche. Basically it suggests that the stem cell is able to perform its function, because of its environment, and the physical and biochemical cues from this niche influence cell division, differentiation, and migration. The niche first came to prominence in the hematopoietic stem cell (HSC) field, where the composition of bone marrow was found to play an active role in HSC function. Research on niches in regard to neural stem cells has focused on the extracellular matrix comprising the SVZ and RMS, and the cytokines and signaling molecules that target this region. The extracellular matrix (ECM) environment of the central nervous system (CNS) is responsible for a large number of regulatory functions both during development and adulthood. The ECM provides signals for cell growth, differentiation and migration (Novak and Kaye, 2000; Steindler, 1993; Steindler et al., 1990). These activities are critical for the development of CNS organization, and disruptions of ECM interactions can cause severe developmental defects (Novak and Kaye, 2000). During CNS histogenesis, ECM defines functional boundaries for cells (Steindler, 1993; Steindler et al., 1989) and is involved in signaling after injury (Laywell et al., 1992). Permissive substrates for neurosphere differentiation may underlie migratory pathways, whereas non-permissive substrates may mark more sedentary cell zones. In the SVZ stem cell niche the ECM, composed primarily of tenascin and chondroitin sulfate proteoglycans (CSPG), is believed to act as a barrier, keeping the NSC in the SVZ. This ECM composition is set up late in embryonic development and is persistent throughout the life of the animal. During early development the presence of the 8 dense ECM may allow the niche to remain undisturbed through development and prevent axons from innervating the region, and possibly degrading the ECM matrix (Gates 1993, 1995, Steindler 1993). CSPG’s are known to be present in other regions of the CNS and function in axon guidance by restricting axon growth to inappropriate targets (Treloar et al., 1996), and the CSPG versiscan, has been shown to inhibit migration of neural crest cells (Landolt et al., 1995). Treatment with enzymes that degrade these CSPG’s has been shown to be beneficial in axon regrowth in CNS injuries (Bradbury et al., 2002). In addition circuits where the region has been depleted of glial cells show an increased in the amount of axon regrowth they experience. This is believed to be the result of a decrease in scar formation and a decrease in glial elements that inhibit axon growth (Moon et al., 2000). In contrast, laminin and fibronectin are known to be potent permissive substrates for a variety of cell types in vitro, including cerebellar and SVZ derived neurospheres (Kearns, 2003). Neither fibronectin nor laminin are present in high levels in the adult animal; however, fibronectin knockout animals demonstrate neural tube abnormalities that are embryonic lethal (George, 1993). Laminin has been shown to be present in the developing cerebellum and acts as a permissive migratory substrate for granule cell precursors to migrate from the external granule cell layer into the internal granule cell layer (Pons et al., 2001). Laminin has been shown to enhance neurite elongation of cultured neurons (Rogers et al., 1983) and to increase the integration and regeneration of cells within injury sites (Grimpe et al., 2002). Slice co-culture transplants with laminin have been reported to enhance the ability of fetal dopaminergic neurons to reconstruct a damaged nigrostriatal circuit in adult rats (Dunnett et al., 1989). CHAPTER 2 PARKINSON’S DISEASE Overview and Anatomy Parkinson’s disease (PD) has classically been defined as a progressive neurodegeneration of the nigrostriatal circuit. Clinically this presents as a whole body tremor, rigid posture, racheting motion of the limbs, dysphagia, and in late stage cases a loss of voluntary motor control and movement . The demographics for PD are heavily skewed towards the elderly, except in specific familial cases where the gene mutations can cause a significant decrease in the age of onset. The disease was first reported in the medical literature by James Parkinson in 1817, and described as the shaking palsy (Parkinson, 1817). Later the clinical anatomy and lesion were discovered that underlie the disease. Rosegay was the first to conclusively label and demonstrate a circuit that originated in the substantia nigra and terminated in the striatum using a feline model (Rosegay, 1944). Anden et al were the first to demonstrate that dopamine was the primary neurotransmitter released into the striatum from the axons of neurons in the SNc (Anden et al., 1964; Anden et al., 1965; Anden et al., 1966). The loss of SNc cells, the only observable lesion seen in Parkinson’s patients, led them to correctly hypothesize that the symptoms of Parkinson’s were a direct result of the loss of dopamine neurotransmission from the SNc to the striatum. Pathologically, PD is associated with the significant loss of the SNc fibers running to the striatum, and the atrophy of the cells bodies within the SNc. Another notable pathology is 9 10 the formation of intracellular protein aggregates seen within SNc cell bodies, termed Lewy bodies. These cytoplamsic inclusions are seen in several different neurological conditions, but when closely associated with the SNc are hallmarks of PD (Gibb and Lees, 1988). The nigrostriatal circuit is an important component of the voluntary motor pathway in the central nervous system. Information from the motor cortex is sent to the striatum. From the striatum it is sent to the globus pallidus then to the thalamus where it is processed and from the thalamus goes to the motor cortex to be sent through the corticospinal tract. The overall output from the SNc to the striatum is inhibitory. The more inhibited the SNc causes the striatum to become, the less inhibitory and more excitatory the globus pallidus becomes. This feedback loop of inhibitory and excitatory circuitry allows for voluntary motor movements to proceed smoothly (Blandini et al., 2000). In the case of Parkinson’s disease the degeneration of the SNC causes a loss of inhibitory output to the striatum. This loss of inhibition causes the striatum to send a stronger inhibitory signal to the external globus pallidus (eGP). The inhibition of the eGP causes the subthalamic nucleus (STN) to send a stronger excitatory signal to the internal globus pallidus (iGP). The iGP normally sends an inhibitory signal to the thalamus. In Parkinson’s this inhibitory signal is much stronger, due to the increased excitatory signal from the STN, and the motor pathways in the thalamus are thus inhibited, resulting in the difficulty initiating voluntary motor movement (Albin et al., 1995). The underlying molecular causes of PD are still being debated. What is established is that there are both environmental and genetic risk factors that are associated with the development of PD. Rare familial forms of PD have been studied that 11 have allowed scientists to better understand what mutations and biochemical effects may be linked to PD. Epidemiological data has also been collected that points to environmental toxins, such as pesticides and heavy metals, that appear to increase the chances of developing PD. Genetic Links To Parkinson’s Disease A variety of genetic studies have been performed to ascertain genes that play a role in causing or predisposing an individual to PD. Three of the most prevalent mutations are alpha-synuclein, Parkin, and PINK1 (Gasser, 2005). Each of these genes has been found to be abnormal in a large number of familial PD patients, or those with a clearly defined genetic linkage to the disease. All of these mutations share a common link in the ubiquitin-proteosome pathway. This pathway is involved in the targeting and degrading misfolded or damaged proteins within the cell and is a critical part of the intracellular machinery. Dysfunctions in the proteosome pathway are believed to induce a state of oxidative stress within the cell and lead to abnormal protein aggregation, like the Lewy bodies seen in PD. The role of these aggregates is unclear, some believe them to be a defense mechanism that the cell uses to isolate abnormal proteins, but many others believe that the aggregates themselves cause an increase in free radicals that can overload the cell with oxidative stress and induce programmed cell death or apoptosis. Alpha-Synuclein Mutations Alpha-synuclein is perhaps the best studied mutation in PD. It was first identified as the root cause of familial PD in a kindred in Italy, and has since believed to be isolated to a founder mutation that originated in Greece (Polymeropoulos et al., 1997). Patients with this mutation display many of the same characteristics as those suffering from sporadic PD, including the formation of Lewy bodies in the SNc, and responsiveness to levodopa. 12 The key feature that separates this familial form from sporadic is the early age of onset which is around 46 years, compared to the average age of onset for sporadic which is around 62 years (Pankratz and Foroud, 2004). At the molecular level alpha-synuclein is believed to act as a lipid binding protein that plays a role in neurotransmitter vesicle release and recycling, as well as synaptic plasticity. In familial forms of PD linked to alpha-synuclein mutations, the mutated protein folds abnormally and generates Lewy bodies, the protein aggregates seen in PD. Several different mutations have been identified in the alpha-synuclein gene, most of which are point mutations that alter a single amino acid in the protein and cause protein misfolding. Recent reports of duplication and triplication of the wild type alpha-synuclein gene have linked these mutations to the development of PD (Singleton et al., 2003). This is an important finding, since it reinforces the data showing that Lewy bodies in sporadic PD are composed mostly of aggregated alpha-synuclein. Here we see the intersection of environmental and genetic factors that may play a role in the development of PD. If wild type alpha-synuclein is more susceptible than other proteins to environmental agents that cause protein misfolding, then it represents a common target for therapeutics against protein misfolding related degenerative diseases. Recent studies looked at alpha-synuclein polymorphisms that may underlie sporadic PD (Pals et al., 2004). Unlike familial cases there is no clear genetic link or clearly identified protein abnormality in sporadic cases. However some reports have suggested that polymorphisms in the alpha-synuclein gene may predispose individuals to develop PD. One recent study reported that there was a specific haplotype in the alpha-synuclein gene that appeared to increase the risk of developing PD 1.4 times in heterozygotes, and twice as likely in 13 homozygotes (Mueller et al., 2005). The mechanism underlying this predisposition is still not understood, but further study on polymorphisms in PD related genes is one of the most important areas in PD research. Parkin Mutations A common theme in the genetics of PD is the relationship the genes have with the misfolded protein response and the proteosome pathway. Alpha-synuclein appears to interfere with the proteosome pathway by overloading it with too much aggregated mutant protein. Another proteosome pathway protein, parkin appears to be the most frequently mutated protein in familial PD with some estimates suggesting it may be the cause of 50% of early onset familial PD (Lucking et al., 2000). Parkin is a ubiquitin ligase, responsible for attaching ubitquitin molecules to proteins to target them for degradations (Zhang et al., 2000). The exact molecular mechanism by which parkin mutations may cause degeneration is unknown, but current research suggests that mutations in parkin decrease its ability to targets proteins for degradation. Without this targeting the cellular machinery is unable to degrade proteins and they can accumulate and form aggregates. One of the primary proteins targeted by parkin for degradation is alpha-synuclein (Shimura et al., 2001). What is unusual about most cases of familial PD associated with parkin mutations is the relative lack of Lewy body inclusions. This led some to suggest that parkin mutations act through an alternate pathway to induce SNc degeneration without Lewy body formation. Recent studies have implicated the JNK mediated apoptsis pathway. Under this paradigm, mutations in parkin cause an increase it parkin substrates, which could induce cellular stress and activate the JNK pathway. In addition the activation and control of JNK effects may be directly regulated by 14 ubiquititination through parkin, and the loss of parkin could cause upregulate the apoptotic effects of JNK (Cha et al., 2005). PTEN Induced Kinase-1 Mutations PTEN induced kinase-1 (PINK1) is a relatively new genetic mutation identified in early onset familial PD. While it only accounts for 1-2% of the early onset cases, PINK1 is being studied intently due to its biochemical functions. (Valente et al., 2004). Analysis of the PINK1 gene product has revealed a mitchocondrial protein that appears to function in oxidative stress response. A recent report found that PINK1 appears to mediate cytochtome c release from the mitochondria, which is an important apoptotic signal (Petit et al., 2005). When cells were transfected with a mutant from of PARK1, which destroys the kinase activity of the protein and is known to exist in PD patients, they noted a significant increase in basal and induced levels of apoptosis in the mutant cells compared to controls. This is another finding that links the development of PD to alternations in the cells ability to deal with oxidative stress. The fact that PINK1 is localized to the mitochondria has implications for