Download characterization of adult and embryonic stem cell proliferation

CHARACTERIZATION OF ADULT AND EMBRYONIC STEM CELL
PROLIFERATION, DIFFERENTIATION, AND INTEGRATION IN VITRO AND IN A
NIGROSTRIATAL SLICE CULTURE SYSTEM
By
SEAN M. KEARNS
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2006
Copyright 2006
by
Sean M. Kearns
I would like to thank my wife, family and friends without whose help all of this would
not have been possible.
ACKNOWLEDGMENTS
I would like to thank my family (Mom, Dad, and Kelly) for all the love and support
they have given me growing up. I thank my friends for all the good times that made life
worth living. I would also like to thank Dr. Dennis Steindler, Dr. Eric Laywell, and the
rest of the Steindler and Laywell labs for teaching me how to do science, and for helping
me to find why I do science. Finally I thank my wife Debbie. Her love and support have
made me complete, and I am eternally grateful that she is a part of my life.
iv
TABLE OF CONTENTS
page
ACKNOWLEDGMENTS ................................................................................................. iv
LIST OF FIGURES .......................................................................................................... vii
ABSTRACT....................................................................................................................... ix
CHAPTER
1
STEM CELL BIOLOGY..............................................................................................1
Stem Cell Characterization ...........................................................................................1
Embryonic Stem Cells ..................................................................................................2
Adult Stem Cells...........................................................................................................4
Adult Neural Stem Cell Differentiation........................................................................6
Stem Cell Niches and Extracellular Matrix ..................................................................7
2
PARKINSON’S DISEASE ..........................................................................................9
Overview and Anatomy................................................................................................9
Genetic Links To Parkinson’s Disease .......................................................................11
Alpha-Synuclein Mutations.................................................................................11
Parkin Mutations .................................................................................................13
PTEN Induced Kinase-1 Mutations.....................................................................14
Environmental Links To Parkinson’s Disease............................................................14
Rural Living Conditions ......................................................................................14
Pesticides and Parkinson’s Disease .....................................................................15
Heavy Metal Exposure and Parkinson’s Disease ................................................16
Modeling Parkinson’s Disease ...................................................................................17
Current Therapies for Parkinson’s Disease ................................................................18
Pharmacological Therapies .................................................................................18
Surgical Therapies ...............................................................................................19
Cell Replacement Therapies................................................................................19
3
MATERIALS AND METHODS ...............................................................................22
Neurosphere Culture and Asteron Cell Characterization ...........................................22
Generation of Neurospheres ................................................................................22
Differentiation and Immunolabeling of Spheres .................................................22
v
In Situ Hybridization with GFAP cDNA.............................................................23
Analysis of Cell Death.........................................................................................24
Electrophysiology................................................................................................25
ECM Effects on Neurosphere Migration....................................................................26
Slice Culture Preparation............................................................................................27
6-Hydroxy Dopamine Nigrostriatal Lesions .......................................................27
Embryonic Stem Cell Neural Precursor Transplants...........................................28
Immunocytochemistry and Quantification ..........................................................28
Electrophysiology of Slice Culture Transplants..................................................29
4
RESULTS ...................................................................................................................31
Neural Stem Cell Differentiation and the Asteron Phenotype....................................31
Combination of Asteron Markers........................................................................32
Analysis of Cell Death.........................................................................................32
Physiological Properties of Hybrid Asterons ......................................................33
Extracellular Matrix Influence on Neurosphere Migration ........................................34
Nigrostriatal Slice Culture ..........................................................................................36
6-Hydroxy Dopamine Lesions of Nigrostriatal Slice Cultures ...........................37
Real Time Analysis of Nigrostriatal Degeneration .............................................38
Nigrostriatal Slice Culture Applications.....................................................................38
Embryonic Stem Cell Neural Precursor Transplants into Nigrostriatal Slice
Cultures ............................................................................................................39
Embryonic Stem Cell Neural Precursor Integration and Maturation in Slice
Cultures ............................................................................................................39
Dopaminization of Transplantable Cell Populations..................................................40
Dopamine Neuron Generation from ESNP Culture In Vitro...............................40
Dopamine Neuron Generation from ESNP Cultures in Slice Culture ................40
Dopaminization of Adult Stem Cell Cultures .....................................................41
5
DISCUSSION AND CONCLUSIONS ......................................................................67
LIST OF REFERENCES...................................................................................................77
BIOGRAPHICAL SKETCH .............................................................................................88
vi
LIST OF FIGURES
Figure
page
4-1. Combined β-III tubulin and GFAP immunolabeling reveals the temporal
progression of the asteron phenotype.......................................................................42
4-2. Antibodies against β-III tubulin and GFAP reveal three immunophenotypes, and
label separate sub-cellular elements within asterons................................................43
4-3.
Asterons co-express β-III tubulin with S100β, and transcribe GFAP mRNA. .......44
4-4. Asteron appearance corresponds with neuronal reduction that is not attributable
to apoptotic cell loss.................................................................................................45
4-5. Caspase 3 analysis of cell death accords well with TUNEL data. ...........................46
4-6. Physiology of neurons, astrocytes, and asterons. .....................................................47
4-7. Phenotype immunostaining of neurosphere derived cells. .......................................48
4-8. Velocity plot of neurosphere derived cells on different ECM substrates..................49
4-9. Migration distances of neurosphere derived cells on ECM substrates.....................50
4-10. Neurosphere derived cell migration patterns and measurements. ...........................51
4-11. Slice culture viability and nigrostriatal circuit maintenance. ..................................52
4-12. 6-Hydroxy Dopamine lesion of nigrostriatal slice cultures.....................................53
4-13. Nova-red staining of TH reveals control and lesioned nigrostriatal circuitry.. .......54
4-14. Cytoarchitectural changes in 6-OHDA lesion slice.................................................55
4-15. Nova-red labeling of striatal TH shows effect of exposure to 6-OHDA. ...............56
4-17. Real time analysis of TH-GFP.................................................................................58
4-18. ESNP transplants into slice cultures........................................................................59
4-19. Long term ESNP transplants in slice cultures. ........................................................59
vii
4-20. Laminin enhances ESNP migration through slice cultures After 6 days in
cultures.. ...................................................................................................................60
4-21. Laminin enhances process outgrowth of ESNP’s in slice cultures. ........................60
4-22. Green fluroescent protein Positive ESNP striatal transplant.. .................................61
4-23. Electrophysiological Characterization of Transplanted Cells. ................................62
4-24. ESNP’s located near the substantia nigra. ...............................................................62
4-25. Increase in TH+ neurons derived from ESNP’s exposed to ventralizing agents.....63
4-26. In vitro ESNP dopaminization.................................................................................63
4-27. Dopaminized ESNP’s implanted into slice cultures................................................64
4-28. Adult neural stem cells exposed to dopaminzing cytokines express TH. ...............65
4-29. Induced TH+ adult stem cells. Adult neural stem cells exposed to FGF8, SHH,
and pleiotrophin........................................................................................................66
viii
Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy
CHARACTERIZATION OF ADULT AND EMBRYONIC STEM CELL
PROLIFERATION, DIFFERENTIATION, AND INTEGRATION IN VITRO AND IN A
NIGROSTRIATAL SLICE CULTURE SYSTEM
By
Sean M. Kearns
August 2006
Chair: Dennis A. Steindler
Major department: Medical Sciences—Molecular Cell Biology
Stem cell therapy holds great promise in repairing brain damage caused by
neurodegenerative diseases, such as Parkinson’s disease. To fully use these cells, a better
understanding is needed of the mechanisms and processes that control their proliferation,
migration, and differentiation. Our study used both in vitro and slice culture techniques to
examine adult neural and embryonic stem cells. Our initial experiments showed that adult
neural stem cells can generate hybrid cells (asterons) in culture. These asterons appear to
be hybrid cells that express both markers of immature neurons and astrocytes, and appear
to be the result of transdifferentiation from a neuron to an astrocyte.
We also examined the effects of different extracellular matrix molecules on the
migration of adult neurosphere derived cells. Our results showed that laminin and
fibronectin are permissive for migration and enhance outgrowth. In contrast, chondroitin
sulfate proteoglycan inhibits migration and impedes outgrowth.
ix
Finally, to better assess stem cell integration into the central nervous system, we
devised a novel slice-culture system that recreates the degeneration seen in Parkinson’s
disease. Using this slice culture model, we showed that ES cell-derived neurons can
survive in culture, and integrate synaptically. We also were able to dopaminize these ES
derived neurons and show that they maintain their dopamine phenotype in the slice. To
enhance transplant integration, we examined the effect of adding extracellular matrix to
the cell transplant. Our results suggest that laminin enhances the integration of these cells
into the slice.
Our study examined the plasticity of adult and embryonic stem cells in culture
and showed that these cells are responsive to environmental factors that interact with
their differentiation and migration. Development of a slice culture model system that
recreates the neuronal environment allows the development and future use of transplant
enhancements for stem cell grafts into the brain.
x
CHAPTER 1
STEM CELL BIOLOGY
Stem Cell Characterization
To understand the potential of using stem cells, one must first understand what a
stem cell is. A variety of definitions have been proposed, but a common set of terms and
properties emerged that serves as a starting point. By focusing on embryonic stem cells
and neural stem cells we compared and contrast the two most common “types” of stem
cells: embryonic and adult stem cells.
The minimal definition of a stem cell is a cell that can divide to renew itself and
give rise to a more committed progenitor (Morrison et al., 1997). Some argued that
self-renewal may be present in mature cell types (e.g., lymphocytes) and have pushed for
a definition based on the plasticity of the stem cell (Zipori, 2005). Those against
self-renewal as a stem cell trait argue that plasticity is the main defining characteristic
separating stem cells from other types of cells. A stem cell functions to generate mature,
committed cell types to create or repair tissues and organs. Embryonic stem cells (ES) in
vivo contribute to all body tissues when implanted into a blastocyst (Bradley et al., 1984).
In vitro ES cells have been shown to create almost all of the mature cell types found in
the body (Keller, 1995; Draper and Andrews, 2002). Adult stem cells have been found in
most adult tissues and organs. Functionally they are an integral part of normal operation
of the system (e.g., the hematopoitic and nervous system) or they play a role in tissue
repair and regeneration (e.g., the hepatic system). Evidence also shows that adult stem
cells (whose in vivo distribution is limited to their target tissues) may in vitro be capable
1
2
of transdifferentiating into other types of mature adult cells. This potential is still
controversial and may not exist in all adult stem cell types, but it further argues that
stemness is a function of its plasticity, and not its renewal capability. While still under
debate, self renewal and plasticity are likely both key components of a stem cell
definition. More information about stem cell functions will refine their definition.
Embryonic Stem Cells
Embryonic stem cells (ES) are derived from the intracellular mass (ICM) of a
developing blastocyst. This region of the blastocyst gives rise to all of the cell types
found in the adult organism. ES cells were first derived from rodents and were shown to
be pluripotent (Bradley et al., 1984). Human ES cells were generated later and were
shown to have properties similar to those of rodent ES cells, while requiring a different
set of culture conditions (Thomson et al., 1998). The primary focus for ES cells has been
keeping them undifferentiated in long-term cultures, and in the exact protocols needed to
differentiate ES cells into adult cell types in an easy and reliable manner. Mouse ES cells
initially had to be grown on mouse fibroblast feeder layers to remain undifferentiated.
Further studies identified leukemia inhibitory factor (LIF) as one of the primary
molecules secreted by feeder-cell layers that maintained ES cells in their undifferentiated
state (Smith et al., 1988). With the discovery of LIF as a mediator of differentiation,
downstream transcriptional targets of LIF were identified that appear to regulate the
pluripotency of ES cells. Transcription factors such as Nanog and Oct3/4 were found to
be expressed in ES cells, and their expression decreased as cells differentiated into
mature phenotypes (Niwa et al., 2000; Chambers et al., 2003) .
Human ES cells (hES) have been shown to behave slightly differently from rodent
ES cells. Human ES cells do not maintain a pluripotent state when treated with LIF,
3
though hES cells can be maintained on feeder layers, or on laminin-coated culture plates
when fed with feeder-layer conditioned media (Thomson et al., 1998; Xu et al., 2001).