certain environmental toxins related to PD. Many of the chemicals that are experimentally used to make PD models act by interfering with mitochondrial function and induction of oxidative stress and apoptosis (Ungerstedt, 1968; Jenner, 2003; Kress and Reynolds, 2005). While there are no reports on polymorphisms associated with PINK1, a reduction in the capacity to deal with mitochondrial insults from an environmental exposure could be a factor in developing PD. Environmental Links To Parkinson’s Disease Rural Living Conditions Since most PD cases are late onset, sporadic instances, it is clear that genetics does not dictate the entire risk potential of developing PD. With the advent of 15 epidemiological studies of PD patients it has become clear that there are environmental risk factors that exist which increase the chances of developing PD (Lai et al., 2002). In addition the development of animal models of PD, based on toxins has opened up new avenues, not only in studying how to treat the disease, but how environmental stresses can lead to neurodegeneration. The majority of the studies in the past 50 years have looked at a small set of epidemiological factors that may play a role in PD. Living location, especially rural or urban, has become a widely studied variable as a risk factor for PD. An analysis of studies done on rural living showed that 7 out of 20 showed a significant positive correlation between living in rural areas and an increased risk of developing PD. The rest found either no correlation, or an insignificant one. While far from definitive proof, at least some evidence exists that rural living may increase the chance of developing PD (Lai et al., 2002). Pesticides and Parkinson’s Disease One of the primary reasons that rural living was suspected as playing a role in the development of PD, was the discovery that exposure to pesticides has been shown increase the risk of PD. A meta-analysis of 19 pesticide exposure studies concluded that there was a significant positive association between pesticide exposure and risk of PD (Priyadarshi et al., 2000). This has been further reinforced by experimental studies that have linked the pesticide rotenone to dopamine neuron toxicity. Rotenone is a known mitochondrial complex I inhibitor that induces apoptosis, and it has been showed that chronic rotenone exposure in rodents caused a selective degeneration in dopamine neurons and induced formation of intracellular inclusions similar to Lewy bodies (Greenamyre et al., 2003; Betarbet et al., 2005). One likely scenario is that rural living 16 typically involves drinking water from a well. Pesticides leaching into the soil and into the well water presents a likely delivery mechanism for human exposure to pesticides. Heavy Metal Exposure and Parkinson’s Disease Another positive, although contested, association exists between heavy metal exposure and PD. One study found a positive correlation between workers that had 20 or more year’s exposure to copper or manganese and development of PD (Gorell et al., 1997). However another study, using the same group as above, found that this increase was broken down among those with a family history of PD and those without (Rybicki et al., 1999). Another study found that 30 or more years exposure to lead, aluminum, and manganese increased the incidence of PD, independent of family history (Lai et al., 2002). Iron exposure has become an important research direction in PD due to a better understanding of the type of free radical damage prevalent in the SNc. Dopamine is a relatively unstable molecule that breaks down, generating free radicals. In addition the substance that gives the SNc its distinctive black hue, neuromelanin, is high in iron content (Youdim et al., 1989; Linert et al., 1996; Hirsch and Faucheux, 1998; Castellani et al., 2000; Gerlach et al., 2003). Iron has been shown to catalyze what is known as the Fenton reaction, which generates hydroxyl radicals. These radicals have been shown to induce DNA damage and to induce apoptosis in exposed cells. There is mounting evidence that the increased iron in the SNc may lead to an increase in Fenton derived free radicals that could be responsible for the neurodegeneration pattern seen in PD. Some of the other metals suspected, have also been linked to free radical generation or a reduction in the ability to scavenge them. This evidence, while not conclusive, does suggest that heavy metal exposure may at the least increase the oxidative stress that the SNc is under. 17 Modeling Parkinson’s Disease Currently most PD research is performed in isolated cell-culture models or in animal models, using either toxic lesions or genetic mutant animals. Isolated cell cultures allow for an easily controlled environment where variables such as toxin exposure or mutated proteins can be observed and easily manipulated. The development of SNc cultures allowed the work being done in cell cultures to help define and profile the at-risk cell populations. Isolated cell cultures are also often the first step in examining whether a chemical or genetic lesion is effective in causing cell death in SNc cells, and examining the effectiveness of therapies in preventing cellular degeneration. Unfortunately isolated cell cultures do a poor job of recreating the actual physiological environment that the cells would normally be found in. Animal models of PD focused on rodent and primate models that mimic the degeneration seen in human PD cases. Most of the work is performed on rodents using toxin models that induce degeneration in the nigrostriatal circuit (Gerlach and Riederer, 1996). Compounds such as 6-hydroxy dopamine (6-OHDA) and MPTP specifically target the nigrostriatal circuit and destroy the cells (Ungerstedt, 1968; Heikkila and Sonsalla, 1992; Glinka et al., 1997; Smeyne and Jackson-Lewis, 2005). Unfortunately these models do not recreate the progressive nature of PD and lack some of the pathological hallmarks of PD, such as lewy bodies. A new method using general proteosome inhibitors, such as lactacyctin, have shown promise in animal models of causing a progressive loss of nigrostriatal neurons with evidence of lewy bodies in cells (McNaught et al., 2002). Slice culture models, like that presented here, allow for a bridge between in vivo and in vitro technologies. The ability to generate mid sagittal slices that contain the nigrostriatal circuit has allowed for modeling of Parkinson’s using the endogenous at risk 18 population of neurons within their neuronal environment, but with the accessibility ability to observe and manipulate of in vitro cultures (Kearns, 2006). Current Therapies for Parkinson’s Disease Pharmacological Therapies The current state of PD treatments lies in either pharmacological intervention, typically in early stage PD, and later in a variety of neurosurgical treatments. Neither of the current therapies serves to slow or reverse the cellular degeneration, but instead rely on enhancing the existing dopaminergic signal to compensate or removing inhibitory influences on the circuit to enhance the message. Pharmacological treatment is led by Ldopa administration. L-dopa is a precursor to dopamine that is able to cross the blood brain barrier and can be converted using aromatic acid decarboxylase into dopamine (Joseph et al., 1978; Olanow et al., 2004). This is a dramatic treatment, since it instantly increases the amount of dopamine present in the nigrostiatal circuit and can initially reverse most of the motor deficits seen in PD. However L-dopa has a serious problem in its long term usage. Patients become non-responsive to L-dopa, usually within 5-10 years, and during an OFF phase with L-dopa, the symptoms can return, and even when the drug is working during an ON phase, their can be abnormal hyperactive motor movements and muscle tension (Deane et al., 2004; Brotchie et al., 2005). L-dopa is still considered a first use drug, but the search for other more effective pharmacological options is proceeding. Several other classes of drugs that have been suggested or tried, include dopamine reuptake blockers, to keep dopamine in the synapse longer and enhance its ability to signal, and drugs that prevent the enzymatic breakdown of dopamine to keep it active longer (Johnston and Brotchie, 2004). These drugs have had 19 therapeutically relevant effects, but due to the progressive nature of PD, their efficiency decreases with the increase in cellular degeneration. Surgical Therapies Surgical intervention for PD preceeded the development of pharmacological intervention strategies by several decades. Until L-dopa was used, the standard treatment for those willing to undertake it was a surgical lesion of the globus pallidus (Ansari et al., 2002; Valldeoriola et al., 2002; Walter and Vitek, 2004). As outlined previously, the globus pallidus sends an inhibitory output to the striatum, as part of the feedback mechanism of the basal ganglia. A lesion of the globus pallidus removes this inhibitory output, and effectively enhances the excitatory signal from the SNc to the striatum. More recently, surgical interventions have begun to use deep brain stimulators in an attempt to block inhibitory outputs to the striatum in an effort to enhance the SNc excitation to the striatum (Lozano and Eltahawy, 2004; Diamond and Jankovic, 2005; Lyons and Pahwa, 2005). Deep brain stimulation’s precise mechanism of action is not clearly understood, but it is believed that the electrical impulses either induce a depolarizing block on the cells, preventing them from firing, or the electrical impulses may desynchronize electrical oscillations present in basal ganglia loops. Abnormal oscillations in firing patterns have been theorized to underlie the abnormal motor movements in the PD, and may also be present during ON medication phases, explaining side effects such as dyskinesia (Silberstein et al., 2005). Cell Replacement Therapies A recent addition to the therapeutic options for PD, has been cell replacement therapy. This approach seeks to replace, using stem cells or fetal progenitors, the lost dopaminergic SNc neurons. Initial experiments performed in the late 1980’s showed 20 proof of principle for cell replacement strategies and had promising results. Many of the first open label trials showed evidence of significant improvement with patients reporting decreased need for L-dopa treatment, and an increased level of dopamine uptake in the putamen (Hauser et al., 1999). Further double blind studies were better able to quantify graft effects and found that the age of the PD patient was a significant factor in the level of improvement the patient experienced (Freed et al., 2001). Another factor in the variable outcome is the variable number of surviving graft neurons. Recent reports have contested the negative analysis of transplants, arguing that the effect seen is positive and beneficial, considering that the trend in behavioral testing scores showed steady improvement. In addition the beneficial effects observed were due to the few cells that survived transplant. As transplantation techniques improve and cell survival increases then clinical improvements should also increase (Isacson et al., 2001). There has been significant debate about the development of post-operative dyskinesias. These abnormal motor movements have been reported in various frequencies in graft patients ranging from 15% (Freed et al., 1992) to 56.5% (Olanow et al., 2003). The underlying mechanism for the development of these dyskinesias remains elusive, but one interesting hypothesis is that the type of neurons being placed into the brain is not the appropriate cell type. A9 type neurons are specific to the SNc region and among their distinguishing features is the expression of the dopamine reuptake transporter D2. This autoreceptor helps modulate dopamine release from these cells and is thought to underlie the strength and modulation of the signal from the SNc to the striatum. A10 type cells lack this autoreceptor and in transplant grafts, a mixture of the two cell types is used. With a portion of the cells releasing dopamine in a non modulated fashion, the signaling 21 pattern may be disrupted leading to the development of dyskinesias (Isacson et al., 2003). As further refinements of cell differentiation and selection occur the ability to transplant cells without these side effects should improve. CHAPTER 3 MATERIALS AND METHODS Neurosphere Culture and Asteron Cell Characterization Generation of Neurospheres Postnatal day 1-10 (P1-P10) C57BL/6 mice (The Jackson Laboratory, USA) deeply anesthetized by hypothermia and decapitated. The SEZ and cerebellar cortex were removed, and dissociated into a single-cell suspension as previously described (Laywell et al., 2002). Cells were then plated into standard T25 tissue culture flasks in growth medium consisting of DMEM/F12 containing N2 supplements, 5% fetal bovine serum (FBS; Atlanta Biologicals, USA), 20ng/mL epidermal growth factor (EGF; Sigma, St. Louis), and 10ng/mL basic fibroblast growth factor (bFGF; Sigma). After 1-2 days, floating cells were collected, centrifuged, trypsinized, triturated into a single-cell suspension, and counted. A secondary culture was initiated by resuspending cells in growth medium (with or without BrdU), and plating them into ultra low attachment polystyrene 6-well plates (Corning, USA) at densities ranging from 1x103 to 1x105 cells/cm2. Neurospheres became apparent within 3-5 days. Differentiation and Immunolabeling of Spheres To promote differentiation, spheres were placed into a drop of differentiation medium (DMEM/F12 + N2 supplements + 5% FBS, with or without on coverglass coated sequentially with polyornithine and laminin (10µg/mL and 5µg/mL, respectively; Sigma, USA). Some neurospheres were plated in the presence of 10µM bromodeoxyuridine (BrdU; Sigma, USA) in order to label