The use of feeder layers was questioned because of the possibility of cross-contamination
from animal cells. Recent evidence suggested the presence of a rodent
glycopolysacarrhide in hES cultured on mouse feeder layers (Martin et al., 2005). This
foreign molecule could induce an immune response to these cells that would likely kill
them if transplanted. Research on feeder layer and conditioned media-free cultures shows
promising results, suggesting that hES cells can be maintained in an environment that
minimizes cross contamination.
Differentiation of ES cells can be performed in a few ways. One way is to culture ES
cells in an aggregate colony form, known as embryoid bodies (EBs) (Keller, 1995). The
EBs can be maintained in culture for some time, and provide cell-cell interactions
important for ES cell survival. The EBs can be plated to generate a monolayer of cells
that can be treated with various cytokines and other factors to induce a specific lineage in
the cells. For example, ES cells can be induced to a neuroectoderm lineage through a
sequential EB culture protocol that adds (then removes) serum from the cultures, and
allows the EBs to attach and generate a monolayer (Okabe et al. 1996). All three major
neural cell types (neurons, astrocytes, and oligodendrocytes) can be produced from ES
cell cultures, and in relatively pure populations. Further manipulations of neuronal
cultures can yield subtypes of neurons, such as dopaminergic or GABAergic neurons.
Dopaminergic neuron generation is being heavily studied as a possible way to replace the
neurons lost in Parkinson’s disease. (Jung et al., 2004; Zeng et al., 2004; Takagi et al.,
2005) provided a working paradigm for efficient generation of dopamine-producing
4
neurons, and provides a useful example of how ES cell manipulation is carried out. The
initial protocol relied on treating ES cells with cytokines, such as sonic hedgehog and
FGF8, that have been linked to endogenous dopamine cell generation during
development.
Adult Stem Cells
Unlike ES cells, which are generated from the inner cell mass of a developing
blastocyst, adult stem cells have been isolated from numerous adult tissue types,
including brain, bone marrow, liver, and skin (Weiss et al., 1996). Like ES cells, adult
stem cells are capable of asymmetric division, producing a relatively undifferentiated
copy of themselves, and a more-committed daughter cell. Initial isolation and
characterization of these adult stem cells showed them to be multipotent, capable of
giving rise to only certain cell types of the tissue they were isolated from. Further studies
introduced the idea that under certain conditions, these cells could transdifferentiate, or
turn into mature cells from other tissue types (Brazelton et al., 2000; Theise et al., 2000;
Ianus et al., 2003). These findings remain controversial, but evidence supports at least a
limited potential for adult stem cell transdifferentiation. Because so many tissues appear
to have adult stem cells associated with them, we have limitd the scope of this overview
to discussing adult neural stem cells.
Stem cells in the CNS have been hypothesized for more than 4 decades. Evidence
of neurogenesis in rodent hippocampus was described by (Altman and Das, 1965, 1966;
Altman, 1969a, b). They described postnatal neurogenesis and suggested that
undifferentiated cells existed within the mature CNS; and that they gave rise to new
neurons, and to new glial cells. The early 1990s began a push to isolate and expand the
neural stem cell. A key discovery was the primary niches of adult neural stem cells
5
(NSCs): the subventricular zone (SVZ) of the lateral ventricles and the subgranular layer
of the hippocampus. (Lois and Alvarez-Buylla, 1993; Kuhn et al., 1996). The SVZ stem
cells generate new neuron progenitors that migrate along the rostral migratory stream to
the olfactory bulb, where they integrate into the periglomerular and granule cell layers of
the olfactory bulb in the rodent. When cells from these regions were cultured in clonal
conditions with suitable growth factors, they gave rise to a sphere that contained both
stem cells and lineage-restricted progenitor cells. Later studies of these cells from the
SVZ, cultured as neurospheres, identified a multipotent astrocyte as the neural stem cell
(Doetsch et al., 1999b; Laywell et al., 2000).
In the SVZ a dynamic relationship exists between NSCs and more restricted
progenitors. Early experiments on rodents found several different cell types in the SVZ
(Doetsch et al., 1999a): the B cell, the multipotent astrocyte stem cell (NSC), the C cells
(a rapidly dividing precursor cell), and the A cell (a restricted neuronal progenitor cell).
Evidence for this model came from studies using cytosine arabinoside (Ara-C) to kill
rapidly proliferating cells in the SVZ. Examining which cells were killed by Ara-C
allowed the relative cell-cycle times of SVZ cell types to be established. The C cells
showed the shortest cell-cycle time and were almost completely destroyed by Ara-C
treatment. Type A cells also were almost completely eliminated by the treatment. Type B
cells showed the least effect from Ara-C treatment. After only 2 days, regeneration of cell
types had begun. After 4.5 days, A and C cells were almost at normal levels. In addition,
giving a second treatment of Ara-C during this regenerative period killed a large number
of the B cells, which had been activated and were dividing to try and reconstitute the
SVZ, and led to no significant regeneration of the cell types in the SVZ.
6
This evidence of postnatal neurogenesis mediated through NSCs brought a great push
to harness this innate potential to regenerate damaged regions in the brain. Currently
there is no evidence that massive regeneration occurs in the CNS as a result of lesion or
injury (Rakic, 1985). Some evidence suggests that endogenous stem cell populations
contribute to repair in damaged regions such as the cortex (Magavi et al., 2000).
However, this repair seems limited to small, specific lesions that do not create large glial
scars, or large amounts of cell necrosis or apoptosis. Additional debate centers on
whether neurogenesis occurs in regions outside the olfactory bulb and hippocampus.
Reports of neurogenesis in the adult monkey (Gould et al., 1999) suggested that primates
and possibly humans might generate new neurons in their cortex. However, evidence for
this was challenged, based on confocal analysis that suggested cells appearing to be
newly generated neurons were actually a neuron closely associated with a satellite glial
cell (Kornack and Rakic, 2001)
Adult Neural Stem Cell Differentiation
By definition, the NSC must be able to generate the three distinct cell types of the
central nervous system; neurons, astrocytes, and oligodendrocytes. Microglial cells,
although restricted to the CNS, are believed to be developmentally derived from the
hematopoietic system and do not constitute a neural lineage. On plating, NSCs have been
observed to give rise to the three neural cell types. What remains poorly understood is the
mechanisms of this differentiation and how static the process is. Recent evidence in the
CNS suggested that cells exist along a continuum of differentiation, and that cell groups
are much more fluid than previously proposed. This idea is supported by the life cycle of
the NSC, which initially exists as a type of specialized astrocyte that (through cell
division and differentiation) can give rise to neurons. Our results also suggest that
7
neuronal cells derived from these NSCs are in a state of phenotypic flux and may turn
from neuronally committed to glial cells in vitro (Laywell, 2005).
Stem Cell Niches and Extracellular Matrix
An important concept in stem cell biology is that of the stem cell niche. Basically
it suggests that the stem cell is able to perform its function, because of its environment,
and the physical and biochemical cues from this niche influence cell division,
differentiation, and migration. The niche first came to prominence in the hematopoietic
stem cell (HSC) field, where the composition of bone marrow was found to play an active
role in HSC function. Research on niches in regard to neural stem cells has focused on
the extracellular matrix comprising the SVZ and RMS, and the cytokines and signaling
molecules that target this region. The extracellular matrix (ECM) environment of the
central nervous system (CNS) is responsible for a large number of regulatory functions
both during development and adulthood. The ECM provides signals for cell growth,
differentiation and migration (Novak and Kaye, 2000; Steindler, 1993; Steindler et al.,
1990). These activities are critical for the development of CNS organization, and
disruptions of ECM interactions can cause severe developmental defects (Novak and
Kaye, 2000). During CNS histogenesis, ECM defines functional boundaries for cells
(Steindler, 1993; Steindler et al., 1989) and is involved in signaling after injury (Laywell
et al., 1992). Permissive substrates for neurosphere differentiation may underlie
migratory pathways, whereas non-permissive substrates may mark more sedentary cell
zones. In the SVZ stem cell niche the ECM, composed primarily of tenascin and
chondroitin sulfate proteoglycans (CSPG), is believed to act as a barrier, keeping the
NSC in the SVZ. This ECM composition is set up late in embryonic development and is
persistent throughout the life of the animal. During early development the presence of the
8
dense ECM may allow the niche to remain undisturbed through development and prevent
axons from innervating the region, and possibly degrading the ECM matrix (Gates 1993,
1995, Steindler 1993). CSPG’s are known to be present in other regions of the CNS and
function in axon guidance by restricting axon growth to inappropriate targets (Treloar et
al., 1996), and the CSPG versiscan, has been shown to inhibit migration of neural crest
cells (Landolt et al., 1995). Treatment with enzymes that degrade these CSPG’s has been
shown to be beneficial in axon regrowth in CNS injuries (Bradbury et al., 2002). In
addition circuits where the region has been depleted of glial cells show an increased in
the amount of axon regrowth they experience. This is believed to be the result of a
decrease in scar formation and a decrease in glial elements that inhibit axon growth
(Moon et al., 2000).
In contrast, laminin and fibronectin are known to be potent permissive substrates
for a variety of cell types in vitro, including cerebellar and SVZ derived neurospheres
(Kearns, 2003). Neither fibronectin nor laminin are present in high levels in the adult
animal; however, fibronectin knockout animals demonstrate neural tube abnormalities
that are embryonic lethal (George, 1993). Laminin has been shown to be present in the
developing cerebellum and acts as a permissive migratory substrate for granule cell
precursors to migrate from the external granule cell layer into the internal granule cell
layer (Pons et al., 2001). Laminin has been shown to enhance neurite elongation of
cultured neurons (Rogers et al., 1983) and to increase the integration and regeneration of
cells within injury sites (Grimpe et al., 2002). Slice co-culture transplants with laminin
have been reported to enhance the ability of fetal dopaminergic neurons to reconstruct a
damaged nigrostriatal circuit in adult rats (Dunnett et al., 1989).
CHAPTER 2
PARKINSON’S DISEASE
Overview and Anatomy
Parkinson’s disease (PD) has classically been defined as a progressive
neurodegeneration of the nigrostriatal circuit. Clinically this presents as a whole body
tremor, rigid posture, racheting motion of the limbs, dysphagia, and in late stage cases a
loss of voluntary motor control and movement . The demographics for PD are heavily
skewed towards the elderly, except in specific familial cases where the gene mutations
can cause a significant decrease in the age of onset.
The disease was first reported in the medical literature by James Parkinson in
1817, and described as the shaking palsy (Parkinson, 1817). Later the clinical anatomy
and lesion were discovered that underlie the disease. Rosegay was the first to
conclusively label and demonstrate a circuit that originated in the substantia nigra and
terminated in the striatum using a feline model (Rosegay, 1944). Anden et al were the
first to demonstrate that dopamine was the primary neurotransmitter released into the
striatum from the axons of neurons in the SNc (Anden et al., 1964; Anden et al., 1965;
Anden et al., 1966). The loss of SNc cells, the only observable lesion seen in Parkinson’s
patients, led them to correctly hypothesize that the symptoms of Parkinson’s were a direct
result of the loss of dopamine neurotransmission from the SNc to the striatum.
Pathologically, PD is associated with the significant loss of the SNc fibers running to the
striatum, and the atrophy of the cells bodies within the SNc. Another notable pathology is
9
10
the formation of intracellular protein aggregates seen within SNc cell bodies, termed
Lewy bodies. These cytoplamsic inclusions are seen in several different neurological
conditions, but when closely associated with the SNc are hallmarks of PD (Gibb and
Lees, 1988).