proliferating cells. Eighteen 22 23 hours to 4 weeks after plating, coverslips were fixed with 4% paraformaldehyde in PBS, and processed for immunofluorescence as described (Laywell et al., 2000) with a variety of antibodies, including monoclonal (Promega, USA) and polyclonal (Covance, Richmond, CA) antibodies against the neuronal cytoskeletal protein β-III tubulin, monoclonal and polyclonal antibodies against the astrocyte intermediate glial fibrillary acidic protein (GFAP), (Immunon, USA), a monoclonal antibody against the neuronal nuclear protein NeuN (Chemicon, USA), polyclonal antibodies against the astrocyteassociated calcium binding protein S100β (Swant, Switzerland). For detection of BrdU, cells were first incubated in 1:1 formamide:2x SSC for 2 hr. at 65o, and 2N HCl for 30 min. at 37o. After equilibrating for 10 min. in borate buffer, cells were immunolabeled with a monoclonal rat antibody against the thymidine analog BrdU (Abcam, USA) in combination with anti-GFAP and anti- β-III tubulin antibodies. After washing and applying appropriate fluorescent secondary antibodies (Molecular Probes, USA), the cells were counterstained with Hoechst 33342 fluorescent nuclear stain (Sigma, USA), coverslipped, and viewed with epifluorescence or confocal microscopy. Images were captured on a Spot camera and Spot software and Adobe Photoshop were used to adjust contrast and brightness to more closely resemble images seen under the microscope. In Situ Hybridization with GFAP cDNA GFAP cDNA probes were generated by RT-PCR amplification of a 401bp DNA fragment from neonatal mouse brain tissue with a pair of primers designed with the Primer 3 program (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi), using the GFAP sequence from the Genebank database (gi: 26080421). Forward primer: GCCACCAGTAACATGCAAGA; Reverse primer: ATGGTGATGCGGTTTTCTTC. The PCR product was cloned into the PCR4 TOPO vector (Invitrogen, USA). After 24 linearization, plasmids extracted from clones of both directions were used as templates to synthesize digoxigenin (DIG)-labeled GFAP sense and antisense probes using the T7 RNA polymerase (1277073 Roche, USA). The hybridization protocol followed the method of Braissant and Wahli (Braissant and Wahli, 1998), with a probe concentration of 400ng/ml, and the hybridization temperature set at 45ºC. Hybridized probe was immunodetected with a monoclonal antibody against DIG (Roche, USA) using alkaline phosphatase as the chromagen. Finally, hybridized cells were processed for immunolabeling with antibodies against GFAP and β-III tubulin, as described above. Analysis of Cell Death Apoptotic cells within plated spheres were visualized using a fluorometric terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) assay (G3250 USA) according to the manufacturer’s recommendations. This assay measures the fragmented DNA of apoptotic cells by incorporating fluorosceinlabeled dUTP at the 3’ ends of DNA strands. As a positive control, some spheres were processed for TUNEL following 30 min. incubation with DNase. Alternatively, activated caspase 3, an enzyme present in early stages of apoptosis, was detected in plated spheres using an anti-activated caspase 3 antibody (BD Pharmingen, USA). As a positive control, some spheres were treated with staurosporine (1µg/ml for 4 hours at 37oC) prior to immunolabeling. Following TUNEL processing or caspase 3 labeling, spheres were immunolabeled as above with antibodies against β-III tubulin, and counterstained with Hoechst 33342 (Sigma, USA). 25 Cell death was quantified by counting the number of TUNEL+ or caspase 3+ nuclei within every sphere on each of three coverslips (range = 12-15 spheres/coverslip). The criterion for apoptotic neurons was intentionally liberal to avoid undercounting. All TUNEL+ or caspase 3+ cells contacting a β-III tubulin+ process were counted as apoptotic neurons. Electrophysiology Spheres plated for 48 to 96 hours were used to assess membrane properties of asterons. Coverslips were placed in a recording chamber perfused with artificial cerebrospinal fluid (ACSF) containing (in mM) 124 NaCl, 26 NaHCO2, 1.25 NaH2PO4, 2.5 KCl, 2 CaCl2, 1 MgCl2, 20 D-glucose, oxygenated with 95% O2 and 5% CO2, giving a pH of 7.4. All recordings were performed at room temperature (22°C). Putative neurons, astrocytes, and asterons were visually identified using infrared DIC videomicroscopy with a fixed-stage microscope equipped with a 40X, 0.8 W waterimmersion lens (Zeiss, Germany), and whole-cell patch-clamp recordings were performed. Patch electrodes had a resistance of 6-8 MΩ when filled with intracellular solution containing (in mM): 120 K-gluconate, 8 NaCl, 10 HEPES, 4 Mg ATP, 0.3 Na3GTP, 0.2 EGTA, 0.1% biocytin (pH 7.3 with KOH, osmolarity 290-300 mOsm). Cells were recorded under either current-clamp or voltage-clamp mode using an Axopatch 1D amplifier (Axon Instruments, USA). Series resistance was 10-25 MΩ and cells were rejected if resistance changed more than 10% throughout the recording session. Action potentials were observed in current-clamp mode by injecting a number of current steps (from -50 pA to 150 pA, in 50pA increments). Na+ and K+ currents were studied in voltage-clamp mode. Cells were held at -65 mV, and steps of voltage were 26 imposed (from -80mV to 55mV, with 15 mV increments). Maximum Na+ current usually occurred when cells were held at -5 mV or 10 mV. The magnitude of K+ current was measured at the steady part of the trace of the last step (55mV). Action potentials and Nacurrents were abolished by adding 1µM TTX (Sigma, USA). Recorded cells were filled with biocytin, and visualized by application of an avidin-AMCA conjugate (Vector, USA). Cell phenotypes were confirmed by immunolabeling the biocytin-filled cells with antibodies against GFAP and β-III tubulin, as above ECM Effects on Neurosphere Migration Cells were isolated from postnatal days 3 to 5 C57BL/6 mice pups. Neurospheres were prepared as described above. The matrices tested were laminin, fibronectin, and CSPG. Glass coverslips were incubated for 24 h with poly-L-ornithine, followed by 8 h incubation with laminin (L-2020, Sigma, USA), fibronectin (F-4759, Sigma, USA), or CSPG (C-9819, Sigma, USA). Spheres were seeded onto each coverslip in N2 media containing 5% FBS and 10 ug/ml of EGF and FGF-2. At 24, 48, 72, and 144 h coverslips from each condition were removed and fixed with ethanol/acetic acid for 30 min. Immunohistochemistry for the neuron-specific protein B-III tubulin (Covance, USA) and the astrocyte specific intermediate filament protein glial fibrillary acidic protein (GFAP) (Immunon, USA) was performed to assess cell differentiation. Hoechst nuclear staining was performed to visualize cell migration outward from the neurosphere. Measurements were performed with a Leica compound fluorescence microscope and SPOT software (Diagnostic Instruments Inc., USA). Migration distance was calculated as a straight line measurement from the edge of the sphere to the farthest 27 defined edge of the migratory cell boundary. Velocity data were defined as total distance migrated over time. Measurements were analyzed using the Student’s t test. Slice Culture Preparation Slice cultures were generated from postnatal day 7 to 15 (n=10), with a total of 48 slices cultured for this study. See Figure 3-1 for the preparation outline. Briefly, animals were euthanized under halothane, and their brains were cut at the midline into two sagittal halves. These halves were then superglued, medial surface down to the vibratome stage, covered in cool, molten 2% agar, and immersed in cold preparation media (DMEM F12, 100 ug/mL L-ascorbic acid, 2 mM L-glutamate, and antibiotic/antimycotic (Invitrogen, USA)). 300-400 uM thick slices were cut using a vibratome (Leica S1000, Germany), transferred to a Petri dish with cold preparation media, and scanned using a dissection microscope (4X magnification) to select slices. Typically 4-6 mid-sagittal slices per animal from the levels 0.8-2.0 mM lateral from midline were obtained (Franklin, 1996). Slices were then immediately transferred to a transwell membrane inset (#3650, Falcon,USA), placed in a 6 well plate, and incubated at humidified 35 degrees C and 5% CO2. Each inset was suspended in 1 mL of “A” media, containing 25 % horse serum (Kluge et al., 1998). “A” media was sequentially replaced by thirds with a serum free DMEM F12 based “B” media, containing B27, and N2 supplements (Invitrogen, USA) until day 7 when cultures contained only “B” media (Benninger et al., 2003; Scheffler et al., 2003). 6-Hydroxy Dopamine Nigrostriatal Lesions For nigrostriatal lesion studies the dopaminergic neurotoxin 6-OHDA (Sigma, USA) was used. 6-OHDA was applied either prior to slices being placed on the 28 membrane, submerged in 20 mM 6-OHDA/saline for 10 min, or 7 days after plating. For 7 day old cultures, all media was replaced with sterile saline and the slices submerged in 20 mM 6OH-DA/saline with 25% mannitol, for 10 minutes. Mannitol was used to disrupt the glial scar and enhance 6-OHDA penetration into the slice. After treatment all saline and 6-OHDA were aspirated and replaced with “B” media. Embryonic Stem Cell Neural Precursor Transplants ESNP’s were derived from GFP expressing R1 ES cells (Hadjantonakis et al., 1998) and cultured as described by Okabe et al (Okabe et al., 1996). TH expression was induced in cells using bFGF (10 ng/ml), FGF8 (100 ng/ml), SHH (500 ng/ml), PTN (100 ng/ml) (Sigma, USA) which were added to the culture media every day. 50-100,000 cells were transplanted using a 5 uL Hamilton syringe to deliver 2 uL to the region around the substantia nigra or directly onto the striatum. For co- transplants with laminin, 50 ug of laminin was added to a mixture of cells, 2% methylcellulose, and B media for transplant. Immunocytochemistry and Quantification For morphological and phenotype analysis, slices were slices were fixed with 4% paraformaldehyde for at least 24 h at 4○ C. Sections were then either processed as whole mounts or embedded in paraffin and sections cut at 10 um. Immunocytochemistry for tyrosine hydroxylase (1:1000, polyclonal, Chemicon, USA), GFP (1:1000, Sigma, USA), Nissl (NeuroTrace, Molecular Probes, USA) and DAPI (Vector, USA) was performed on these sections to assay slice viability as well as ESNP survival and integration. Sections were mounted on slides and incubated in primary antibody overnight at 4○ C. Labeling with fluorescent secondary antibodies (Molecular Probes, USA) was performed at room temperature for one hour. DiI labeling 29 was performed using a DiI paste (Molecular probes, USA) applied using a 16 gauge needle tip. Paste was applied to the striatum of slices after one week in culture. Cell counts were performed on 10 uM sections. Serial sections, at least 40 uM apart were analyzed. TH+ and Nissl/DAPI+ cells in the SNc were counted, and the counts averaged across conditions. For striatal density, digital photos were taken of the striatum under the same shutter and gain settings. Image J (NIH, USA) was used to calculate the mean grey value of a random region of the striatum. All measurements were individually normalized to the grey value of adjacent cortex to account for staining variations. All counts and intensity data was analyzed using GraphPad Prism (Graphpad.com, USA). Electrophysiology of Slice Culture Transplants Culture media was removed and slices were placed into a holding chamber continuously perfused with oxygenated artificial cerebrospinal fluid (aCSF) containing, in mM: 125 NaCl, 3 KCl, 26 NaHCO3, 1.25 NaH2PO4, 20 glucose, 1 MgCl2, and 2 CaCl2 and maintained at 35° C during experiments. Intracellular pipette solution comprised of, in mM: 145 K-gluconate, 10 HEPES, 10 EGTA, and 5 MgATP (pH 7.2, osmolarity 290). For experiments in which post-synaptic currents were recorded, 145 K-gluconate was replaced with 125 KCl and 20 K-gluconate. Recordings were performed with an Axopatch-1D (Axon Instruments, USA) and filtered at 5 kHz. Clampex 8.2 (Axon Instruments, USA) was used to deliver command potentials and for data collection. Series resistances were < 20 MΩ and checked frequently to ensure that they did not deviate. During current-clamp experiments a step protocol was utilized in which currents 30 between 10-100 pA were applied per step. Clampfit 8.2 (Axon Instruments, USA) was used to analyze voltage and current traces. Figure 3-1. Slice Culture Protocol Schematic. Slice cultures are generated from postnatal mice brains. A) After the brain is removed, the cerebellum is removed and the hemispheres are separated. B) Hemispheres are then superglued to a vibratome stage and covered in molten agar to support the tissue during sectioning. After sectioning, slices are selected from the appropriate level for culture. C) Sections for 6-OHDA treatment are bathed in a 20 mM solution for 10 min prior to plating and the media is changed on the samples as indicated in the timeline. CHAPTER 4 RESULTS Neural Stem Cell Differentiation and the Asteron Phenotype Shortly after the initiation of sphere differentiation by plating onto adhesive substrata, combined β-III tubulin/GFAP immunolabeling reveals distinct neuron/astrocyte mixtures (Fig. 4-1A, B), in which no individual cells are seen coexpressing these markers. During the first day post-plating, “immature” neurons are apparent as small, rounded cells with relatively short processes (Fig. 4-1). Over the next 1-2 days, the neuronal phenotype begins to “mature” as they start to show a more fibroblastic soma in combination with longer, branching processes (Fig. 4-1B). Shortly after this stage, exclusively β-III tubulin+ neurons can be seen combining fine neuronal-like processes with wide, flattened cell bodies characteristic of astrocytes (Fig. 4-1C). By 5-6 days post-plating, there are few cells left that exclusively express β-III tubulin, while the number of co-expressing