The nigrostriatal circuit is an important component of the voluntary motor
pathway in the central nervous system. Information from the motor cortex is sent to the
striatum. From the striatum it is sent to the globus pallidus then to the thalamus where it
is processed and from the thalamus goes to the motor cortex to be sent through the
corticospinal tract. The overall output from the SNc to the striatum is inhibitory. The
more inhibited the SNc causes the striatum to become, the less inhibitory and more
excitatory the globus pallidus becomes. This feedback loop of inhibitory and excitatory
circuitry allows for voluntary motor movements to proceed smoothly (Blandini et al.,
2000). In the case of Parkinson’s disease the degeneration of the SNC causes a loss of
inhibitory output to the striatum. This loss of inhibition causes the striatum to send a
stronger inhibitory signal to the external globus pallidus (eGP). The inhibition of the eGP
causes the subthalamic nucleus (STN) to send a stronger excitatory signal to the internal
globus pallidus (iGP). The iGP normally sends an inhibitory signal to the thalamus. In
Parkinson’s this inhibitory signal is much stronger, due to the increased excitatory signal
from the STN, and the motor pathways in the thalamus are thus inhibited, resulting in the
difficulty initiating voluntary motor movement (Albin et al., 1995).
The underlying molecular causes of PD are still being debated. What is
established is that there are both environmental and genetic risk factors that are
associated with the development of PD. Rare familial forms of PD have been studied that
11
have allowed scientists to better understand what mutations and biochemical effects may
be linked to PD. Epidemiological data has also been collected that points to
environmental toxins, such as pesticides and heavy metals, that appear to increase the
chances of developing PD.
Genetic Links To Parkinson’s Disease
A variety of genetic studies have been performed to ascertain genes that play a role in
causing or predisposing an individual to PD. Three of the most prevalent mutations are
alpha-synuclein, Parkin, and PINK1 (Gasser, 2005). Each of these genes has been found
to be abnormal in a large number of familial PD patients, or those with a clearly defined
genetic linkage to the disease. All of these mutations share a common link in the
ubiquitin-proteosome pathway. This pathway is involved in the targeting and degrading
misfolded or damaged proteins within the cell and is a critical part of the intracellular
machinery. Dysfunctions in the proteosome pathway are believed to induce a state of
oxidative stress within the cell and lead to abnormal protein aggregation, like the Lewy
bodies seen in PD. The role of these aggregates is unclear, some believe them to be a
defense mechanism that the cell uses to isolate abnormal proteins, but many others
believe that the aggregates themselves cause an increase in free radicals that can overload
the cell with oxidative stress and induce programmed cell death or apoptosis.
Alpha-Synuclein Mutations
Alpha-synuclein is perhaps the best studied mutation in PD. It was first identified as
the root cause of familial PD in a kindred in Italy, and has since believed to be isolated to
a founder mutation that originated in Greece (Polymeropoulos et al., 1997). Patients with
this mutation display many of the same characteristics as those suffering from sporadic
PD, including the formation of Lewy bodies in the SNc, and responsiveness to levodopa.
12
The key feature that separates this familial form from sporadic is the early age of onset
which is around 46 years, compared to the average age of onset for sporadic which is
around 62 years (Pankratz and Foroud, 2004).
At the molecular level alpha-synuclein is believed to act as a lipid binding protein that
plays a role in neurotransmitter vesicle release and recycling, as well as synaptic
plasticity. In familial forms of PD linked to alpha-synuclein mutations, the mutated
protein folds abnormally and generates Lewy bodies, the protein aggregates seen in PD.
Several different mutations have been identified in the alpha-synuclein gene, most of
which are point mutations that alter a single amino acid in the protein and cause protein
misfolding. Recent reports of duplication and triplication of the wild type alpha-synuclein
gene have linked these mutations to the development of PD (Singleton et al., 2003). This
is an important finding, since it reinforces the data showing that Lewy bodies in sporadic
PD are composed mostly of aggregated alpha-synuclein. Here we see the intersection of
environmental and genetic factors that may play a role in the development of PD. If wild
type alpha-synuclein is more susceptible than other proteins to environmental agents that
cause protein misfolding, then it represents a common target for therapeutics against
protein misfolding related degenerative diseases. Recent studies looked at
alpha-synuclein polymorphisms that may underlie sporadic PD (Pals et al., 2004). Unlike
familial cases there is no clear genetic link or clearly identified protein abnormality in
sporadic cases. However some reports have suggested that polymorphisms in the
alpha-synuclein gene may predispose individuals to develop PD. One recent study
reported that there was a specific haplotype in the alpha-synuclein gene that appeared to
increase the risk of developing PD 1.4 times in heterozygotes, and twice as likely in
13
homozygotes (Mueller et al., 2005). The mechanism underlying this predisposition is still
not understood, but further study on polymorphisms in PD related genes is one of the
most important areas in PD research.
Parkin Mutations
A common theme in the genetics of PD is the relationship the genes have with the
misfolded protein response and the proteosome pathway. Alpha-synuclein appears to
interfere with the proteosome pathway by overloading it with too much aggregated
mutant protein. Another proteosome pathway protein, parkin appears to be the most
frequently mutated protein in familial PD with some estimates suggesting it may be the
cause of 50% of early onset familial PD (Lucking et al., 2000). Parkin is a ubiquitin
ligase, responsible for attaching ubitquitin molecules to proteins to target them for
degradations (Zhang et al., 2000). The exact molecular mechanism by which parkin
mutations may cause degeneration is unknown, but current research suggests that
mutations in parkin decrease its ability to targets proteins for degradation. Without this
targeting the cellular machinery is unable to degrade proteins and they can accumulate
and form aggregates. One of the primary proteins targeted by parkin for degradation is
alpha-synuclein (Shimura et al., 2001). What is unusual about most cases of familial PD
associated with parkin mutations is the relative lack of Lewy body inclusions. This led
some to suggest that parkin mutations act through an alternate pathway to induce SNc
degeneration without Lewy body formation. Recent studies have implicated the JNK
mediated apoptsis pathway. Under this paradigm, mutations in parkin cause an increase it
parkin substrates, which could induce cellular stress and activate the JNK pathway. In
addition the activation and control of JNK effects may be directly regulated by
14
ubiquititination through parkin, and the loss of parkin could cause upregulate the
apoptotic effects of JNK (Cha et al., 2005).
PTEN Induced Kinase-1 Mutations
PTEN induced kinase-1 (PINK1) is a relatively new genetic mutation identified in
early onset familial PD. While it only accounts for 1-2% of the early onset cases, PINK1
is being studied intently due to its biochemical functions. (Valente et al., 2004). Analysis
of the PINK1 gene product has revealed a mitchocondrial protein that appears to function
in oxidative stress response. A recent report found that PINK1 appears to mediate
cytochtome c release from the mitochondria, which is an important apoptotic signal (Petit
et al., 2005). When cells were transfected with a mutant from of PARK1, which destroys
the kinase activity of the protein and is known to exist in PD patients, they noted a
significant increase in basal and induced levels of apoptosis in the mutant cells compared
to controls. This is another finding that links the development of PD to alternations in the
cells ability to deal with oxidative stress. The fact that PINK1 is localized to the
mitochondria has implications for certain environmental toxins related to PD. Many of
the chemicals that are experimentally used to make PD models act by interfering with
mitochondrial function and induction of oxidative stress and apoptosis (Ungerstedt, 1968;
Jenner, 2003; Kress and Reynolds, 2005). While there are no reports on polymorphisms
associated with PINK1, a reduction in the capacity to deal with mitochondrial insults
from an environmental exposure could be a factor in developing PD.
Environmental Links To Parkinson’s Disease
Rural Living Conditions
Since most PD cases are late onset, sporadic instances, it is clear that genetics
does not dictate the entire risk potential of developing PD. With the advent of
15
epidemiological studies of PD patients it has become clear that there are environmental
risk factors that exist which increase the chances of developing PD (Lai et al., 2002). In
addition the development of animal models of PD, based on toxins has opened up new
avenues, not only in studying how to treat the disease, but how environmental stresses
can lead to neurodegeneration. The majority of the studies in the past 50 years have
looked at a small set of epidemiological factors that may play a role in PD. Living
location, especially rural or urban, has become a widely studied variable as a risk factor
for PD. An analysis of studies done on rural living showed that 7 out of 20 showed a
significant positive correlation between living in rural areas and an increased risk of
developing PD. The rest found either no correlation, or an insignificant one. While far
from definitive proof, at least some evidence exists that rural living may increase the
chance of developing PD (Lai et al., 2002).
Pesticides and Parkinson’s Disease
One of the primary reasons that rural living was suspected as playing a role in the
development of PD, was the discovery that exposure to pesticides has been shown
increase the risk of PD. A meta-analysis of 19 pesticide exposure studies concluded that
there was a significant positive association between pesticide exposure and risk of PD
(Priyadarshi et al., 2000). This has been further reinforced by experimental studies that
have linked the pesticide rotenone to dopamine neuron toxicity. Rotenone is a known
mitochondrial complex I inhibitor that induces apoptosis, and it has been showed that
chronic rotenone exposure in rodents caused a selective degeneration in dopamine
neurons and induced formation of intracellular inclusions similar to Lewy bodies
(Greenamyre et al., 2003; Betarbet et al., 2005). One likely scenario is that rural living
16
typically involves drinking water from a well. Pesticides leaching into the soil and into
the well water presents a likely delivery mechanism for human exposure to pesticides.
Heavy Metal Exposure and Parkinson’s Disease
Another positive, although contested, association exists between heavy metal
exposure and PD. One study found a positive correlation between workers that had 20 or
more year’s exposure to copper or manganese and development of PD (Gorell et al.,
1997). However another study, using the same group as above, found that this increase
was broken down among those with a family history of PD and those without (Rybicki et
al., 1999). Another study found that 30 or more years exposure to lead, aluminum, and
manganese increased the incidence of PD, independent of family history (Lai et al.,
2002). Iron exposure has become an important research direction in PD due to a better
understanding of the type of free radical damage prevalent in the SNc. Dopamine is a
relatively unstable molecule that breaks down, generating free radicals. In addition the
substance that gives the SNc its distinctive black hue, neuromelanin, is high in iron
content (Youdim et al., 1989; Linert et al., 1996; Hirsch and Faucheux, 1998; Castellani
et al., 2000; Gerlach et al., 2003). Iron has been shown to catalyze what is known as the
Fenton reaction, which generates hydroxyl radicals. These radicals have been shown to
induce DNA damage and to induce apoptosis in exposed cells. There is mounting
evidence that the increased iron in the SNc may lead to an increase in Fenton derived free
radicals that could be responsible for the neurodegeneration pattern seen in PD. Some of
the other metals suspected, have also been linked to free radical generation or a reduction
in the ability to scavenge them. This evidence, while not conclusive, does suggest that
heavy metal exposure may at the least increase the oxidative stress that the SNc is under.
17
Modeling Parkinson’s Disease
Currently most PD research is performed in isolated cell-culture models or in
animal models, using either toxic lesions or genetic mutant animals. Isolated cell cultures
allow for an easily controlled environment where variables such as toxin exposure or
mutated proteins can be observed and easily manipulated. The development of SNc
cultures allowed the work being done in cell cultures to help define and profile the at-risk
cell populations. Isolated cell cultures are also often the first step in examining whether a
chemical or genetic lesion is effective in causing cell death in SNc cells, and examining
the effectiveness of therapies in preventing cellular degeneration.
Unfortunately isolated cell cultures do a poor job of recreating the actual
physiological environment that the cells would normally be found in. Animal models of
PD focused on rodent and primate models that mimic the degeneration seen in human PD
cases. Most of the work is performed on rodents using toxin models that induce
degeneration in the nigrostriatal circuit (Gerlach and Riederer, 1996). Compounds such
as 6-hydroxy dopamine (6-OHDA) and MPTP specifically target the nigrostriatal circuit
and destroy the cells (Ungerstedt, 1968; Heikkila and Sonsalla, 1992; Glinka et al., 1997;
Smeyne and Jackson-Lewis, 2005). Unfortunately these models do not recreate the
progressive nature of PD and lack some of the pathological hallmarks of PD, such as
lewy bodies. A new method using general proteosome inhibitors, such as lactacyctin,
have shown promise in animal models of causing a progressive loss of nigrostriatal
neurons with evidence of lewy bodies in cells (McNaught et al., 2002).
Slice culture models, like that presented here, allow for a bridge between in vivo
and in vitro technologies. The ability to generate mid sagittal slices that contain the
nigrostriatal circuit has allowed for modeling of Parkinson’s using the endogenous at risk
18
population of neurons within their neuronal environment, but with the accessibility ability
to observe and manipulate of in vitro cultures (Kearns, 2006).
Current Therapies for Parkinson’s Disease
Pharmacological Therapies
The current state of PD treatments lies in either pharmacological intervention,
typically in early stage PD, and later in a variety of neurosurgical treatments. Neither of
the current therapies serves to slow or reverse the cellular degeneration, but instead rely
on enhancing the existing dopaminergic signal to compensate or removing inhibitory
influences on the circuit to enhance the message. Pharmacological treatment is led by Ldopa administration. L-dopa is a precursor to dopamine that is able to cross the blood
brain barrier and can be converted using aromatic acid decarboxylase into dopamine
(Joseph et al., 1978; Olanow et al., 2004). This is a dramatic treatment, since it instantly
increases the amount of dopamine present in the nigrostiatal circuit and can initially
reverse most of the motor deficits seen in PD. However L-dopa has a serious problem in
its long term usage. Patients become non-responsive to L-dopa, usually within 5-10
years, and during an OFF phase with L-dopa, the symptoms can return, and even when
the drug is working during an ON phase, their can be abnormal hyperactive motor
movements and muscle tension (Deane et al., 2004; Brotchie et al., 2005).
L-dopa is still considered a first use drug, but the search for other more effective
pharmacological options is proceeding. Several other classes of drugs that have been
suggested or tried, include dopamine reuptake blockers, to keep dopamine in the synapse
longer and enhance its ability to signal, and drugs that prevent the enzymatic breakdown
of dopamine to keep it active longer (Johnston and Brotchie, 2004). These drugs have had
19
therapeutically relevant effects, but due to the progressive nature of PD, their efficiency
decreases with the increase in cellular degeneration.
Surgical Therapies
Surgical intervention for PD preceeded the development of pharmacological
intervention strategies by several decades. Until L-dopa was used, the standard treatment
for those willing to undertake it was a surgical lesion of the globus pallidus (Ansari et al.,
2002; Valldeoriola et al., 2002; Walter and Vitek, 2004). As outlined previously, the
globus pallidus sends an inhibitory output to the striatum, as part of the feedback
mechanism of the basal ganglia. A lesion of the globus pallidus removes this inhibitory
output, and effectively enhances the excitatory signal from the SNc to the striatum. More
recently, surgical interventions have begun to use deep brain stimulators in an attempt to
block inhibitory outputs to the striatum in an effort to enhance the SNc excitation to the
striatum (Lozano and Eltahawy, 2004; Diamond and Jankovic, 2005; Lyons and Pahwa,
2005). Deep brain stimulation’s precise mechanism of action is not clearly understood,
but it is believed that the electrical impulses either induce a depolarizing block on the
cells, preventing them from firing, or the electrical impulses may desynchronize electrical
oscillations present in basal ganglia loops. Abnormal oscillations in firing patterns have
been theorized to underlie the abnormal motor movements in the PD, and may also be
present during ON medication phases, explaining side effects such as dyskinesia
(Silberstein et al., 2005).
Cell Replacement Therapies
A recent addition to the therapeutic options for PD, has been cell replacement therapy.
This approach seeks to replace, using stem cells or fetal progenitors, the lost
dopaminergic SNc neurons. Initial experiments performed in the late 1980’s showed
20
proof of principle for cell replacement strategies and had promising results. Many of the
first open label trials showed evidence of significant improvement with patients reporting
decreased need for L-dopa treatment, and an increased level of dopamine uptake in the
putamen (Hauser et al., 1999). Further double blind studies were better able to quantify
graft effects and found that the age of the PD patient was a significant factor in the level
of improvement the patient experienced (Freed et al., 2001). Another factor in the
variable outcome is the variable number of surviving graft neurons. Recent reports have
contested the negative analysis of transplants, arguing that the effect seen is positive and
beneficial, considering that the trend in behavioral testing scores showed steady
improvement. In addition the beneficial effects observed were due to the few cells that
survived transplant. As transplantation techniques improve and cell survival increases
then clinical improvements should also increase (Isacson et al., 2001).
There has been significant debate about the development of post-operative
dyskinesias. These abnormal motor movements have been reported in various frequencies
in graft patients ranging from 15% (Freed et al., 1992) to 56.5% (Olanow et al., 2003).
The underlying mechanism for the development of these dyskinesias remains elusive, but
one interesting hypothesis is that the type of neurons being placed into the brain is not the
appropriate cell type. A9 type neurons are specific to the SNc region and among their
distinguishing features is the expression of the dopamine reuptake transporter D2. This
autoreceptor helps modulate dopamine release from these cells and is thought to underlie
the strength and modulation of the signal from the SNc to the striatum. A10 type cells
lack this autoreceptor and in transplant grafts, a mixture of the two cell types is used.
With a portion of the cells releasing dopamine in a non modulated fashion, the signaling
21
pattern may be disrupted leading to the development of dyskinesias (Isacson et al., 2003).
As further refinements of cell differentiation and selection occur the ability to transplant
cells without these side effects should improve.
CHAPTER 3
MATERIALS AND METHODS
Neurosphere Culture and Asteron Cell Characterization
Generation of Neurospheres
Postnatal day 1-10 (P1-P10) C57BL/6 mice (The Jackson Laboratory, USA) deeply
anesthetized by hypothermia and decapitated. The SEZ and cerebellar cortex were
removed, and dissociated into a single-cell suspension as previously described (Laywell
et al., 2002). Cells were then plated into standard T25 tissue culture flasks in growth
medium consisting of DMEM/F12 containing N2 supplements, 5% fetal bovine serum
(FBS; Atlanta Biologicals, USA), 20ng/mL epidermal growth factor (EGF; Sigma, St.
Louis), and 10ng/mL basic fibroblast growth factor (bFGF; Sigma). After 1-2 days,
floating cells were collected, centrifuged, trypsinized, triturated into a single-cell
suspension, and counted. A secondary culture was initiated by resuspending cells in
growth medium (with or without BrdU), and plating them into ultra low attachment
polystyrene 6-well plates (Corning, USA) at densities ranging from 1x103 to 1x105
cells/cm2. Neurospheres became apparent within 3-5 days.
Differentiation and Immunolabeling of Spheres
To promote differentiation, spheres were placed into a drop of differentiation
medium (DMEM/F12 + N2 supplements + 5% FBS, with or without on coverglass
coated sequentially with polyornithine and laminin (10µg/mL and 5µg/mL, respectively;
Sigma, USA). Some neurospheres were plated in the presence of 10µM
bromodeoxyuridine (BrdU; Sigma, USA) in order to label proliferating cells. Eighteen
22
23
hours to 4 weeks after plating, coverslips were fixed with 4% paraformaldehyde in PBS,
and processed for immunofluorescence as described (Laywell et al., 2000) with a variety
of antibodies, including monoclonal (Promega, USA) and polyclonal (Covance,
Richmond, CA) antibodies against the neuronal cytoskeletal protein β-III tubulin,
monoclonal and polyclonal antibodies against the astrocyte intermediate glial fibrillary
acidic protein (GFAP), (Immunon, USA), a monoclonal antibody against the neuronal
nuclear protein NeuN (Chemicon, USA), polyclonal antibodies against the astrocyteassociated calcium binding protein S100β (Swant, Switzerland). For detection of BrdU,
cells were first incubated in 1:1 formamide:2x SSC for 2 hr. at 65o, and 2N HCl for 30
min. at 37o. After equilibrating for 10 min. in borate buffer, cells were immunolabeled
with a monoclonal rat antibody against the thymidine analog BrdU (Abcam, USA) in
combination with anti-GFAP and anti- β-III tubulin antibodies. After washing and
applying appropriate fluorescent secondary antibodies (Molecular Probes, USA), the cells
were counterstained with Hoechst 33342 fluorescent nuclear stain (Sigma, USA),
coverslipped, and viewed with epifluorescence or confocal microscopy. Images were
captured on a Spot camera and Spot software and Adobe Photoshop were used to adjust
contrast and brightness to more closely resemble images seen under the microscope.
In Situ Hybridization with GFAP cDNA
GFAP cDNA probes were generated by RT-PCR amplification of a 401bp DNA
fragment from neonatal mouse brain tissue with a pair of primers designed with the
Primer 3 program (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi), using the
GFAP sequence from the Genebank database (gi: 26080421). Forward primer:
GCCACCAGTAACATGCAAGA; Reverse primer: ATGGTGATGCGGTTTTCTTC.
The PCR product was cloned into the PCR4 TOPO vector (Invitrogen, USA). After
24
linearization, plasmids extracted from clones of both directions were used as templates to
synthesize digoxigenin (DIG)-labeled GFAP sense and antisense probes using the T7
RNA polymerase (1277073 Roche, USA).
The hybridization protocol followed the method of Braissant and Wahli
(Braissant and Wahli, 1998), with a probe concentration of 400ng/ml, and the
hybridization temperature set at 45ºC. Hybridized probe was immunodetected with
a monoclonal antibody against DIG (Roche, USA) using alkaline phosphatase as the
chromagen. Finally, hybridized cells were processed for immunolabeling with
antibodies against GFAP and β-III tubulin, as described above.
Analysis of Cell Death
Apoptotic cells within plated spheres were visualized using a fluorometric
terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL)
assay (G3250 USA) according to the manufacturer’s recommendations. This assay
measures the fragmented DNA of apoptotic cells by incorporating fluorosceinlabeled dUTP at the 3’ ends of DNA strands. As a positive control, some spheres
were processed for TUNEL following 30 min. incubation with DNase.
Alternatively, activated caspase 3, an enzyme present in early stages of apoptosis,
was detected in plated spheres using an anti-activated caspase 3 antibody (BD
Pharmingen, USA). As a positive control, some spheres were treated with
staurosporine (1µg/ml for 4 hours at 37oC) prior to immunolabeling. Following
TUNEL processing or caspase 3 labeling, spheres were immunolabeled as above
with antibodies against β-III tubulin, and counterstained with Hoechst 33342 (Sigma,
USA).
25
Cell death was quantified by counting the number of TUNEL+ or caspase 3+
nuclei within every sphere on each of three coverslips (range = 12-15
spheres/coverslip). The criterion for apoptotic neurons was intentionally liberal to
avoid undercounting. All TUNEL+ or caspase 3+ cells contacting a β-III tubulin+
process were counted as apoptotic neurons.
Electrophysiology
Spheres plated for 48 to 96 hours were used to assess membrane properties of
asterons. Coverslips were placed in a recording chamber perfused with artificial
cerebrospinal fluid (ACSF) containing (in mM) 124 NaCl, 26 NaHCO2, 1.25 NaH2PO4,
2.5 KCl, 2 CaCl2, 1 MgCl2, 20 D-glucose, oxygenated with 95% O2 and 5% CO2, giving
a pH of 7.4. All recordings were performed at room temperature (22°C). Putative
neurons, astrocytes, and asterons were visually identified using infrared DIC
videomicroscopy with a fixed-stage microscope equipped with a 40X, 0.8 W waterimmersion lens (Zeiss, Germany), and whole-cell patch-clamp recordings were
performed. Patch electrodes had a resistance of 6-8 MΩ when filled with intracellular
solution containing (in mM): 120 K-gluconate, 8 NaCl, 10 HEPES, 4 Mg ATP, 0.3
Na3GTP, 0.2 EGTA, 0.1% biocytin (pH 7.3 with KOH, osmolarity 290-300 mOsm).
Cells were recorded under either current-clamp or voltage-clamp mode using an
Axopatch 1D amplifier (Axon Instruments, USA). Series resistance was 10-25 MΩ and
cells were rejected if resistance changed more than 10% throughout the recording
session. Action potentials were observed in current-clamp mode by injecting a number of
current steps (from -50 pA to 150 pA, in 50pA increments). Na+ and K+ currents were
studied in voltage-clamp mode. Cells were held at -65 mV, and steps of voltage were
26
imposed (from -80mV to 55mV, with 15 mV increments). Maximum Na+ current usually
occurred when cells were held at -5 mV or 10 mV. The magnitude of K+ current was
measured at the steady part of the trace of the last step (55mV). Action potentials and Nacurrents were abolished by adding 1µM TTX (Sigma, USA).