asterons reaches its maximum level (Fig. 4-1D). Asterons continue to display flatter, more stellate morphologies (Fig. 4-1E), and in the second post-plating week show a wide, flat, “fibroblastic” morphology typical of cultured astrocytes (Fig. 4-1F). During this transition period of neuronal decline and asteron increase, cells with all three phenotypes (neuron, astrocyte, and asteron) can often be seen in a single, high magnification field of view (Fig. 4-2A), arguing against the interpretation that the asteron phenotype results simply from antibody cross-reactivity. Likewise, confocal microscopy of individual asterons reveals that antibodies for neuronal and glial 31 32 markers are co-localized within the same cell, and it appears that these markers label separate populations of subcellular elements within the same cell (Fig. 4-2B-D), suggesting that the asteron phenotype is not the result of antibody cross-reactivity or epifluorescence bleed-through. Combinations of monoclonal anti-β-III tubulin + polyclonal anti-GFAP, and polyclonal anti-β-III tubulin + monoclonal anti-GFAP co-label hybrid asteron cells equivalently. Combination of Asteron Markers In addition to β-III tubulin and GFAP, asterons also co-label with a combination of monoclonal anti-β-III tubulin and polyclonal anti-S100β. Again, some but not all β-III tubulin+ cells are also immunopositive for S100β (Fig. 4-3A & insets). Likewise, asterons are immunolabeled with antibodies against GFAP and the neuronal protein, MAP2 (data not shown). However, when we combine polyclonal anti-GFAP with monoclonal anti-NeuN, a protein thought to be restricted to fully mature neurons, we never observe cells expressing both markers (25 spheres examined), even though it is clear from positive controls that both antibodies are present at optimal concentrations for immunolabeling (data not shown). Finally, combining GFAP cDNA in situ hybridization with β-III tubulin and GFAP immunolabeling shows that cells transcribing astrocyte-associated mRNA are immunopositive for both glia- and neuron-associated cytoskeletal proteins (Fig 4-3B, C). Analysis of Cell Death Neurons (i.e. cells exclusively expressing neuronal phenotype markers) become apparent immediately after spheres attach to substrate and begin differentiation, then decrease in number until, after approximately two weeks, they are no longer detectable. 33 The observed decrease in neuron number is paralleled by an increase in asteron cells coexpressing neuronal and glial phenotype markers, and it is this inverse relationship that originally led us to hypothesize that neurons in these cultures undergo a phenotypic transformation into hybrid neuron/astrocytic cells. A partial alternative to this hypothesis, though, is that the reduction in neuronal cells is due simply to cell death. In order to determine if cell death plays a significant role in neuronal reduction, we used two methods to analyze apoptosis in cerebellar-derived spheres: TUNEL and caspase 3 immunolabeling. We focused our apoptosis analysis on the six days immediately after sphere plating, since this time window corresponds to the vast majority of neuron/asteron inversion. At all time points assessed only a small number of sphere-derived cells are TUNEL+ (Fig.4-4B, compare to +control in 4A). Quantification of sphere composition (including both the penumbral and the central sphere mass) with respect to neurons, astrocytes, and TUNEL+ cells (Fig. 4C) shows that even if all of the TUNEL+ cells represented dying neurons, it could not account for the dramatic reduction in neuron number during the first few days after plating. The TUNEL analysis is mirrored very closely by immunodetection of the early apoptosis marker, activated caspase 3; again, only a small number of sphere cells at all time points analyzed are caspase+, and only a fraction of these cells (6% of all caspase+ cells) are immunopositive for βIII- tubulin (Figure 4-5). Physiological Properties of Hybrid Asterons Electrophysiological recording of 20 candidate neurons, astrocytes, and asterons reveals that retrospectively identified asterons (Fig. 4-6A,B) have a varied electrophysiological profile. Clearly-identified neurons show both K+ and Na+ channels, a depolarizing spike, and resting membrane potentials of -70 mV or lower (Fig 4-6C), 34 whereas astrocytes show large K+ channels, small (or no) Na+ channels, no depolarizing spike, and resting membrane potentials usually greater than -70 mV (Fig. 7G). Asterons show wide variability in resting membrane potential (-52 to -78 mV), but consistently display K+ currents with relative amplitudes that place them between the amplitudes seen for neuronal and astrocytic K+ currents. We found examples of asterons that display physiological profiles that resemble astrocytes (Fig. 4-6F; compare to 4-6G), though with lower amplitude K+ current. In addition, one confirmed asteron showed intermediate amplitude K+ channels, neuron-like Na+ channels, and a Na+ spike that could be abolished by the administration of TTX (Fig. 4-6D&E). The relative amplitude of the K+ current among the different cell types, combined with the presence or absence of significant Na+ channels suggests that as cells transition into asterons from neurons, they begin to turn off Na+ channel expression and upregulate K+ channel amplitude. Extracellular Matrix Influence on Neurosphere Migration Neurospheres derived from both SVZ and cerebellar niches developed in culture and when plated on adherent substrates generated robust numbers of neurons and glial cells (Figure 4-7). The results indicate that cells generated from neurospheres display differential migration patterns on the three different ECM substrates tested. Analyzing the distance migrated outward from the edge of the sphere to the furthest observed cell allowed us to generate a plot of migratory velocity, and of total distance migrated. Laminin and fibronectin allow multipotent neurosphere cells to migrate faster compared to CSPG. After 24 h, spheres on all substrates attached and cells began to migrate outward in a radial pattern. Laminin showed a significantly faster migration velocity compared to 35 CSPG, but the difference between fibronectin and laminin was not significant. Although not reaching the level of statistical significance, the difference between fibronectin and CSPG was consistent between trials and did appear to favor migration on fibronectin. At 48 h fibronectin showed a significant difference from both laminin and CSPG in outgrowth velocity, and laminin contributed to a significantly faster cell migration compared to CSPG. At 72 h laminin gave rise to no significant difference in velocity from fibronectin, but both fibronectin and laminin substrates generated significantly faster migratory rates of neurosphere cells compared to CSPG. At 144 h the velocities for all the substrates decreased, suggesting a loss of migratory capacity in the maturing cell population. Total migratory distance followed the same pattern of ECM preference as migration velocity. At 24 h laminin showed a significantly larger outgrowth over CSPG, and fibronectin showed a large but not significant difference over CSPG. At 48 h the increase in fibronectin velocity led to a significant difference in migration distance over both laminin and CSPG. At 72 h, laminin and fibronectin both maintained a significant increase in outgrowth distance over CSPG. This same pattern continued at 144 h. The values obtained for the migration velocities on laminin and fibronectin prior to 144 h are in accordance with cell migration rates reported in slice culture studies by Komuro and Rakic (1995), who observed an average velocity of 13.9 uM/h for migrating cerebellar granule cells in cerebellar slice cultures. This is in agreement with our data showing that the maximal velocity for neurosphere cells on fibronectin at 48 h was 13.94 uM/h and for laminin 12.86 uM/h at 72 h. The velocity data suggests a maturing cell population that begins to mature and cease migrating around 144 h. This decrease does 36 not seem to be distance-related, as each substrate showed a deceleration with significant differences in the migration distance. In addition, whereas the assay does not discriminate between random and directed migration, the radial outward pattern of migration and the lack of asymmetric migration suggests that there is little directed migration (Figure 4-10). Since all substrates exhibited this pattern of nondirected migration we concluded that distance and velocity measures were affected only by matrix composistion. We did not note any difference in neuron/glial percentages between the different ECM substrates that were tested. Nigrostriatal Slice Culture Long-term parasagittal slice cultures demonstrated good viability all the way through 4 weeks in culture. Figure 4-11A shows staining for TH, with robust expression in the SNc, the medial forebrain bundle (MFB) and the striatum, after 3 weeks in culture. In parasagittal slices of postnatal mouse brains, there are 2-3 400 µm thick slices with both the SNc and striatum present from each side, with the MFB also being present between these structures. Figure 4-11B shows DiI labeling of a slice 4 days after application. There is extensive label within the DiI application points in the striatum, and labeled fibers and cells away from the application in the nigral region (Fig. 4-11B), suggesting active transport of the dye through intact fibers. Axon tracing using a 10,000 MW dextran tracer (Fluro-Ruby) placed in the striatum show labeled cells in the cortex (e.g. layer V) and in the nigral area (Fig. 4-11C). Taken together, these data show that long term parasagittal slice cultures retain a sufficient three dimensional organization to functionally model their in vivo correlates. 37 6-Hydroxy Dopamine Lesions of Nigrostriatal Slice Cultures Exposure of the slices to 6-OHDA caused a significant reduction in the number of SNc TH positive neurons. Figure 4-12A shows the TH staining of a slice exposed to 6OHDA at the time of initial plating, with an almost complete lack of staining in the striatum, and a significant reduction in the medial forebrain bundle and SNC after 3 weeks in culture. Cell counts of lesioned slices showed a significant (P=0.0092) 46% ±6% decrease in TH+ cell bodies in the SNc (4-12B). In addition, there was also a significant (P=0.0172) reduction, 60% ± 6%, in the striatal TH density (Fig 4-12C). Nova-red visible chromagen staining (Figure 4-13 A,B) showed robust TH staining throughout the entire nigrostriatal circuit. Lesioned slices showed a similar pattern staining loss as the fluorescent labeling. We did note a difference in dorsal compared to ventral striatal labeling. This is likely due to the sparing of the ventral tegmental area dopamine neurons in the midbrain which preferentially project to the ventral striatum and are less susceptible to 6-OHDA lesioning. High magnification views of the slice cultures also show characteristic lesioninduced changes. Figure 4-14A shows the effect of 6-OHDA on the SNc of slice cultures. In control slices the SNc is morphologically intact with discrete TH staining and a clear cytoarchitecture including fine intranigral fibers. 6-OHDA lesioned slices show a loss of discrete labeling and a reduction in the number of clearly identified cell bodies and intranigral fibers. In the striatum, the loss of TH staining is very pronounced in the lesioned slices (Figure 4-14B). Nova-red staining for TH confirmed the results of fluorescent antibody labeling. High magnification views of the striatum showed a significant reduction in TH staining compared to control slices after 2 weeks in culture (4-15 A,B). High magnification views 38 of the SNc (Figure 4-16 A,B) also showed a reduction in TH staining in lesioned slices. We noted a reduction in non-specific punctuate labeling with the nova-red staining over the fluorescent secondary antibodies suggesting that the visible chromagen method may be the preferred method for visualizing the effect of lesions on the slices. The trade off is that the current nova-red technique has difficulty in resolving cell bodies in control slices due to the staining intensity. Further refinement of the staining methods should enhance the ability to visualize cell bodies in control and lesioned slices. Real Time Analysis of Nigrostriatal Degeneration The use of slices from animals expressing GFP under the control of the TH promoter shows that 6-OHDA exposure causes a loss of GFP expression confirming a similar loss of TH+ cells and fibers in this transgenic mouse model Using slice cultures from the TH-EGFP mouse, it was possible to track, in living slices the loss of GFP signal which corresponded to the loss of dopaminergic innervation. Our initial results demonstrated a strong GFP signal localized to the striatum and the SNc (Figure 4-17). When slices were treated with 6-OHDA prior to their culture, GFP was significantly reduced in the striatum within 4 days of plating. The control GFP signal remained strong for at least a week in culture, suggesting that the culture conditions are amenable to keeping the nigrostriatal circuit intact. Nigrostriatal Slice Culture Applications Using the 6-OHDA lesion model system we have begun to screen a variety of potential therapeutic options. The majority of the work has been done on dennervated slices using ES derived neuronal precursors to try and repair and reconnect damaged circuitry. These cells have demonstrated a robust survival in slice cultures preparations and are amenable to manipulation prior to transplantation. We have examined the effect 39 of laminin on ESNP migration and integration into the slice culture. In vitro and in vivo experiments were performed to induce a dopaminergic phenotype in the ESNP’ cells, in order to replace the cell type lost in Parkinson’s. Given the ease of manipulation and access to the slice culture and the transplanted cells we have also demonstrated functional characterization of implanted ESNP’s. Embryonic Stem Cell Neural Precursor Transplants into Nigrostriatal Slice Cultures ESNP’s transplanted into slice cultures remained viable for up to 4 weeks in culture. When initially plated the cells tended to exist as aggregates that cells slowly migrated out from. Figure 4-18 shows ESNP’s implanted on the slice after 6 days in culture. After 3 weeks in culture, ESNP’s were observed throughout the implantation area and possessed a more mature phenotype with processes and expression of neural cytoskeletal markers, such as MAP2 (Figure 4-19). Adding laminin to the ESNP transplant mixture enhanced the outgrowth of cells through the slice culture. Within 6 days in the presence of laminin, cells had dispersed out in the slice and there was a lack of cellular aggregation seen with laminin (Figure 4-20, 4-21). Embryonic Stem Cell Neural Precursor Integration and Maturation in Slice Cultures ESNP integration into the slice culture appeared robust, with many of the cells developing extensive processes (Figure 4-22). ESNP’s implanted into the slice culture striatum matured and were able to integrate into the slice culture circuitry. Electrophysiological recording from an ESNP in the striatum showed that the cell was capable of generating an action potential and responded to post synaptic currents, suggesting that the cell was receiving inputs from surrounding neurons in the striatum. 