Recorded cells were filled with biocytin, and visualized by application of an
avidin-AMCA conjugate (Vector, USA). Cell phenotypes were confirmed by
immunolabeling the biocytin-filled cells with antibodies against GFAP and β-III
tubulin, as above
ECM Effects on Neurosphere Migration
Cells were isolated from postnatal days 3 to 5 C57BL/6 mice pups. Neurospheres
were prepared as described above. The matrices tested were laminin, fibronectin, and
CSPG. Glass coverslips were incubated for 24 h with poly-L-ornithine, followed by 8 h
incubation with laminin (L-2020, Sigma, USA), fibronectin (F-4759, Sigma, USA), or
CSPG (C-9819, Sigma, USA). Spheres were seeded onto each coverslip in N2 media
containing 5% FBS and 10 ug/ml of EGF and FGF-2. At 24, 48, 72, and 144 h coverslips
from each condition were removed and fixed with ethanol/acetic acid for 30 min.
Immunohistochemistry for the neuron-specific protein B-III tubulin (Covance,
USA) and the astrocyte specific intermediate filament protein glial fibrillary acidic
protein (GFAP) (Immunon, USA) was performed to assess cell differentiation. Hoechst
nuclear staining was performed to visualize cell migration outward from the neurosphere.
Measurements were performed with a Leica compound fluorescence microscope
and SPOT software (Diagnostic Instruments Inc., USA). Migration distance was
calculated as a straight line measurement from the edge of the sphere to the farthest
27
defined edge of the migratory cell boundary. Velocity data were defined as total distance
migrated over time. Measurements were analyzed using the Student’s t test.
Slice Culture Preparation
Slice cultures were generated from postnatal day 7 to 15 (n=10), with a total of 48
slices cultured for this study. See Figure 3-1 for the preparation outline. Briefly, animals
were euthanized under halothane, and their brains were cut at the midline into two
sagittal halves. These halves were then superglued, medial surface down to the vibratome
stage, covered in cool, molten 2% agar, and immersed in cold preparation media (DMEM
F12, 100 ug/mL L-ascorbic acid, 2 mM L-glutamate, and antibiotic/antimycotic
(Invitrogen, USA)). 300-400 uM thick slices were cut using a vibratome (Leica S1000,
Germany), transferred to a Petri dish with cold preparation media, and scanned using a
dissection microscope (4X magnification) to select slices. Typically 4-6 mid-sagittal
slices per animal from the levels 0.8-2.0 mM lateral from midline were obtained
(Franklin, 1996). Slices were then immediately transferred to a transwell membrane inset
(#3650, Falcon,USA), placed in a 6 well plate, and incubated at humidified 35 degrees C
and 5% CO2. Each inset was suspended in 1 mL of “A” media, containing 25 % horse
serum (Kluge et al., 1998). “A” media was sequentially replaced by thirds with a serum
free DMEM F12 based “B” media, containing B27, and N2 supplements (Invitrogen,
USA) until day 7 when cultures contained only “B” media (Benninger et al., 2003;
Scheffler et al., 2003).
6-Hydroxy Dopamine Nigrostriatal Lesions
For nigrostriatal lesion studies the dopaminergic neurotoxin 6-OHDA (Sigma,
USA) was used. 6-OHDA was applied either prior to slices being placed on the
28
membrane, submerged in 20 mM 6-OHDA/saline for 10 min, or 7 days after plating. For
7 day old cultures, all media was replaced with sterile saline and the slices submerged in
20 mM 6OH-DA/saline with 25% mannitol, for 10 minutes. Mannitol was used to disrupt
the glial scar and enhance 6-OHDA penetration into the slice. After treatment all saline
and 6-OHDA were aspirated and replaced with “B” media.
Embryonic Stem Cell Neural Precursor Transplants
ESNP’s were derived from GFP expressing R1 ES cells (Hadjantonakis et al.,
1998) and cultured as described by Okabe et al (Okabe et al., 1996). TH expression was
induced in cells using bFGF (10 ng/ml), FGF8 (100 ng/ml), SHH (500 ng/ml), PTN (100
ng/ml) (Sigma, USA) which were added to the culture media every day. 50-100,000 cells
were transplanted using a 5 uL Hamilton syringe to deliver 2 uL to the region around the
substantia nigra or directly onto the striatum. For co- transplants with laminin, 50 ug of
laminin was added to a mixture of cells, 2% methylcellulose, and B media for transplant.
Immunocytochemistry and Quantification
For morphological and phenotype analysis, slices were slices were fixed with 4%
paraformaldehyde for at least 24 h at 4○ C. Sections were then either processed as whole
mounts or embedded in paraffin and sections cut at 10 um.
Immunocytochemistry for tyrosine hydroxylase (1:1000, polyclonal, Chemicon,
USA), GFP (1:1000, Sigma, USA), Nissl (NeuroTrace, Molecular Probes, USA) and
DAPI (Vector, USA) was performed on these sections to assay slice viability as well as
ESNP survival and integration. Sections were mounted on slides and incubated in
primary antibody overnight at 4○ C. Labeling with fluorescent secondary antibodies
(Molecular Probes, USA) was performed at room temperature for one hour. DiI labeling
29
was performed using a DiI paste (Molecular probes, USA) applied using a 16 gauge
needle tip. Paste was applied to the striatum of slices after one week in culture.
Cell counts were performed on 10 uM sections. Serial sections, at least 40 uM
apart were analyzed. TH+ and Nissl/DAPI+ cells in the SNc were counted, and the
counts averaged across conditions. For striatal density, digital photos were taken of the
striatum under the same shutter and gain settings. Image J (NIH, USA) was used to
calculate the mean grey value of a random region of the striatum. All measurements were
individually normalized to the grey value of adjacent cortex to account for staining
variations. All counts and intensity data was analyzed using GraphPad Prism
(Graphpad.com, USA).
Electrophysiology of Slice Culture Transplants
Culture media was removed and slices were placed into a holding chamber
continuously perfused with oxygenated artificial cerebrospinal fluid (aCSF) containing,
in mM: 125 NaCl, 3 KCl, 26 NaHCO3, 1.25 NaH2PO4, 20 glucose, 1 MgCl2, and 2 CaCl2
and maintained at 35° C during experiments. Intracellular pipette solution comprised of,
in mM: 145 K-gluconate, 10 HEPES, 10 EGTA, and 5 MgATP (pH 7.2, osmolarity 290).
For experiments in which post-synaptic currents were recorded, 145 K-gluconate was
replaced with 125 KCl and 20 K-gluconate. Recordings were performed with an
Axopatch-1D (Axon Instruments, USA) and filtered at 5 kHz. Clampex 8.2 (Axon
Instruments, USA) was used to deliver command potentials and for data collection.
Series resistances were < 20 MΩ and checked frequently to ensure that they did not
deviate. During current-clamp experiments a step protocol was utilized in which currents
30
between 10-100 pA were applied per step. Clampfit 8.2 (Axon Instruments, USA) was
used to analyze voltage and current traces.
Figure 3-1. Slice Culture Protocol Schematic. Slice cultures are generated from
postnatal mice brains. A) After the brain is removed, the cerebellum is
removed and the hemispheres are separated. B) Hemispheres are then
superglued to a vibratome stage and covered in molten agar to support the
tissue during sectioning. After sectioning, slices are selected from the
appropriate level for culture. C) Sections for 6-OHDA treatment are bathed in
a 20 mM solution for 10 min prior to plating and the media is changed on the
samples as indicated in the timeline.
CHAPTER 4
RESULTS
Neural Stem Cell Differentiation and the Asteron Phenotype
Shortly after the initiation of sphere differentiation by plating onto adhesive
substrata, combined β-III tubulin/GFAP immunolabeling reveals distinct
neuron/astrocyte mixtures (Fig. 4-1A, B), in which no individual cells are seen coexpressing these markers. During the first day post-plating, “immature” neurons are
apparent as small, rounded cells with relatively short processes (Fig. 4-1).
Over the next 1-2 days, the neuronal phenotype begins to “mature” as they start to
show a more fibroblastic soma in combination with longer, branching processes
(Fig. 4-1B). Shortly after this stage, exclusively β-III tubulin+ neurons can be seen
combining fine neuronal-like processes with wide, flattened cell bodies characteristic
of astrocytes (Fig. 4-1C). By 5-6 days post-plating, there are few cells left that
exclusively express β-III tubulin, while the number of co-expressing asterons
reaches its maximum level (Fig. 4-1D). Asterons continue to display flatter, more
stellate morphologies (Fig. 4-1E), and in the second post-plating week show a wide,
flat, “fibroblastic” morphology typical of cultured astrocytes (Fig. 4-1F). During this
transition period of neuronal decline and asteron increase, cells with all three
phenotypes (neuron, astrocyte, and asteron) can often be seen in a single, high
magnification field of view (Fig. 4-2A), arguing against the interpretation that the
asteron phenotype results simply from antibody cross-reactivity. Likewise, confocal
microscopy of individual asterons reveals that antibodies for neuronal and glial
31
32
markers are co-localized within the same cell, and it appears that these markers label
separate populations of subcellular elements within the same cell (Fig. 4-2B-D),
suggesting that the asteron phenotype is not the result of antibody cross-reactivity or
epifluorescence bleed-through. Combinations of monoclonal anti-β-III tubulin +
polyclonal anti-GFAP, and polyclonal anti-β-III tubulin + monoclonal anti-GFAP
co-label hybrid asteron cells equivalently.
Combination of Asteron Markers
In addition to β-III tubulin and GFAP, asterons also co-label with a combination
of monoclonal anti-β-III tubulin and polyclonal anti-S100β. Again, some but not all
β-III tubulin+ cells are also immunopositive for S100β (Fig. 4-3A & insets).
Likewise, asterons are immunolabeled with antibodies against GFAP and the
neuronal protein, MAP2 (data not shown). However, when we combine polyclonal
anti-GFAP with monoclonal anti-NeuN, a protein thought to be restricted to fully
mature neurons, we never observe cells expressing both markers (25 spheres
examined), even though it is clear from positive controls that both antibodies are
present at optimal concentrations for immunolabeling (data not shown). Finally,
combining GFAP cDNA in situ hybridization with β-III tubulin and GFAP
immunolabeling shows that cells transcribing astrocyte-associated mRNA are
immunopositive for both glia- and neuron-associated cytoskeletal proteins (Fig 4-3B,
C).
Analysis of Cell Death
Neurons (i.e. cells exclusively expressing neuronal phenotype markers) become
apparent immediately after spheres attach to substrate and begin differentiation, then
decrease in number until, after approximately two weeks, they are no longer detectable.
33
The observed decrease in neuron number is paralleled by an increase in asteron cells coexpressing neuronal and glial phenotype markers, and it is this inverse relationship that
originally led us to hypothesize that neurons in these cultures undergo a phenotypic
transformation into hybrid neuron/astrocytic cells. A partial alternative to this
hypothesis, though, is that the reduction in neuronal cells is due simply to cell death. In
order to determine if cell death plays a significant role in neuronal reduction, we used two
methods to analyze apoptosis in cerebellar-derived spheres: TUNEL and caspase 3
immunolabeling. We focused our apoptosis analysis on the six days immediately after
sphere plating, since this time window corresponds to the vast majority of neuron/asteron
inversion. At all time points assessed only a small number of sphere-derived cells are
TUNEL+ (Fig.4-4B, compare to +control in 4A). Quantification of sphere composition
(including both the penumbral and the central sphere mass) with respect to neurons,
astrocytes, and TUNEL+ cells (Fig. 4C) shows that even if all of the TUNEL+ cells
represented dying neurons, it could not account for the dramatic reduction in neuron
number during the first few days after plating. The TUNEL analysis is mirrored very
closely by immunodetection of the early apoptosis marker, activated caspase 3; again,
only a small number of sphere cells at all time points analyzed are caspase+, and only a
fraction of these cells (6% of all caspase+ cells) are immunopositive for βIII- tubulin
(Figure 4-5).