40 Figure 4-23 shows a mature ESNP in the striatum, and shows the recorded cell and the electrophysiologal traces that were performed on the cell within the slice. The ultimate goal of transplantation regeneration is to replace the cell population lost in the degeneration and to have the transplant reside in the anatomically correct location. Preliminary results with transplants near the intact SNc have shown that ESNP’s are able to mature in this region and survive (Figure 4-24). Dopaminization of Transplantable Cell Populations Dopamine Neuron Generation from ESNP Culture In Vitro Culturing ESNP’s in the presence of FGF8, SHH, and FGF8, enhanced the differentiation of these cells into dopamine neurons. Our results with a 7 day induction protocol showed an approximate 10-fold increase in the number of TH+ neurons generated compared to non-induced controls (Figure 4-25). In vitro dopaminized ESNP’s matured rapidly on laminin coated coverslips and extended long processes. Figure 4-26 shows the typical morphology of in vitro dopaminized ESNPs. Dopamine Neuron Generation from ESNP Cultures in Slice Culture Using our slice culture model system we showed the ability of ES derived neurons to mature and integrate within the culture environment. Our next step involved manipulating the cells that we were transplanting in order to try and selectively replace the population of neurons that was lost in our lesion model, the dopaminergic neurons of the SNc. Various strategies have been attempted to try and induce a dopaminergic phenotype in cells, ranging from genetic knock-ins of transcriptions factors to culture in the presence of cytokines and growth factors. Using a combination strategy of two of the more potent cytokine induction methods, we were able to enhance dopaminergic neuron generation in our ESNP cultures, and obtained interesting results using this induction method on other 41 cell populations. In the slice cultures, dopaminized ESNP’s survived for at least 2 weeks in the slice and exhibited morphological maturation. We observed transplanted dopaminized neurons located in ectopic locations such as the striatum and cortex (Figure 4-27). In general these neurons had robust process extension, but did not appear to have any sort of directed growth Dopaminization of Adult Stem Cell Cultures Given the success of the cytokine cocktail on inducing a dopamine phenotype, preliminary work has begun on inducing adult stem cell neuroblasts to a dopaminergic phenotype. The initial results have suggested that adult neural stem cells can be induced using cytokines, but that the effect is more limited than in ES derived neurons (Figure 428). In addition we noted a lack of co-localization of TH with neuronal markers. While this does not rule out the possibility that these cells are neuronal, it does raise the issue of whether non-neuronal cell types can be induced to express TH (Figure 4-29). 42 Figure 4-1. Combined β-III tubulin and GFAP immunolabeling reveals the temporal progression of the asteron phenotype. A) Shortly after initiation of differentiation, spheres contain non-overlapping populations of cells immunopositive for either β-III tubulin (red), or GFAP (green). No cells are seen co-expressing both markers (inset in A, higher magnification). B) Twenty-four hours post-plating, spheres still contain cells with mutually exclusive β-III tubulin (red)/GFAP(green) labeling patterns, but neuronal morphology is more mature (inset in B). C) Phenotypic heterogeneity is increased two days after plating, with cells that co-label with both neuron (red) and astrocyte (green) markers (arrow pointing to “yellow” cell). D) At three days post-plating, few cells exclusively expressing β-III tubulin can be seen, and the number of co-expressing asterons increases. E) At five days neurons are very scarce, and co-expressing asterons display astrocytic morphologies. Inset in (E) shows a higher magnification of an asteron at this stage. F) By six days co-expressing cells show a wide, flat, fibroblast-like morphology typical of cultured astrocytes. 43 Figure 4-2. Antibodies against β-III tubulin and GFAP reveal three immunophenotypes, and label separate sub-cellular elements within asterons. A) β-III tubulin+ neurons (red), GFAP+ astrocytes (green), and co-expressing asterons (yellow) can be seen in close proximity with no evidence of antibody cross-reactivity. B-D) Confocal microscopy shows the co-localization of both immunomarkers in a single z-axis of an asteron. Scale bar in (A) applies to all panels. 44 Figure 4-3. Asterons co-express β-III tubulin with S100β, and transcribe GFAP mRNA Two days after plating, some cells (e.g. arrows) are co-labeled with both the astrocyte calcium-binding protein S100β, and β-III tubulin (A). Not all β-III tubulin+ cells are also S100β+ (lower left inset in A: arrow indicates a cell exclusively expressing β-III tubulin), indicating that the staining pattern does not result from antibody cross-reactivity. Lower right inset in (A) shows higher magnification of a double-labeled asteron. (B&C). Some cells that hybridze GFAP cDNA (asterisk in B) also immunolabel for GFAP and β-III tubulin (asterisk in C). Inset in (B) shows that β-III tubulin+ neurons (red) do not hybridize GFAP cDNA. 45 Figure 4-4. Asteron appearance corresponds with neuronal reduction that is not attributable to apoptotic cell loss. A) TUNEL staining reveals cells undergoing apoptosis in control DNAse-treated sphere cells. B) Untreated sphere cells plated for three days. C) The temporal relationship among neurons, asterons, and apoptotic cells. As neurons (blue line) decrease, there is a corresponding increase in asterons (green line). TUNEL (red line) shows that there is a steady rate of 1-3 apoptotic cells per sphere during the first week after plating. 46 Figure 4-5. Caspase 3 analysis of cell death accords well with TUNEL data. Histogram shows that the level of cell death detected with caspase 3 immunolabeling during the first week after plating corresponds remarkably well with the level of TUNEL staing. Apoptosis was induced with staurosporine in spheres plated for 48 hours as a positive control (red bar). 47 Figure 4-6. Physiology of neurons, astrocytes, and asterons. A) Candidate asterons immunolabeled for β-III tubulin (red) and GFAP (green) were voltage clamped. B) Patched cells were filled with biocytin (blue) during recording and later immunostained C) Voltage- clamp recordings demonstrate the Na+ and K+ current profiles of a typical neuron. D) Tracing of an asteron possessing Na+ and K+ currents. E) TTX exposure blocks the Na+ current activity of this cell. F) Another example of an asteron shows no Na+ current, and a more astrocytic K+ current. G) A trace from a typical astrocyte shows a large amplitude K+ current with no Na+ current. 48 Figure 4-7. Phenotype immunostaining of neurosphere derived cells. Neurosphere derived cells immunolabeled for β-III tubulin (red) and GFAP (green) show evidence of morphologically maturing neurons on the astrocyte monolayer. 49 Figure 4-8. Velocity plot of neurosphere derived cells on different ECM substrates. Velocity plots show that the different ECM substrates have variable effects on neurosphere cell speed. Laminin and fibronectin show the fastest migration speeds, while CSPG significantly slows down cell migration. Cells on all substrates begin to show a decrease in speed after 72 hours in culture. 50 Figure 4-9. Migration distances of neurosphere derived cells on ECM substrates. Neurosphere derived cells show significant differences in migration distance on different ECM substrates. Laminin and fibronectin show the longest migration distances with CSPG significantly reducing cell migration distance. 51 Figure 4-10. Neurosphere derived cell migration patterns and measurements.Cells migrating from neurospheres migrate in a radial pattern outward from the sphere core. A) Neurosphere derived cells on laminin after 144 h in culture. B) Neurospere derived cells on fibronectin after 144 h in culture. C) Neurosphere derived cells on CSPG after 144 h in culture. 52 Figure 4-11. Slice culture viability and nigrostriatal circuit maintenance. A) Montage of TH staining in an intact slice after 2.5 weeks in culture. Inset into A is a nuclear stain of the hippocampus showing the intact cytoarchitecture. B) DiI tracing within a slice after 4 days in culture with the application points in the striatum and backfilled cells in the SNc. C) Dextran tracing of an intact slice after 3 days in culture. Arrows represent application points in the striatum and there are labeled cells in the SNc and the cortex (Higher magnification insets of these regions). 53 Figure 4-12. 6-OHDA lesion of nigrostriatal slice cultures. A) TH staining of a slice culture that was exposed to 20 mM 6-OHDA. B) Histogram showing the percent reduction in SNc cell bodies, P<0.05. C) Reduction in optical density of TH staining. 54 Figure 4-13. Nova-red staining of TH reveals control and lesioned nigrostriatal circuitry. A) Intact control slice culture after 2 weeks in culture. The nigrostriatal circuit, including SNc, MFB, and striatum are all preserved and show intense labeling. B) A 6-OHDA lesioned slice, after 2 weeks in culture. The TH staining is reduced, notably in the SNc and in the dorsal striatum. 55 Figure 4-14. Cytoarchitectural changes in 6-OHDA lesion slice. A) TH staining in the SNc of control and lesioned slices. B) TH staining in the striatum in control and lesioned slice. 56 Figure 4-15. Nova-red labeling of striatal TH shows effect of exposure to 6-OHDA. A) Striatal TH labeling in a control slice culture striatum after 2 weeks in culture. B) Striatal labeling in a 6-OHDA lesioned striatum after two weeks in culture. 57 Figure 4-16. Nova-red staining of the SNc reveals loss of staining after exposure to 6OHDA. A) Representative sections from control slice cultures after 1-2 weeks in culture. B) Representative sections from slice cultures after 1-2 weeks in culture after exposure to 6-OHDA. Slices exposed to 6-OHDA show a significant reduction in staining intensity and in observable cell bodies. 58 Figure 4-17. Real time analysis of TH-GFP. A) Control slices show intense GFP labeling in the striatum at 4 and 7 days. B) 6-OHDA treated slices at the same time points show a significant decrease in GFP intensity suggesting a loss of dopaminergic fibers. 59 Figure 4-18. ESNP transplants into slice cultures. Transplanted ESNP’s after 6 days in the slice culture appear as cellular aggregates with little evidence of migration into the slice tissue. Figure 4-19. Long term ESNP transplants in slice cultures. After 23 days in culture, ESNP’s have migrated through the slice culture and in this high magnification view can be seen extending processes through the slice. Inset shows a MAP2 positive GFP+ neuron, showing that the transplanted cells are expressing neuronal markers. 60 Figure 4-20. Laminin enhances ESNP migration through slice cultures After 6 days in cultures, ESNP’s that were transplanted in the presence of soluble laminin show an increased spread through the slice culture and less cellular aggregation. Figure 4-21. Laminin enhances process outgrowth of ESNP’s in slice cultures. After 6 days in culture, ESNP’s, under high magnification, show evidence of extensive process outgrowth, comparable to ESNP’s not treated with laminin after 3 weeks in culture. 61 Figure 4-22. GFP+ ESNP striatal transplant. GFP+ ESNP located in the striatum after 2 weeks in culture. This ESNP demonstrates a significant level of maturation with extensive process arborization. Red is TH staining showing the dopaminergic fibers running into the striatum, green is GFP and blue is a nuclear counter stain. 62 Figure 4-23. Electrophysiological Characterization of Transplanted Cells. (A) GFP+ ESNP cell in the striatum with patch clamp. B)Tracing indicating that the patched cell has the capability to generate an action potential. C) Tracing showing that the cell exhibits post synaptic currents. Figure 4-24. ESNP’s located near the substantia nigra. ESNP’s located near the SNc show survival and process extension after 2 weeks in culture, suggesting that this region is capable of supporting ESNP engraftment. 63 Figure 4-25. Increase in TH+ neurons derived from ESNP’s exposed to ventralizing agents. Figure 4-26. In vitro ESNP dopaminization.. ESNP’s cultured on laminin coated coverslips, under the influence of inducing cytokines, express TH and show a high level of maturation including extensive process extension. 64 4-27. Dopaminized ESNP’s implanted into slice cultures. TH+ ESNP cells were seen in isolation, with elaborate short distance processes. Cells were implanted into the striatum and were observed in the striatum and neighboring cortex. 65 Figure 4-28. Adult neural stem cells exposed to dopaminzing cytokines express TH. Cultured adult neual stem cells can be treated with FGF8, SHH, and pleiotropin to induce TH expression in a subset of cells. Red is beta III tubulin and green is TH. 66 Figure 4-29. Induced TH+ adult stem cells. Adult neural stem cells exposed to FGF8, SHH, and pleiotrophin. Panel A shows TH+ cells, Panel B is beta III tubulin positive cells and Panel C shows the merged image with a nuclear counterstain. CHAPTER 5 DISCUSSION AND CONCLUSIONS Adult neural stem cells and ES derived neurons represent two populations of cells that may be amenable to repair and regeneration within the central nervous system. One of the biggest challenges to utilizing stem cells effectively is controlling cell migration, differentiation, and integration into damaged tissue. Our initial work with adult neurosphere cultures focused on cell fate determination. In these experiments we observed a hybrid cell type that we termed “asterons” that appeared to posses characteristics of both neurons and astrocytes. Further analysis of neurosphere cells on different ECM molecules allowed us to generate migration profiles that have identified ECM molecules that enhance migration of neural stem cells. In order to better understand how stem cells behave in the neuronal environment we have developed a novel slice culture bioassay system. Using this slice culture model system we can observe in real time the fate choice and integration potential of both adult and embryonic stem cells. Stem cell repair of damaged circuits within the brain is a key area of stem cell therapy and our slice culture bioassay focused on examining stem cell behavior in a model of Parkinson’s disease. Characterizing and manipulating stem cell fate choice is a critical component of utilizing stem cells for regeneration based therapies. Without the ability to make the right type of cell, stem cell based therapies would be ineffective or potentially more harmful to the patient. In addition, basic questions of cell phenotype and cellular developmental processes can be examined using stem cells as a recapitulation of cellular differentiation. 67 68 Our initial experiments on adult neural stem cell derived neurosphere cells allowed us to examine postnatally derived glial and neuronal development. Our observations indicated a time dependent decrease in the neuronal population, coincident with the appearance of the hybrid cell type asterons. Our hypothesis was that a subset of neurons in the neurosphere cultures was transdifferentiating from early immature neurons into glial cells. Our data showed that only immature neuronal markers, such as beta III tubulin, co-localized with astrocyte markers such as GFAP in asterons. Mature markers, such as NeuN did not co-localize with any glial markers. This suggests that the asteron is only expressing immature markers of differentiation. Electrophysiological recording from asterons showed an variable intermediate profile of membrane currents and potential. Compared to neurons, asterons tend to lose Na+ currents, show increased K+ amplitude and generally have a lower resting membrane potential. However we did observe asterons that were capable of generating action potentials that could be blocked using Na+ channel blockers. Cell death analysis did not show any significant levels of neuronal apoptosis, suggesting that not all of the neuronal loss was due to cell death. All of the evidence then supports are hypothesis that neurosphere derived early neurons may be capable of altering their cell fate choice during early development. While there is no reliable evidence for asterons in vivo, there have been several reports of cells that appear to have intermediate properties. Some GFAP+ cells derived from human embryonic CNS stem cells can exhibit spontaneous neuronal firing patterns in vitro (Gritti et al., 2000), and a GluR-expressing astrocyte in the hippocampus has been described that may represent an intermediate cell type (referred to as an astron) that possesses glial properties, but may have begun to express neuronal genes (Matthias et al., 69 2003). While it is possible that the asteron may only represent an in vitro state, it does suggest that environmental factors can be used to alter cell fate choice, and in addition generate unique cell type. An intriguing possibility is that the asteron represents an open ended state of stem cell differentiation. At this stage the asteron may be more receptive to exogenous influences to determine cell fate as well as certain intrinsic programs. Damage to these intrinsic developmental programs has been linked to the development of tumors derived from stem cells (Perryman and Sylvester, 2006). In addition there have been reports of cells similar to asterons isolated from cortical brain tumors of humans (Ignatova et al., 2002). The asteron therefore could be an in vitro representation of an in vivo stem cell state that allows for differentiation, but may also represent a state where oncogenic disruptions might initiate tumor formation. Our next area of study using these adult neural stem cell derived cells was to examine the effect of extracellular matrix molecules on cell fate choice as well as physical properties of migration. Extracellular matrix molecules have long been shown to affect cell migration and differentiation, both in vivo and in vitro. Neural stem cells in particular are normally restricted to their germinal zones through the use of inhibitory and permissive ECM. Neurosphere derived cells plated on laminin and fibronectin showed and enhanced migration capacity, compared to CSPG substrate. Our results indicated that neural stem cells on all tested substrates demonstrated a time dependant increase, then decrease, in migration velocity. This pattern is suggestive of a maturing cell population that becomes less mobile, and more morphologically mature. The velocity data also shows that fibronectin and laminin are more permissive for neural stem cell and daughter 70 cell migration than CSPG. There was no appreciable difference in cell fate, suggesting that the adult neural stem cell does not respond to these ECM molecules in determining fate. Given the predictable nature of neural stem cell behavior on these substrates it becomes feasible to generate scaffolds for neural stem cell transplants or as bridges for endogenous stem cell migration. Permissive substrates placed inside the rostral migratory stream could hypothetically be used to transport endogenous stem cells to the site of an injury. This scaffold could be seeded with cytokines and transcription factor activators that could be used to induce SVZ stem cells into the appropriate cell type for repair. Working within the in vitro cell culture model provides advantages in observation and manipulation, but does not provide enough information regarding how in vivo environments and conditions may interact with cell transplants. Since cell transplants are being aggressively targeted for neurodegenerative disorders, we decided to focus our stem cell characterization and manipulation on a model of Parkinson’s disease. Based on our observations using adult neurosphere derived cells, we needed a system where we could track over time the differentiation and migration of cells within the model. Organotypic slice cultures represent a novel culture method that combines advantages of in vitro and in vivo environments. By maintaining the cytoarchitecture of the brain, cell transplants are exposed to factors and environmental conditions similar to in vivo transplants. In addition slice cultures allow for the direct manipulation and observation of transplanted cells. Developing a novel mid-sagittal slice culture system that maintains an intact nigrostriatal circuit was our first challenge. Once we accomplished creating the slice model, our experiments demonstrated that both embryonic and adult stem cell fate determination is dependent on the interplay of many different factors. The ability to 71 observe and manipulate these cells inside the neuronal environment is critical to better understand how these transplants might behave in patients. Cell transplants are being developed as a therapy for neurodegenerative diseases. Our slice culture model provides a suitable paradigm to model nigrostriatal degeneration and allows for a “Parkinson’s disease in a dish” system. This novel system maintains an intact connection between the circuit components throughout the entire culturing period, as opposed to other slice culture paradigms that rely on regrowth of axons in culture to recreate connections in the dish. This model system can be used to observe the endogenous cells within the slice, as well as test a variety of toxic or therapeutic agents. Using 6-OHDA we have selectively degenerated the nigrostriatal circuit and generated a model of PD that is amenable to testing therapeutic options such as stem cell replacement therapies. Exposure to 6-OHDA induced a significant level of nigrostriatal degeneration, causing an approximate 46% reduction in SNc cell bodies and a 60% reduction in striatal dopamine innervation. These reductions are in the rage of those seen in early to mid stage PD, and represent a reasonable level of degeneration at which to test cell replacement strategies. This model system is also amenable to future lesion options. Initial work is being done on other potential toxic lesions, including using proteosome inhibitors. Previous work using these compounds in animal models has shown degeneration in the nigrostriatal circuit and evidence of lewy bodies inclusions. This toxin model may more accurately model the progressive nature of PD, and recreate the key pathological hallmark of intracellular inclusions. Using this toxin in a slice culture model should allow for a detailed examination of how intracytoplasmic inclusions may initiate cellular 72 degeneration. Real time observation of cell states during inclusion generation may yield clues as to what cellular processes or insults precipitate lewy body formation. Besides toxic lesions, the availability of genetic mutants has allowed for the examination of specific mutations on the development of neurodegeneration. Mutants such as the alpha synuclein, and parkin mutations have provided valuable insight as to what biochemically occurs in neuronal cells with known PD mutations. Slice cultures allow for the examination of these mutant models, independent of co-morbidity factors that are often present in these mutants. An example of this is the weaver mutation. Weaver mutants display a severe cerebellar dysfunction and exhibit ataxia, as well as progressive degeneration in the nigrostriatal circuit with a specific loss of A9 dopamine neurons in the SNc (Triarhou, 2002). The mutation linked to weaver, the GIRK2 potassium channel mutation, has been shown to be important in A9 dopaminergic SNc neurons genesis and survival (Triarhou et al., 1988). While this mutant shows some useful features of PD, its limited lifespan, postnatal day 21 usually, makes it a difficult animal model. We have cultured weaver brain slice cultures past this day 21 mark and initial results suggest that the viability of non affected regions are not significantly reduced. Since the cause of death in most of the mutants is a failure to thrive due to motor deficits, the slice culture model is an effective way to track the ongoing degeneration caused by the mutation independent of the animal. As more mutations are discovered in familial and sporadic PD, the number of mutant models will increase, and this slice culture model system represents a promising methodology to rapidly screen mutant disease progression and therapeutic efficiencies. 