Physiological Properties of Hybrid Asterons
Electrophysiological recording of 20 candidate neurons, astrocytes, and asterons
reveals that retrospectively identified asterons (Fig. 4-6A,B) have a varied
electrophysiological profile. Clearly-identified neurons show both K+ and Na+ channels,
a depolarizing spike, and resting membrane potentials of -70 mV or lower (Fig 4-6C),
34
whereas astrocytes show large K+ channels, small (or no) Na+ channels, no depolarizing
spike, and resting membrane potentials usually greater than -70 mV (Fig. 7G). Asterons
show wide variability in resting membrane potential (-52 to -78 mV), but consistently
display K+ currents with relative amplitudes that place them between the amplitudes seen
for neuronal and astrocytic K+ currents. We found examples of asterons that display
physiological profiles that resemble astrocytes (Fig. 4-6F; compare to 4-6G), though with
lower amplitude K+ current. In addition, one confirmed asteron showed intermediate
amplitude K+ channels, neuron-like Na+ channels, and a Na+ spike that could be
abolished by the administration of TTX (Fig. 4-6D&E). The relative amplitude of the K+
current among the different cell types, combined with the presence or absence of
significant Na+ channels suggests that as cells transition into asterons from neurons, they
begin to turn off Na+ channel expression and upregulate K+ channel amplitude.
Extracellular Matrix Influence on Neurosphere Migration
Neurospheres derived from both SVZ and cerebellar niches developed in culture
and when plated on adherent substrates generated robust numbers of neurons and glial
cells (Figure 4-7). The results indicate that cells generated from neurospheres display
differential migration patterns on the three different ECM substrates tested. Analyzing the
distance migrated outward from the edge of the sphere to the furthest observed cell
allowed us to generate a plot of migratory velocity, and of total distance migrated.
Laminin and fibronectin allow multipotent neurosphere cells to migrate faster compared
to CSPG.
After 24 h, spheres on all substrates attached and cells began to migrate outward in
a radial pattern. Laminin showed a significantly faster migration velocity compared to
35
CSPG, but the difference between fibronectin and laminin was not significant. Although
not reaching the level of statistical significance, the difference between fibronectin and
CSPG was consistent between trials and did appear to favor migration on fibronectin. At
48 h fibronectin showed a significant difference from both laminin and CSPG in
outgrowth velocity, and laminin contributed to a significantly faster cell migration
compared to CSPG. At 72 h laminin gave rise to no significant difference in velocity
from fibronectin, but both fibronectin and laminin substrates generated significantly
faster migratory rates of neurosphere cells compared to CSPG. At 144 h the velocities for
all the substrates decreased, suggesting a loss of migratory capacity in the maturing cell
population.
Total migratory distance followed the same pattern of ECM preference as
migration velocity. At 24 h laminin showed a significantly larger outgrowth over CSPG,
and fibronectin showed a large but not significant difference over CSPG. At 48 h the
increase in fibronectin velocity led to a significant difference in migration distance over
both laminin and CSPG. At 72 h, laminin and fibronectin both maintained a significant
increase in outgrowth distance over CSPG. This same pattern continued at 144 h.
The values obtained for the migration velocities on laminin and fibronectin prior to
144 h are in accordance with cell migration rates reported in slice culture studies by
Komuro and Rakic (1995), who observed an average velocity of 13.9 uM/h for migrating
cerebellar granule cells in cerebellar slice cultures. This is in agreement with our data
showing that the maximal velocity for neurosphere cells on fibronectin at 48 h was 13.94
uM/h and for laminin 12.86 uM/h at 72 h. The velocity data suggests a maturing cell
population that begins to mature and cease migrating around 144 h. This decrease does
36
not seem to be distance-related, as each substrate showed a deceleration with significant
differences in the migration distance. In addition, whereas the assay does not discriminate
between random and directed migration, the radial outward pattern of migration and the
lack of asymmetric migration suggests that there is little directed migration (Figure 4-10).
Since all substrates exhibited this pattern of nondirected migration we concluded that
distance and velocity measures were affected only by matrix composistion. We did not
note any difference in neuron/glial percentages between the different ECM substrates that
were tested.
Nigrostriatal Slice Culture
Long-term parasagittal slice cultures demonstrated good viability all the way
through 4 weeks in culture. Figure 4-11A shows staining for TH, with robust expression
in the SNc, the medial forebrain bundle (MFB) and the striatum, after 3 weeks in culture.
In parasagittal slices of postnatal mouse brains, there are 2-3 400 µm thick slices with
both the SNc and striatum present from each side, with the MFB also being present
between these structures. Figure 4-11B shows DiI labeling of a slice 4 days after
application. There is extensive label within the DiI application points in the striatum, and
labeled fibers and cells away from the application in the nigral region (Fig. 4-11B),
suggesting active transport of the dye through intact fibers. Axon tracing using a 10,000
MW dextran tracer (Fluro-Ruby) placed in the striatum show labeled cells in the cortex
(e.g. layer V) and in the nigral area (Fig. 4-11C). Taken together, these data show that
long term parasagittal slice cultures retain a sufficient three dimensional organization to
functionally model their in vivo correlates.
37
6-Hydroxy Dopamine Lesions of Nigrostriatal Slice Cultures
Exposure of the slices to 6-OHDA caused a significant reduction in the number of
SNc TH positive neurons. Figure 4-12A shows the TH staining of a slice exposed to 6OHDA at the time of initial plating, with an almost complete lack of staining in the
striatum, and a significant reduction in the medial forebrain bundle and SNC after 3
weeks in culture. Cell counts of lesioned slices showed a significant (P=0.0092) 46%
±6% decrease in TH+ cell bodies in the SNc (4-12B). In addition, there was also a
significant (P=0.0172) reduction, 60% ± 6%, in the striatal TH density (Fig 4-12C).
Nova-red visible chromagen staining (Figure 4-13 A,B) showed robust TH staining
throughout the entire nigrostriatal circuit. Lesioned slices showed a similar pattern
staining loss as the fluorescent labeling. We did note a difference in dorsal compared to
ventral striatal labeling. This is likely due to the sparing of the ventral tegmental area
dopamine neurons in the midbrain which preferentially project to the ventral striatum and
are less susceptible to 6-OHDA lesioning.
High magnification views of the slice cultures also show characteristic lesioninduced changes. Figure 4-14A shows the effect of 6-OHDA on the SNc of slice cultures.
In control slices the SNc is morphologically intact with discrete TH staining and a clear
cytoarchitecture including fine intranigral fibers. 6-OHDA lesioned slices show a loss of
discrete labeling and a reduction in the number of clearly identified cell bodies and
intranigral fibers. In the striatum, the loss of TH staining is very pronounced in the
lesioned slices (Figure 4-14B).
Nova-red staining for TH confirmed the results of fluorescent antibody labeling.
High magnification views of the striatum showed a significant reduction in TH staining
compared to control slices after 2 weeks in culture (4-15 A,B). High magnification views
38
of the SNc (Figure 4-16 A,B) also showed a reduction in TH staining in lesioned slices.
We noted a reduction in non-specific punctuate labeling with the nova-red staining over
the fluorescent secondary antibodies suggesting that the visible chromagen method may
be the preferred method for visualizing the effect of lesions on the slices. The trade off is
that the current nova-red technique has difficulty in resolving cell bodies in control slices
due to the staining intensity. Further refinement of the staining methods should enhance
the ability to visualize cell bodies in control and lesioned slices.
Real Time Analysis of Nigrostriatal Degeneration
The use of slices from animals expressing GFP under the control of the TH
promoter shows that 6-OHDA exposure causes a loss of GFP expression confirming a
similar loss of TH+ cells and fibers in this transgenic mouse model Using slice cultures
from the TH-EGFP mouse, it was possible to track, in living slices the loss of GFP signal
which corresponded to the loss of dopaminergic innervation. Our initial results
demonstrated a strong GFP signal localized to the striatum and the SNc (Figure 4-17).
When slices were treated with 6-OHDA prior to their culture, GFP was significantly
reduced in the striatum within 4 days of plating. The control GFP signal remained strong
for at least a week in culture, suggesting that the culture conditions are amenable to
keeping the nigrostriatal circuit intact.
Nigrostriatal Slice Culture Applications
Using the 6-OHDA lesion model system we have begun to screen a variety of
potential therapeutic options. The majority of the work has been done on dennervated
slices using ES derived neuronal precursors to try and repair and reconnect damaged
circuitry. These cells have demonstrated a robust survival in slice cultures preparations
and are amenable to manipulation prior to transplantation. We have examined the effect
39
of laminin on ESNP migration and integration into the slice culture. In vitro and in vivo
experiments were performed to induce a dopaminergic phenotype in the ESNP’ cells, in
order to replace the cell type lost in Parkinson’s. Given the ease of manipulation and
access to the slice culture and the transplanted cells we have also demonstrated functional
characterization of implanted ESNP’s.
Embryonic Stem Cell Neural Precursor Transplants into Nigrostriatal Slice
Cultures
ESNP’s transplanted into slice cultures remained viable for up to 4 weeks in
culture. When initially plated the cells tended to exist as aggregates that cells slowly
migrated out from. Figure 4-18 shows ESNP’s implanted on the slice after 6 days in
culture. After 3 weeks in culture, ESNP’s were observed throughout the implantation area
and possessed a more mature phenotype with processes and expression of neural
cytoskeletal markers, such as MAP2 (Figure 4-19). Adding laminin to the ESNP
transplant mixture enhanced the outgrowth of cells through the slice culture. Within 6
days in the presence of laminin, cells had dispersed out in the slice and there was a lack
of cellular aggregation seen with laminin (Figure 4-20, 4-21).
Embryonic Stem Cell Neural Precursor Integration and Maturation in Slice
Cultures
ESNP integration into the slice culture appeared robust, with many of the cells
developing extensive processes (Figure 4-22). ESNP’s implanted into the slice culture
striatum matured and were able to integrate into the slice culture circuitry.
Electrophysiological recording from an ESNP in the striatum showed that the cell was
capable of generating an action potential and responded to post synaptic currents,
suggesting that the cell was receiving inputs from surrounding neurons in the striatum.
40
Figure 4-23 shows a mature ESNP in the striatum, and shows the recorded cell and the
electrophysiologal traces that were performed on the cell within the slice.
The ultimate goal of transplantation regeneration is to replace the cell population
lost in the degeneration and to have the transplant reside in the anatomically correct
location. Preliminary results with transplants near the intact SNc have shown that ESNP’s
are able to mature in this region and survive (Figure 4-24).
Dopaminization of Transplantable Cell Populations
Dopamine Neuron Generation from ESNP Culture In Vitro
Culturing ESNP’s in the presence of FGF8, SHH, and FGF8, enhanced the
differentiation of these cells into dopamine neurons. Our results with a 7 day induction
protocol showed an approximate 10-fold increase in the number of TH+ neurons
generated compared to non-induced controls (Figure 4-25). In vitro dopaminized ESNP’s
matured rapidly on laminin coated coverslips and extended long processes. Figure 4-26
shows the typical morphology of in vitro dopaminized ESNPs.
Dopamine Neuron Generation from ESNP Cultures in Slice Culture
Using our slice culture model system we showed the ability of ES derived neurons to
mature and integrate within the culture environment. Our next step involved manipulating
the cells that we were transplanting in order to try and selectively replace the population
of neurons that was lost in our lesion model, the dopaminergic neurons of the SNc.
Various strategies have been attempted to try and induce a dopaminergic phenotype in
cells, ranging from genetic knock-ins of transcriptions factors to culture in the presence
of cytokines and growth factors. Using a combination strategy of two of the more potent
cytokine induction methods, we were able to enhance dopaminergic neuron generation in
our ESNP cultures, and obtained interesting results using this induction method on other
41
cell populations. In the slice cultures, dopaminized ESNP’s survived for at least 2 weeks
in the slice and exhibited morphological maturation. We observed transplanted
dopaminized neurons located in ectopic locations such as the striatum and cortex (Figure
4-27). In general these neurons had robust process extension, but did not appear to have
any sort of directed growth
Dopaminization of Adult Stem Cell Cultures
Given the success of the cytokine cocktail on inducing a dopamine phenotype,
preliminary work has begun on inducing adult stem cell neuroblasts to a dopaminergic
phenotype. The initial results have suggested that adult neural stem cells can be induced
using cytokines, but that the effect is more limited than in ES derived neurons (Figure 428). In addition we noted a lack of co-localization of TH with neuronal markers. While
this does not rule out the possibility that these cells are neuronal, it does raise the issue of
whether non-neuronal cell types can be induced to express TH (Figure 4-29).