73 ES cell derived neurons were implanted into slice cultures and survived and integrated into the host tissue. This integration may be enhanced by the addition of permissive ECM molecules that would increase cellular migration and process extension. Experiments presented here have shown that adult neural stem cells show an increase in migratory potential on laminin and fibronectin over CSPG. Based on these results, the seeding of neural stem cells in different matrices may allow for a precise and directed migratory pattern. Further development of ECM substrates may allow for the development of grafts that could redirect endogenous stem cells to areas of damage and degeneration and allow for in situ regeneration. The presence of laminin with our transplanted ESNP’s enhanced their migratory potential and integration into the slice. This observation may have important clinical implications as stem cell transplantation strategies become more refined. The addition of permissive ECM molecules to stem cell transplants in clinical settings may allow for better cell survival and integration. ECM molecules have been implicated in ES derived neuron maturation and phenotype fate. Understanding what ECM molecules direct ES cell fate choice it may be possible to replicate this in transplants. As a general rule the more immature a cell is the better chance that it has to survive and integrate into a host environment. Being able to implant less mature ES derived neurons that can complete their maturation and development within the host would allow for a better integration. Directing ES and adult neural stem cells toward the appropriate phenotype is a critical step in ensuring that the cells being transplanted respond in the correct physiological manner. Our results with FGF8, SHH, and pleiotrophin, demonstrated that cytokine exposure is a potent paradigm for inducing TH expression in ES derived 74 neurons and to a lesser extent adult neural stem cells. While the tested cells are positive for tyrosine hydroxylase, there is still little evidence that these cells are actively releasing dopamine. Future work on these induced cells will hopefully be able to analyze conditioned media from these cells and assay the presence of dopamine or its metabolites in the media. Even with appropriate release of dopamine, there are still hurdles in reconnecting the circuitry. Recent evidence from patients treated with fetal dopaminergic cells has suggested that the incidence of dyskinesia, abnormal and exaggerated motor movements, is the result of inappropriate dopamine release, and loss of dopamine reuptake, from the transplanted cells. Within the ventral mesencephalon there are two distinct groups of dopamine cells, the A9 and A10 type cells. A9 cells of the SNc are involved in the motor pathway and express dopamine autoreceptors that modulate dopamine release. A10 cells of the ventral tegmental area are involved in reward pathways with dopamine release, and lack the autoreceptor feedback. Since A9 and A10 cells are both part of the transplanted cell mixture put into the damaged striatum, there is the potential for unregulated dopamine release that can lead to the dyskinesia.. Along with ESNP’s we examined the use of adult stem cells as an inducible cell population. Our initial results suggest that adult derive neural stem cells could be induced to generate TH+ cells. Further work to be done on fine tuning the dopaminergic phenotype will likely focus on genetic manipulation, through induction of SNc specific transcription factors. Analysis of different dopaminergic populations to better understand which genetic factors are involved in the final differentiation should allow for production of tailored neurons that provide the correct signal output. Coupled with the information 75 on stem cell behavior on various substrates, this presents a possible transplantation enhancement strategy for use in cell replacement therapies in neurodegenerative diseases. Nigrostriatal slice cultures provide an adaptable and scalable methodology for gene therapy based approaches for prevention and/or treatment of Parkinson’s disease. Gene therapy systems using AAV or Lentiviral vectors to introduce growth factors such as brain derived growth factor (BDNF) or glial derived growth factor (GDNF) into animal models of nigrostriatal degeneration (Bjorklund, 2000) . The ability to deliver gene therapy agents directly to the brain regions of interest reduces the difficulty associated with this procedure as well as allowing for a smaller volume to be more precisely delivered. In addition there is initial data on the efficacy of using a polymer based gene therapy system (Hofland, 1996) to introduce genes into glioblastomas located within slice cultures. One of the most promising potential applications for this slice culture model system is the ability to do high throughput screening of compounds that either increase cellular degeneration or ones that prevent it. Slice cultures allow for more experiments per animal and for direct manipulation of the tissue and the environment. Using slice cultures from the TH-GFP animals we have been able to show proof of concept that these slices can provide a read out of TH innervation in real time. Using 6-OHDA we have noted a significant reduction in GFP intensity within the striatum compared to control slices that have been in culture for over a week. Using this system a large number of compounds could be assayed and effects over time measured. Given the epidemiological data for pesticides and heavy metal exposure, the TH-GFP slice culture system may provide a 76 way to track how important factors such dose and time of exposure are for the potential toxicity of these compounds. The research presented here describes a novel slice culture model system that provides a “Parkinson’s in a dish” model system. Using this and in vitro cultures, we have examined ES and adult neural stem cell differentiation, migration and integration under a variety of conditions. Our results suggest that stem cells are greatly influenced by their environment. Factors present during their culture can induce cell fate choices, and can even promote hybrid cell types not normally seen in vivo. Extracellular matrix molecules, such as laminin and fibronectin, can enhance stem cell migration, while ECM such as chondroitin sulfate inhibits cell migration. In slice cultures laminin enhances stem cell migration and morphological maturation. As stem cell therapy becomes more widely available the need for information on how to condition these cells prior to transplantation and how to best deliver and control them during and after transplantation will be key to harnessing the power of these cells to rebuild damaged circuits and restore function. LIST OF REFERENCES Albin RL, Young AB, Penney JB (1995) The functional anatomy of disorders of the basal ganglia. Trends Neurosci 18:63-64. Altman J (1969a) Autoradiographic and histological studies of postnatal neurogenesis. 3. Dating the time of production and onset of differentiation of cerebellar microneurons in rats. J Comp Neurol 136:269-293. Altman J (1969b) Autoradiographic and histological studies of postnatal neurogenesis. IV. Cell proliferation and migration in the anterior forebrain, with special reference to persisting neurogenesis in the olfactory bulb. J Comp Neurol 137:433-457. Altman J, Das GD (1965) Autoradiographic and histological evidence of postnatal hippocampal neurogenesis in rats. J Comp Neurol 124:319-335. Altman J, Das GD (1966) Autoradiographic and histological studies of postnatal neurogenesis. I. A longitudinal investigation of the kinetics, migration and transformation of cells incorporating tritiated thymidine in neonate rats, with special reference to postnatal neurogenesis in some brain regions. J Comp Neurol 126:337-389. Anden NE, Dahlstroem A, Fuxe K, Larsson K (1965) Further Evidence for the Presence of Nigro-Neostriatal Dopamine Neurons in the Rat. Am J Anat 116:329-333. Anden NE, Dahlstrom A, Fuxe K, Larsson K (1966) Functional role of the nigroneostriatal dopamine neurons. Acta Pharmacol Toxicol (Copenh) 24:263-274. Anden NE, Carlsson A, Dahlstroem A, Fuxe K, Hillarp NA, Larsson K (1964) Demonstration and Mapping out of Nigro-Neostriatal Dopamine Neurons. Life Sci 15:523-530. Ansari SA, Nachanakian A, Biary NM (2002) Current surgical treatment of Parkinsons disease. Saudi Med J 23:1319-1323. Benninger F, Beck H, Wernig M, Tucker KL, Brustle O, Scheffler B (2003) Functional integration of embryonic stem cell-derived neurons in hippocampal slice cultures. J Neurosci 23:7075-7083. 77 78 Betarbet R, Sherer TB, Greenamyre JT (2005) Ubiquitin-proteasome system and Parkinson's diseases. Exp Neurol 191 Suppl 1:S17-27. Blandini F, Nappi G, Tassorelli C, Martignoni E (2000) Functional changes of the basal ganglia circuitry in Parkinson's disease. Prog Neurobiol 62:63-88. Bjorklund A, Kirik D, Rosenblad C, Georgievska B, Lundberg C, Mandel RJ (2000) Towards a neuroprotective gene therapy for Parkinson's disease: use of adenovirus, AAV and lentivirus vectors for gene transfer of GDNF to the nigrostriatal system in the rat Parkinson model. Brain Res 886:82-98. Bradbury EJ, Moon LD, Popat RJ, King VR, Bennett GS, Patel PN, Fawcett JW, McMahon SB (2002) Chondroitinase ABC promotes functional recovery after spinal cord injury. Nature 416:636-640. Bradley A, Evans M, Kaufman MH, Robertson E (1984) Formation of germ-line chimaeras from embryo-derived teratocarcinoma cell lines. Nature 309:255-256. Braissant O, Wahli W (1998) Differential expression of peroxisome proliferator-activated receptor-alpha, -beta, and -gamma during rat embryonic development. Endocrinology 139:2748-2754. Brazelton TR, Rossi FM, Keshet GI, Blau HM (2000) From marrow to brain: expression of neuronal phenotypes in adult mice. Science 290:1775-1779. Brotchie JM, Lee J, Venderova K (2005) Levodopa-induced dyskinesia in Parkinson's disease. J Neural Transm 112:359-391. Castellani RJ, Siedlak SL, Perry G, Smith MA (2000) Sequestration of iron by Lewy bodies in Parkinson's disease. Acta Neuropathol (Berl) 100:111-114. Cha GH, Kim S, Park J, Lee E, Kim M, Lee SB, Kim JM, Chung J, Cho KS (2005) Parkin negatively regulates JNK pathway in the dopaminergic neurons of Drosophila. Proc Natl Acad Sci U S A 102:10345-10350. Chambers I, Colby D, Robertson M, Nichols J, Lee S, Tweedie S, Smith A (2003) Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 113:643-655. Deane KH, Spieker S, Clarke CE (2004) Catechol-O-methyltransferase inhibitors for levodopa-induced complications in Parkinson's disease. Cochrane Database Syst Rev:CD004554. Diamond A, Jankovic J (2005) The effect of deep brain stimulation on quality of life in movement disorders. J Neurol Neurosurg Psychiatry 76:1188-1193. 79 Doetsch F, Garcia-Verdugo JM, Alvarez-Buylla A (1999a) Regeneration of a germinal layer in the adult mammalian brain. Proc Natl Acad Sci U S A 96:11619-11624. Doetsch F, Caille I, Lim DA, Garcia-Verdugo JM, Alvarez-Buylla A (1999b) Subventricular zone astrocytes are neural stem cells in the adult mammalian brain. Cell 97:703-716. Draper JS, Andrews PW (2002) Embryonic stem cells: advances toward potential therapeutic use. Curr Opin Obstet Gynecol 14:309-315. Dunnett SB, Rogers DC, Richards SJ (1989) Nigrostriatal reconstruction after 6-OHDA lesions in rats: combination of dopamine-rich nigral grafts and nigrostriatal "bridge" grafts. Exp Brain Res 75:523-535. Franklin BJ, Paxinos, G.T. (1996) The Mouse Brain in Stereotaxic Coordinates. New York: Academic Press. Freed CR, Rosenberg NL, Schneck SA, Breeze RE (1992) Improved drug responsiveness following fetal tissue implant for Parkinson's disease. Neurochem Int 20 Suppl:321S-327S. Freed CR, Greene PE, Breeze RE, Tsai WY, DuMouchel W, Kao R, Dillon S, Winfield H, Culver S, Trojanowski JQ, Eidelberg D, Fahn S (2001) Transplantation of embryonic dopamine neurons for severe Parkinson's disease. N Engl J Med 344:710-719. Gasser T (2005) Genetics of Parkinson's disease. Curr Opin Neurol 18:363-369. Gates MA, O'Brien TF, Faissner A, Steindler DA (1993) Neuron-glial interactions during the in vivo and in vitro development of the nigrostriatal circuit. J Chem Neuroanat 6:179-189. George EL, Georges-Labouesse EN, Patel-King RS, Rayburn H, Hynes RO (1993) Defects in mesoderm, neural tube and vascular development in mouse embryos lacking fibronectin. Development 119:1079-1091. Gerlach M, Riederer P (1996) Animal models of Parkinson's disease: an empirical comparison with the phenomenology of the disease in man. J Neural Transm 103:987-1041. Gerlach M, Double KL, Ben-Shachar D, Zecca L, Youdim MB, Riederer P (2003) Neuromelanin and its interaction with iron as a potential risk factor for dopaminergic neurodegeneration underlying Parkinson's disease. Neurotox Res 5:35-44. Gibb WR, Lees AJ (1988) The relevance of the Lewy body to the pathogenesis of idiopathic Parkinson's disease. J Neurol Neurosurg Psychiatry 51:745-752. 80 Glinka Y, Gassen M, Youdim MB (1997) Mechanism of 6-hydroxydopamine neurotoxicity. J Neural Transm Suppl 50:55-66. Gorell JM, Johnson CC, Rybicki BA, Peterson EL, Kortsha GX, Brown GG, Richardson RJ (1997) Occupational exposures to metals as risk factors for Parkinson's disease. Neurology 48:650-658. Gould E, Reeves AJ, Graziano MS, Gross CG (1999) Neurogenesis in the neocortex of adult primates. Science 286:548-552. Greenamyre JT, Betarbet R, Sherer TB (2003) The rotenone model of Parkinson's disease: genes, environment and mitochondria. Parkinsonism Relat Disord 9 Suppl 2:S59-64. Grimpe B, Dong S, Doller C, Temple K, Malouf AT, Silver J (2002) The critical role of basement membrane-independent laminin gamma 1 chain during axon regeneration in the CNS. J Neurosci 22:3144-3160. Gritti A, Rosati B, Lecchi M, Vescovi AL, Wanke E (2000) Excitable properties in astrocytes derived from human embryonic CNS stem cells. Eur J Neurosci 12:3549-3559. Hadjantonakis AK, Gertsenstein M, Ikawa M, Okabe M, Nagy A (1998) Generating green fluorescent mice by germline transmission of green fluorescent ES cells. Mech Dev 76:79-90. Hauser RA, Freeman TB, Snow BJ, Nauert M, Gauger L, Kordower JH, Olanow CW (1999) Long-term evaluation of bilateral fetal nigral transplantation in Parkinson disease. Arch Neurol 56:179-187. Heikkila RE, Sonsalla PK (1992) The MPTP-treated mouse as a model of parkinsonism: how good is it? Neurochem Int 20 Suppl:299S-303S. Hirsch EC, Faucheux BA (1998) Iron metabolism and Parkinson's disease. Mov Disord 13 Suppl 1:39-45. Hofland HE, Shephard L, Sullivan SM (1996) Formation of stable cationic lipid/DNA complexes for gene transfer. Proc Natl Acad Sci U S A 93:7305-7309. Ianus A, Holz GG, Theise ND, Hussain MA (2003) In vivo derivation of glucosecompetent pancreatic endocrine cells from bone marrow without evidence of cell fusion. J Clin Invest 111:843-850. Ignatova TN, Kukekov VG, Laywell ED, Suslov ON, Vrionis FD, Steindler DA (2002) Human cortical glial tumors contain neural stem-like cells expressing astroglial and neuronal markers in vitro. Glia 39:193-206. 81 Isacson O, Bjorklund L, Pernaute RS (2001) Parkinson's disease: interpretations of transplantation study are erroneous. Nat Neurosci 4:553. Isacson O, Bjorklund LM, Schumacher JM (2003) Toward full restoration of synaptic and terminal function of the dopaminergic system in Parkinson's disease by stem cells. Ann Neurol 53 Suppl 3:S135-146; discussion S146-138. Jenner P (2003) Oxidative stress in Parkinson's disease. Ann Neurol 53 Suppl 3:S26-36; discussion S36-28. Johnston TH, Brotchie JM (2004) Drugs in development for Parkinson's disease. Curr Opin Investig Drugs 5:720-726. Joseph C, Chassan JB, Koch ML (1978) Levodopa in Parkinson disease: a long-term appraisal of mortality. Ann Neurol 3:116-118. Jung CG, Hida H, Nakahira K, Ikenaka K, Kim HJ, Nishino H (2004) Pleiotrophin mRNA is highly expressed in neural stem (progenitor) cells of mouse ventral mesencephalon and the product promotes production of dopaminergic neurons from embryonic stem cell-derived nestin-positive cells. Faseb J 18:1237-1239. Kearns SM, Laywell ED, Kukekov VK, Steindler DA (2003) Extracellular matrix effects on neurosphere cell motility. Exp Neurol 182:240-244. Kearns SM, Scheffler B, Goetz AK, Lin DD, Baker HD, Roper SN, Mandel RJ, Steindler DA (2006) A method for a more complete in vitro Parkinson's model: Slice culture bioassay for modeling maintenance and repair of the nigrostriatal circuit. J Neurosci Methods. Keller GM (1995) In vitro differentiation of embryonic stem cells. Curr Opin Cell Biol 7:862-869. Kluge A, Hailer NP, Horvath TL, Bechmann I, Nitsch R (1998) Tracing of the entorhinal-hippocampal pathway in vitro. Hippocampus 8:57-68. Kornack DR, Rakic P (2001) Cell proliferation without neurogenesis in adult primate neocortex. Science 294:2127-2130. Kress GJ, Reynolds IJ (2005) Dopaminergic neurotoxins require excitotoxic stimulation in organotypic cultures. Neurobiol Dis. Kuhn HG, Dickinson-Anson H, Gage FH (1996) Neurogenesis in the dentate gyrus of the adult rat: age-related decrease of neuronal progenitor proliferation. J Neurosci 16:2027-2033. 82 Lai BC, Marion SA, Teschke K, Tsui JK (2002) Occupational and environmental risk factors for Parkinson's disease. Parkinsonism Relat Disord 8:297-309. Landolt RM, Vaughan L, Winterhalter KH, Zimmermann DR (1995) Versican is selectively expressed in embryonic tissues that act as barriers to neural crest cell migration and axon outgrowth. Development 121:2303-2312. Laywell ED, Dorries U, Bartsch U, Faissner A, Schachner M, Steindler DA (1992) Enhanced expression of the developmentally regulated extracellular matrix molecule tenascin following adult brain injury. Proc Natl Acad Sci U S A 89:2634-2638. Laywell ED, Rakic P, Kukekov VG, Holland EC, Steindler DA (2000) Identification of a multipotent astrocytic stem cell in the immature and adult mouse brain. Proc Natl Acad Sci U S A 97:13883-13888. Laywell ED, Kukekov VG, Suslov O, Zheng T, Steindler DA (2002) Production and analysis of neurospheres from acutely dissociated and postmortem CNS specimens. Methods Mol Biol 198:15-27. Laywell ED, Kearns SM, Zheng T, Chen KA, Deng J, Chen HX, Roper SN, Steindler DA (2005) Neuron-to-astrocyte transition: phenotypic fluidity and the formation of hybrid asterons in differentiating neurospheres. J Comp Neurol 493:321-333. Linert W, Herlinger E, Jameson RF, Kienzl E, Jellinger K, Youdim MB (1996) Dopamine, 6-hydroxydopamine, iron, and dioxygen--their mutual interactions and possible implication in the development of Parkinson's disease. Biochim Biophys Acta 1316:160-168. Lois C, Alvarez-Buylla A (1993) Proliferating subventricular zone cells in the adult mammalian forebrain can differentiate into neurons and glia. Proc Natl Acad Sci U S A 90:2074-2077. Lozano AM, Eltahawy H (2004) How does DBS work? Suppl Clin Neurophysiol 57:733736. Lucking CB, Durr A, Bonifati V, Vaughan J, De Michele G, Gasser T, Harhangi BS, Meco G, Denefle P, Wood NW, Agid Y, Brice A (2000) Association between early-onset Parkinson's disease and mutations in the parkin gene. French Parkinson's Disease Genetics Study Group. N Engl J Med 342:1560-1567. Lyons KE, Pahwa R (2005) Long-term benefits in quality of life provided by bilateral subthalamic stimulation in patients with Parkinson disease. J Neurosurg 103:252255. 83 Magavi SS, Leavitt BR, Macklis JD (2000) Induction of neurogenesis in the neocortex of adult mice. Nature 405:951-955. Martin MJ, Muotri A, Gage F, Varki A (2005) Human embryonic stem cells express an immunogenic nonhuman sialic acid. Nat Med 11:228-232. Matthias K, Kirchhoff F, Seifert G, Huttmann K, Matyash M, Kettenmann H, Steinhauser C (2003) Segregated expression of AMPA-type glutamate receptors and glutamate transporters defines distinct astrocyte populations in the mouse hippocampus. J Neurosci 23:1750-1758. McNaught KS, Bjorklund LM, Belizaire R, Isacson O, Jenner P, Olanow CW (2002) Proteasome inhibition causes nigral degeneration with inclusion bodies in rats. Neuroreport 13:1437-1441. Moon LD, Brecknell JE, Franklin RJ, Dunnett SB, Fawcett JW (2000) Robust regeneration of CNS axons through a track depleted of CNS glia. Exp Neurol 161:49-66. Morrison SJ, Shah NM, Anderson DJ (1997) Regulatory mechanisms in stem cell biology. Cell 88:287-298. Mueller JC, Fuchs J, Hofer A, Zimprich A, Lichtner P, Illig T, Berg D, Wullner U, Meitinger T, Gasser T (2005) Multiple regions of alpha-synuclein are associated with Parkinson's disease. Ann Neurol 57:535-541. Niwa H, Miyazaki J, Smith AG (2000) Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet 24:372376. Novak U, Kaye AH (2000) Extracellular matrix and the brain: components and function. J Clin Neurosci 7:280-290. Okabe S, Forsberg-Nilsson K, Spiro AC, Segal M, McKay RD (1996) Development of neuronal precursor cells and functional postmitotic neurons from embryonic stem cells in vitro. Mech Dev 59:89-102. Olanow CW, Goetz CG, Kordower JH, Stoessl AJ, Sossi V, Brin MF, Shannon KM, Nauert GM, Perl DP, Godbold J, Freeman TB (2003) A double-blind controlled trial of bilateral fetal nigral transplantation in Parkinson's disease. Ann Neurol 54:403-414. 84 Olanow CW, Agid Y, Mizuno Y, Albanese A, Bonuccelli U, Damier P, De Yebenes J, Gershanik O, Guttman M, Grandas F, Hallett M, Hornykiewicz O, Jenner P, Katzenschlager R, Langston WJ, LeWitt P, Melamed E, Mena MA, Michel PP, Mytilineou C, Obeso JA, Poewe W, Quinn N, Raisman-Vozari R, Rajput AH, Rascol O, Sampaio C, Stocchi F (2004) Levodopa in the treatment of Parkinson's disease: current controversies. Mov Disord 19:997-1005. Pals P, Lincoln S, Manning J, Heckman M, Skipper L, Hulihan M, Van den Broeck M, De Pooter T, Cras P, Crook J, Van Broeckhoven C, Farrer MJ (2004) alphaSynuclein promoter confers susceptibility to Parkinson's disease. Ann Neurol 56:591-595. Pankratz N, Foroud T (2004) Genetics of Parkinson disease. NeuroRx 1:235-242. Parkinson J (1817) An Essay on the Shaking Palsy. London: Whittingham and Rowland. Perryman SV, Sylvester KG (2006) Repair and regeneration: opportunities for carcinogenesis from tissue stem cells. J Cell Mol Med 10:292-308. Petit A, Kawarai T, Paitel E, Sanjo N, Maj M, Scheid M, Chen F, Gu Y, Hasegawa H, Salehi-Rad S, Wang L, Rogaeva E, Fraser P, Robinson B, St George-Hyslop P, Tandon A (2005) Wild-type PINK1 prevents basal and induced neuronal apoptosis, a protective effect abrogated by Parkinson disease-related mutations. J Biol Chem 280:34025-34032. Polymeropoulos MH, Lavedan C, Leroy E, Ide SE, Dehejia A, Dutra A, Pike B, Root H, Rubenstein J, Boyer R, Stenroos ES, Chandrasekharappa S, Athanassiadou A, Papapetropoulos T, Johnson WG, Lazzarini AM, Duvoisin RC, Di Iorio G, Golbe LI, Nussbaum RL (1997) Mutation in the alpha-synuclein gene identified in families with Parkinson's disease. Science 276:2045-2047. Priyadarshi A, Khuder SA, Schaub EA, Shrivastava S (2000) A meta-analysis of Parkinson's disease and exposure to pesticides. Neurotoxicology 21:435-440. Rakic P (1985) DNA synthesis and cell division in the adult primate brain. Ann N Y Acad Sci 457:193-211. Rogers SL, Letourneau PC, Palm SL, McCarthy J, Furcht LT (1983) Neurite extension by peripheral and central nervous system neurons in response to substratumbound fibronectin and laminin. Dev Biol 98:212-220. Rosegay H (1944) An experimental investigation of the connections between the corpus striatum and the substantia nigra in the cat. Journal of Comparative Neurology 80:293-321. 85 Rybicki BA, Johnson CC, Peterson EL, Kortsha GX, Gorell JM (1999) A family history of Parkinson's disease and its effect on other PD risk factors. Neuroepidemiology 18:270-278. Scheffler B, Schmandt T, Schroder W, Steinfarz B, Husseini L, Wellmer J, Seifert G, Karram K, Beck H, Blumcke I, Wiestler OD, Steinhauser C, Brustle O (2003) Functional network integration of embryonic stem cell-derived astrocytes in hippocampal slice cultures. Development 130:5533-5541. Shimura H, Schlossmacher MG, Hattori N, Frosch MP, Trockenbacher A, Schneider R, Mizuno Y, Kosik KS, Selkoe DJ (2001) Ubiquitination of a new form of alphasynuclein by parkin from human brain: implications for Parkinson's disease. Science 293:263-269. Silberstein P, Oliviero A, Di Lazzaro V, Insola A, Mazzone P, Brown P (2005) Oscillatory pallidal local field potential activity inversely correlates with limb dyskinesias in Parkinson's disease. Exp Neurol 194:523-529. Singleton AB, Farrer M, Johnson J, Singleton A, Hague S, Kachergus J, Hulihan M, Peuralinna T, Dutra A, Nussbaum R, Lincoln S, Crawley A, Hanson M, Maraganore D, Adler C, Cookson MR, Muenter M, Baptista M, Miller D, Blancato J, Hardy J, Gwinn-Hardy K (2003) alpha-Synuclein locus triplication causes Parkinson's disease. Science 302:841. Smeyne RJ, Jackson-Lewis V (2005) The MPTP model of Parkinson's disease. Brain Res Mol Brain Res 134:57-66. Smith AG, Heath JK, Donaldson DD, Wong GG, Moreau J, Stahl M, Rogers D (1988) Inhibition of pluripotential embryonic stem cell differentiation by purified polypeptides. Nature 336:688-690. Steindler DA, Cooper NG, Faissner A, Schachner M (1989) Boundaries defined by adhesion molecules during development of the cerebral cortex: the J1/tenascin glycoprotein in the mouse somatosensory cortical barrel field. Dev Biol 131:243260. Steindler DA, O'Brien TF, Laywell E, Harrington K, Faissner A, Schachner M (1990) Boundaries during normal and abnormal brain development: in vivo and in vitro studies of glia and glycoconjugates. Exp Neurol 109:35-56. Steindler DA (1993) Glial boundaries in the developing nervous system. Annu Rev Neurosci 16:445-470. 86 Takagi Y, Takahashi J, Saiki H, Morizane A, Hayashi T, Kishi Y, Fukuda H, Okamoto Y, Koyanagi M, Ideguchi M, Hayashi H, Imazato T, Kawasaki H, Suemori H, Omachi S, Iida H, Itoh N, Nakatsuji N, Sasai Y, Hashimoto N (2005) Dopaminergic neurons generated from monkey embryonic stem cells function in a Parkinson primate model. J Clin Invest 115:102-109. Theise ND, Nimmakayalu M, Gardner R, Illei PB, Morgan G, Teperman L, Henegariu O, Krause DS (2000) Liver from bone marrow in humans. Hepatology 32:11-16. Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshall VS, Jones JM (1998) Embryonic stem cell lines derived from human blastocysts. Science 282:1145-1147. Treloar HB, Nurcombe V, Key B (1996) Expression of extracellular matrix molecules in the embryonic rat olfactory pathway. J Neurobiol 31:41-55. Triarhou LC (2002) Biology and pathology of the Weaver mutant mouse. Adv Exp Med Biol 517:15-42. Triarhou LC, Norton J, Ghetti B (1988) Mesencephalic dopamine cell deficit involves areas A8, A9 and A10 in weaver mutant mice. Exp Brain Res 70:256-265. Ungerstedt U (1968) 6-Hydroxy-dopamine induced degeneration of central monoamine neurons. Eur J Pharmacol 5:107-110. Valente EM, Abou-Sleiman PM, Caputo V, Muqit MM, Harvey K, Gispert S, Ali Z, Del Turco D, Bentivoglio AR, Healy DG, Albanese A, Nussbaum R, GonzalezMaldonado R, Deller T, Salvi S, Cortelli P, Gilks WP, Latchman DS, Harvey RJ, Dallapiccola B, Auburger G, Wood NW (2004) Hereditary early-onset Parkinson's disease caused by mutations in PINK1. Science 304:1158-1160. Valldeoriola F, Martinez-Rodriguez J, Tolosa E, Rumia J, Alegret M, Pilleri M, Ferrer E (2002) Four year follow-up study after unilateral pallidotomy in advanced Parkinson's disease. J Neurol 249:1671-1677. Walter BL, Vitek JL (2004) Surgical treatment for Parkinson's disease. Lancet Neurol 3:719-728. Weiss S, Dunne C, Hewson J, Wohl C, Wheatley M, Peterson AC, Reynolds BA (1996) Multipotent CNS stem cells are present in the adult mammalian spinal cord and ventricular neuroaxis. J Neurosci 16:7599-7609. Xu C, Inokuma MS, Denham J, Golds K, Kundu P, Gold JD, Carpenter MK (2001) Feeder-free growth of undifferentiated human embryonic stem cells. Nat Biotechnol 19:971-974. 87 Youdim MB, Ben-Shachar D, Riederer P (1989) Is Parkinson's disease a progressive siderosis of substantia nigra resulting in iron and melanin induced neurodegeneration? Acta Neurol Scand Suppl 126:47-54. Zeng X, Cai J, Chen J, Luo Y, You ZB, Fotter E, Wang Y, Harvey B, Miura T, Backman C, Chen GJ, Rao MS, Freed WJ (2004) Dopaminergic differentiation of human embryonic stem cells. Stem Cells 22:925-940. Zhang Y, Gao J, Chung KK, Huang H, Dawson VL, Dawson TM (2000) Parkin functions as an E2-dependent ubiquitin- protein ligase and promotes the degradation of the synaptic vesicle-associated protein, CDCrel-1. Proc Natl Acad Sci U S A 97:13354-13359. Zipori D (2005) The stem state: plasticity is essential, whereas self-renewal and hierarchy are optional. Stem Cells 23:719-726. BIOGRAPHICAL SKETCH Sean Kearns was born October 29th 1977 in Gainesville, Florida and attended Eastside high school’s International Baccalaureate (I.B.) program where a psychology class sparked his interest in neuroscience. Sean attended the University of Florida and received his degree in neuroscience in 2000. From there he decided to pursue neuroscience in the newly completed McKnight Brain Institute. A fortuitous meeting with Dr. Dennis Steindler led Sean to the new and exciting field of stem cell biology. Sean pursued his Ph.D. doing research relating to Parkinson’s disease and potential therapies using adult and embryonic stem cells. When not in the lab, Sean is an avid Star Wars fan and collector. He also makes time each year to go someplace new to camp, hike, and fish. He shares his home with his lovely wife Debbie, and their two cats Tigger and Starbuck. 88