42
Figure 4-1. Combined β-III tubulin and GFAP immunolabeling reveals the temporal
progression of the asteron phenotype. A) Shortly after initiation of
differentiation, spheres contain non-overlapping populations of cells
immunopositive for either β-III tubulin (red), or GFAP (green). No cells are
seen co-expressing both markers (inset in A, higher magnification). B)
Twenty-four hours post-plating, spheres still contain cells with mutually
exclusive β-III tubulin (red)/GFAP(green) labeling patterns, but neuronal
morphology is more mature (inset in B). C) Phenotypic heterogeneity is
increased two days after plating, with cells that co-label with both neuron
(red) and astrocyte (green) markers (arrow pointing to “yellow” cell). D) At
three days post-plating, few cells exclusively expressing β-III tubulin can be
seen, and the number of co-expressing asterons increases. E) At five days
neurons are very scarce, and co-expressing asterons display astrocytic
morphologies. Inset in (E) shows a higher magnification of an asteron at this
stage. F) By six days co-expressing cells show a wide, flat, fibroblast-like
morphology typical of cultured astrocytes.
43
Figure 4-2. Antibodies against β-III tubulin and GFAP reveal three immunophenotypes,
and label separate sub-cellular elements within asterons. A) β-III tubulin+
neurons (red), GFAP+ astrocytes (green), and co-expressing asterons (yellow)
can be seen in close proximity with no evidence of antibody cross-reactivity.
B-D) Confocal microscopy shows the co-localization of both immunomarkers
in a single z-axis of an asteron. Scale bar in (A) applies to all panels.
44
Figure 4-3. Asterons co-express β-III tubulin with S100β, and transcribe GFAP mRNA
Two days after plating, some cells (e.g. arrows) are co-labeled with both the
astrocyte calcium-binding protein S100β, and β-III tubulin (A). Not all β-III
tubulin+ cells are also S100β+ (lower left inset in A: arrow indicates a cell
exclusively expressing β-III tubulin), indicating that the staining pattern does
not result from antibody cross-reactivity. Lower right inset in (A) shows
higher magnification of a double-labeled asteron. (B&C). Some cells that
hybridze GFAP cDNA (asterisk in B) also immunolabel for GFAP and β-III
tubulin (asterisk in C). Inset in (B) shows that β-III tubulin+ neurons (red) do
not hybridize GFAP cDNA.
45
Figure 4-4. Asteron appearance corresponds with neuronal reduction that is not
attributable to apoptotic cell loss. A) TUNEL staining reveals cells
undergoing apoptosis in control DNAse-treated sphere cells. B) Untreated
sphere cells plated for three days. C) The temporal relationship among
neurons, asterons, and apoptotic cells. As neurons (blue line) decrease, there is
a corresponding increase in asterons (green line). TUNEL (red line) shows
that there is a steady rate of 1-3 apoptotic cells per sphere during the first
week after plating.
46
Figure 4-5. Caspase 3 analysis of cell death accords well with TUNEL data. Histogram
shows that the level of cell death detected with caspase 3 immunolabeling
during the first week after plating corresponds remarkably well with the level
of TUNEL staing. Apoptosis was induced with staurosporine in spheres plated
for 48 hours as a positive control (red bar).
47
Figure 4-6. Physiology of neurons, astrocytes, and asterons. A) Candidate asterons
immunolabeled for β-III tubulin (red) and GFAP (green) were voltage
clamped. B) Patched cells were filled with biocytin (blue) during recording
and later immunostained C) Voltage- clamp recordings demonstrate the Na+
and K+ current profiles of a typical neuron. D) Tracing of an asteron
possessing Na+ and K+ currents. E) TTX exposure blocks the Na+ current
activity of this cell. F) Another example of an asteron shows no Na+ current,
and a more astrocytic K+ current. G) A trace from a typical astrocyte shows a
large amplitude K+ current with no Na+ current.
48
Figure 4-7. Phenotype immunostaining of neurosphere derived cells. Neurosphere
derived cells immunolabeled for β-III tubulin (red) and GFAP (green) show
evidence of morphologically maturing neurons on the astrocyte monolayer.
49
Figure 4-8. Velocity plot of neurosphere derived cells on different ECM substrates.
Velocity plots show that the different ECM substrates have variable effects on
neurosphere cell speed. Laminin and fibronectin show the fastest migration
speeds, while CSPG significantly slows down cell migration. Cells on all
substrates begin to show a decrease in speed after 72 hours in culture.
50
Figure 4-9. Migration distances of neurosphere derived cells on ECM substrates.
Neurosphere derived cells show significant differences in migration distance
on different ECM substrates. Laminin and fibronectin show the longest
migration distances with CSPG significantly reducing cell migration distance.
51
Figure 4-10. Neurosphere derived cell migration patterns and measurements.Cells
migrating from neurospheres migrate in a radial pattern outward from the
sphere core. A) Neurosphere derived cells on laminin after 144 h in culture.
B) Neurospere derived cells on fibronectin after 144 h in culture. C)
Neurosphere derived cells on CSPG after 144 h in culture.
52
Figure 4-11. Slice culture viability and nigrostriatal circuit maintenance. A) Montage of
TH staining in an intact slice after 2.5 weeks in culture. Inset into A is a
nuclear stain of the hippocampus showing the intact cytoarchitecture. B) DiI
tracing within a slice after 4 days in culture with the application points in the
striatum and backfilled cells in the SNc. C) Dextran tracing of an intact slice
after 3 days in culture. Arrows represent application points in the striatum and
there are labeled cells in the SNc and the cortex (Higher magnification insets
of these regions).
53
Figure 4-12. 6-OHDA lesion of nigrostriatal slice cultures. A) TH staining of a slice
culture that was exposed to 20 mM 6-OHDA. B) Histogram showing the
percent reduction in SNc cell bodies, P<0.05. C) Reduction in optical density
of TH staining.
54
Figure 4-13. Nova-red staining of TH reveals control and lesioned nigrostriatal circuitry.
A) Intact control slice culture after 2 weeks in culture. The nigrostriatal
circuit, including SNc, MFB, and striatum are all preserved and show intense
labeling. B) A 6-OHDA lesioned slice, after 2 weeks in culture. The TH
staining is reduced, notably in the SNc and in the dorsal striatum.
55
Figure 4-14. Cytoarchitectural changes in 6-OHDA lesion slice. A) TH staining in the
SNc of control and lesioned slices. B) TH staining in the striatum in control
and lesioned slice.
56
Figure 4-15. Nova-red labeling of striatal TH shows effect of exposure to 6-OHDA. A)
Striatal TH labeling in a control slice culture striatum after 2 weeks in culture.
B) Striatal labeling in a 6-OHDA lesioned striatum after two weeks in culture.
57
Figure 4-16. Nova-red staining of the SNc reveals loss of staining after exposure to 6OHDA. A) Representative sections from control slice cultures after 1-2
weeks in culture. B) Representative sections from slice cultures after 1-2
weeks in culture after exposure to 6-OHDA. Slices exposed to 6-OHDA
show a significant reduction in staining intensity and in observable cell
bodies.
58
Figure 4-17. Real time analysis of TH-GFP. A) Control slices show intense GFP labeling
in the striatum at 4 and 7 days. B) 6-OHDA treated slices at the same time
points show a significant decrease in GFP intensity suggesting a loss of
dopaminergic fibers.
59
Figure 4-18. ESNP transplants into slice cultures. Transplanted ESNP’s after 6 days in
the slice culture appear as cellular aggregates with little evidence of migration
into the slice tissue.
Figure 4-19. Long term ESNP transplants in slice cultures. After 23 days in culture,
ESNP’s have migrated through the slice culture and in this high magnification
view can be seen extending processes through the slice. Inset shows a MAP2
positive GFP+ neuron, showing that the transplanted cells are expressing
neuronal markers.
60
Figure 4-20. Laminin enhances ESNP migration through slice cultures After 6 days in
cultures, ESNP’s that were transplanted in the presence of soluble laminin
show an increased spread through the slice culture and less cellular
aggregation.
Figure 4-21. Laminin enhances process outgrowth of ESNP’s in slice cultures. After 6
days in culture, ESNP’s, under high magnification, show evidence of
extensive process outgrowth, comparable to ESNP’s not treated with laminin
after 3 weeks in culture.
61
Figure 4-22. GFP+ ESNP striatal transplant. GFP+ ESNP located in the striatum after 2
weeks in culture. This ESNP demonstrates a significant level of maturation
with extensive process arborization. Red is TH staining showing the
dopaminergic fibers running into the striatum, green is GFP and blue is a
nuclear counter stain.
62
Figure 4-23. Electrophysiological Characterization of Transplanted Cells. (A) GFP+
ESNP cell in the striatum with patch clamp. B)Tracing indicating that the
patched cell has the capability to generate an action potential. C) Tracing
showing that the cell exhibits post synaptic currents.
Figure 4-24. ESNP’s located near the substantia nigra. ESNP’s located near the SNc
show survival and process extension after 2 weeks in culture, suggesting that
this region is capable of supporting ESNP engraftment.
63
Figure 4-25. Increase in TH+ neurons derived from ESNP’s exposed to ventralizing
agents.
Figure 4-26. In vitro ESNP dopaminization.. ESNP’s cultured on laminin coated
coverslips, under the influence of inducing cytokines, express TH and show a
high level of maturation including extensive process extension.
64
4-27. Dopaminized ESNP’s implanted into slice cultures. TH+ ESNP cells were
seen in isolation, with elaborate short distance processes. Cells were implanted
into the striatum and were observed in the striatum and neighboring cortex.
65
Figure 4-28. Adult neural stem cells exposed to dopaminzing cytokines express TH.
Cultured adult neual stem cells can be treated with FGF8, SHH, and
pleiotropin to induce TH expression in a subset of cells. Red is beta III tubulin
and green is TH.
66
Figure 4-29. Induced TH+ adult stem cells. Adult neural stem cells exposed to FGF8,
SHH, and pleiotrophin. Panel A shows TH+ cells, Panel B is beta III tubulin
positive cells and Panel C shows the merged image with a nuclear
counterstain.
CHAPTER 5
DISCUSSION AND CONCLUSIONS
Adult neural stem cells and ES derived neurons represent two populations of cells
that may be amenable to repair and regeneration within the central nervous system. One
of the biggest challenges to utilizing stem cells effectively is controlling cell migration,
differentiation, and integration into damaged tissue. Our initial work with adult
neurosphere cultures focused on cell fate determination. In these experiments we
observed a hybrid cell type that we termed “asterons” that appeared to posses
characteristics of both neurons and astrocytes. Further analysis of neurosphere cells on
different ECM molecules allowed us to generate migration profiles that have identified
ECM molecules that enhance migration of neural stem cells. In order to better understand
how stem cells behave in the neuronal environment we have developed a novel slice
culture bioassay system. Using this slice culture model system we can observe in real
time the fate choice and integration potential of both adult and embryonic stem cells.
Stem cell repair of damaged circuits within the brain is a key area of stem cell therapy
and our slice culture bioassay focused on examining stem cell behavior in a model of
Parkinson’s disease.
Characterizing and manipulating stem cell fate choice is a critical component of
utilizing stem cells for regeneration based therapies. Without the ability to make the right
type of cell, stem cell based therapies would be ineffective or potentially more harmful to
the patient. In addition, basic questions of cell phenotype and cellular developmental
processes can be examined using stem cells as a recapitulation of cellular differentiation.
67
68
Our initial experiments on adult neural stem cell derived neurosphere cells allowed
us to examine postnatally derived glial and neuronal development. Our observations
indicated a time dependent decrease in the neuronal population, coincident with the
appearance of the hybrid cell type asterons. Our hypothesis was that a subset of neurons
in the neurosphere cultures was transdifferentiating from early immature neurons into
glial cells. Our data showed that only immature neuronal markers, such as beta III
tubulin, co-localized with astrocyte markers such as GFAP in asterons. Mature markers,
such as NeuN did not co-localize with any glial markers. This suggests that the asteron is
only expressing immature markers of differentiation. Electrophysiological recording from
asterons showed an variable intermediate profile of membrane currents and potential.
Compared to neurons, asterons tend to lose Na+ currents, show increased K+ amplitude
and generally have a lower resting membrane potential. However we did observe asterons
that were capable of generating action potentials that could be blocked using Na+ channel
blockers. Cell death analysis did not show any significant levels of neuronal apoptosis,
suggesting that not all of the neuronal loss was due to cell death.
All of the evidence then supports are hypothesis that neurosphere derived early
neurons may be capable of altering their cell fate choice during early development. While
there is no reliable evidence for asterons in vivo, there have been several reports of cells
that appear to have intermediate properties. Some GFAP+ cells derived from human
embryonic CNS stem cells can exhibit spontaneous neuronal firing patterns in vitro
(Gritti et al., 2000), and a GluR-expressing astrocyte in the hippocampus has been
described that may represent an intermediate cell type (referred to as an astron) that
possesses glial properties, but may have begun to express neuronal genes (Matthias et al.,
69
2003). While it is possible that the asteron may only represent an in vitro state, it does
suggest that environmental factors can be used to alter cell fate choice, and in addition
generate unique cell type.
An intriguing possibility is that the asteron represents an open ended state of stem
cell differentiation. At this stage the asteron may be more receptive to exogenous
influences to determine cell fate as well as certain intrinsic programs. Damage to these
intrinsic developmental programs has been linked to the development of tumors derived
from stem cells (Perryman and Sylvester, 2006). In addition there have been reports of
cells similar to asterons isolated from cortical brain tumors of humans (Ignatova et al.,
2002). The asteron therefore could be an in vitro representation of an in vivo stem cell
state that allows for differentiation, but may also represent a state where oncogenic
disruptions might initiate tumor formation.
Our next area of study using these adult neural stem cell derived cells was to
examine the effect of extracellular matrix molecules on cell fate choice as well as
physical properties of migration. Extracellular matrix molecules have long been shown to
affect cell migration and differentiation, both in vivo and in vitro. Neural stem cells in
particular are normally restricted to their germinal zones through the use of inhibitory and
permissive ECM. Neurosphere derived cells plated on laminin and fibronectin showed
and enhanced migration capacity, compared to CSPG substrate. Our results indicated that
neural stem cells on all tested substrates demonstrated a time dependant increase, then
decrease, in migration velocity. This pattern is suggestive of a maturing cell population
that becomes less mobile, and more morphologically mature. The velocity data also
shows that fibronectin and laminin are more permissive for neural stem cell and daughter
70
cell migration than CSPG. There was no appreciable difference in cell fate, suggesting
that the adult neural stem cell does not respond to these ECM molecules in determining
fate. Given the predictable nature of neural stem cell behavior on these substrates it
becomes feasible to generate scaffolds for neural stem cell transplants or as bridges for
endogenous stem cell migration. Permissive substrates placed inside the rostral migratory
stream could hypothetically be used to transport endogenous stem cells to the site of an
injury. This scaffold could be seeded with cytokines and transcription factor activators
that could be used to induce SVZ stem cells into the appropriate cell type for repair.
Working within the in vitro cell culture model provides advantages in observation
and manipulation, but does not provide enough information regarding how in vivo
environments and conditions may interact with cell transplants. Since cell transplants are
being aggressively targeted for neurodegenerative disorders, we decided to focus our
stem cell characterization and manipulation on a model of Parkinson’s disease. Based on
our observations using adult neurosphere derived cells, we needed a system where we
could track over time the differentiation and migration of cells within the model.
Organotypic slice cultures represent a novel culture method that combines advantages of
in vitro and in vivo environments. By maintaining the cytoarchitecture of the brain, cell
transplants are exposed to factors and environmental conditions similar to in vivo
transplants. In addition slice cultures allow for the direct manipulation and observation of
transplanted cells. Developing a novel mid-sagittal slice culture system that maintains an
intact nigrostriatal circuit was our first challenge. Once we accomplished creating the
slice model, our experiments demonstrated that both embryonic and adult stem cell fate
determination is dependent on the interplay of many different factors. The ability to
71
observe and manipulate these cells inside the neuronal environment is critical to better
understand how these transplants might behave in patients.
Cell transplants are being developed as a therapy for neurodegenerative diseases.
Our slice culture model provides a suitable paradigm to model nigrostriatal degeneration
and allows for a “Parkinson’s disease in a dish” system. This novel system maintains an
intact connection between the circuit components throughout the entire culturing period,
as opposed to other slice culture paradigms that rely on regrowth of axons in culture to
recreate connections in the dish. This model system can be used to observe the
endogenous cells within the slice, as well as test a variety of toxic or therapeutic agents.
Using 6-OHDA we have selectively degenerated the nigrostriatal circuit and generated a
model of PD that is amenable to testing therapeutic options such as stem cell replacement
therapies. Exposure to 6-OHDA induced a significant level of nigrostriatal degeneration,
causing an approximate 46% reduction in SNc cell bodies and a 60% reduction in striatal
dopamine innervation. These reductions are in the rage of those seen in early to mid stage
PD, and represent a reasonable level of degeneration at which to test cell replacement
strategies.
This model system is also amenable to future lesion options. Initial work is being
done on other potential toxic lesions, including using proteosome inhibitors. Previous
work using these compounds in animal models has shown degeneration in the
nigrostriatal circuit and evidence of lewy bodies inclusions. This toxin model may more
accurately model the progressive nature of PD, and recreate the key pathological
hallmark of intracellular inclusions. Using this toxin in a slice culture model should allow
for a detailed examination of how intracytoplasmic inclusions may initiate cellular
72
degeneration. Real time observation of cell states during inclusion generation may yield
clues as to what cellular processes or insults precipitate lewy body formation.
Besides toxic lesions, the availability of genetic mutants has allowed for the
examination of specific mutations on the development of neurodegeneration. Mutants
such as the alpha synuclein, and parkin mutations have provided valuable insight as to
what biochemically occurs in neuronal cells with known PD mutations. Slice cultures
allow for the examination of these mutant models, independent of co-morbidity factors
that are often present in these mutants. An example of this is the weaver mutation.
Weaver mutants display a severe cerebellar dysfunction and exhibit ataxia, as well as
progressive degeneration in the nigrostriatal circuit with a specific loss of A9 dopamine
neurons in the SNc (Triarhou, 2002). The mutation linked to weaver, the GIRK2
potassium channel mutation, has been shown to be important in A9 dopaminergic SNc
neurons genesis and survival (Triarhou et al., 1988). While this mutant shows some
useful features of PD, its limited lifespan, postnatal day 21 usually, makes it a difficult
animal model. We have cultured weaver brain slice cultures past this day 21 mark and
initial results suggest that the viability of non affected regions are not significantly
reduced. Since the cause of death in most of the mutants is a failure to thrive due to motor
deficits, the slice culture model is an effective way to track the ongoing degeneration
caused by the mutation independent of the animal. As more mutations are discovered in
familial and sporadic PD, the number of mutant models will increase, and this slice
culture model system represents a promising methodology to rapidly screen mutant
disease progression and therapeutic efficiencies.
73
ES cell derived neurons were implanted into slice cultures and survived and
integrated into the host tissue. This integration may be enhanced by the addition of
permissive ECM molecules that would increase cellular migration and process extension.
Experiments presented here have shown that adult neural stem cells show an increase in
migratory potential on laminin and fibronectin over CSPG. Based on these results, the
seeding of neural stem cells in different matrices may allow for a precise and directed
migratory pattern. Further development of ECM substrates may allow for the
development of grafts that could redirect endogenous stem cells to areas of damage and
degeneration and allow for in situ regeneration.
The presence of laminin with our transplanted ESNP’s enhanced their migratory
potential and integration into the slice. This observation may have important clinical
implications as stem cell transplantation strategies become more refined. The addition of
permissive ECM molecules to stem cell transplants in clinical settings may allow for
better cell survival and integration. ECM molecules have been implicated in ES derived
neuron maturation and phenotype fate. Understanding what ECM molecules direct ES
cell fate choice it may be possible to replicate this in transplants. As a general rule the
more immature a cell is the better chance that it has to survive and integrate into a host
environment. Being able to implant less mature ES derived neurons that can complete
their maturation and development within the host would allow for a better integration.
Directing ES and adult neural stem cells toward the appropriate phenotype is a
critical step in ensuring that the cells being transplanted respond in the correct
physiological manner. Our results with FGF8, SHH, and pleiotrophin, demonstrated that
cytokine exposure is a potent paradigm for inducing TH expression in ES derived
74
neurons and to a lesser extent adult neural stem cells. While the tested cells are positive
for tyrosine hydroxylase, there is still little evidence that these cells are actively releasing
dopamine. Future work on these induced cells will hopefully be able to analyze
conditioned media from these cells and assay the presence of dopamine or its metabolites
in the media. Even with appropriate release of dopamine, there are still hurdles in
reconnecting the circuitry. Recent evidence from patients treated with fetal dopaminergic
cells has suggested that the incidence of dyskinesia, abnormal and exaggerated motor
movements, is the result of inappropriate dopamine release, and loss of dopamine
reuptake, from the transplanted cells. Within the ventral mesencephalon there are two
distinct groups of dopamine cells, the A9 and A10 type cells. A9 cells of the SNc are
involved in the motor pathway and express dopamine autoreceptors that modulate
dopamine release. A10 cells of the ventral tegmental area are involved in reward
pathways with dopamine release, and lack the autoreceptor feedback. Since A9 and A10
cells are both part of the transplanted cell mixture put into the damaged striatum, there is
the potential for unregulated dopamine release that can lead to the dyskinesia..
Along with ESNP’s we examined the use of adult stem cells as an inducible cell
population. Our initial results suggest that adult derive neural stem cells could be induced
to generate TH+ cells. Further work to be done on fine tuning the dopaminergic
phenotype will likely focus on genetic manipulation, through induction of SNc specific
transcription factors. Analysis of different dopaminergic populations to better understand
which genetic factors are involved in the final differentiation should allow for production
of tailored neurons that provide the correct signal output. Coupled with the information
75
on stem cell behavior on various substrates, this presents a possible transplantation
enhancement strategy for use in cell replacement therapies in neurodegenerative diseases.
Nigrostriatal slice cultures provide an adaptable and scalable methodology for gene
therapy based approaches for prevention and/or treatment of Parkinson’s disease. Gene
therapy systems using AAV or Lentiviral vectors to introduce growth factors such as
brain derived growth factor (BDNF) or glial derived growth factor (GDNF) into animal
models of nigrostriatal degeneration (Bjorklund, 2000) . The ability to deliver gene
therapy agents directly to the brain regions of interest reduces the difficulty associated
with this procedure as well as allowing for a smaller volume to be more precisely
delivered. In addition there is initial data on the efficacy of using a polymer based gene
therapy system (Hofland, 1996) to introduce genes into glioblastomas located within slice
cultures.
One of the most promising potential applications for this slice culture model system
is the ability to do high throughput screening of compounds that either increase cellular
degeneration or ones that prevent it. Slice cultures allow for more experiments per animal
and for direct manipulation of the tissue and the environment. Using slice cultures from
the TH-GFP animals we have been able to show proof of concept that these slices can
provide a read out of TH innervation in real time. Using 6-OHDA we have noted a
significant reduction in GFP intensity within the striatum compared to control slices that
have been in culture for over a week. Using this system a large number of compounds
could be assayed and effects over time measured. Given the epidemiological data for
pesticides and heavy metal exposure, the TH-GFP slice culture system may provide a
76
way to track how important factors such dose and time of exposure are for the potential
toxicity of these compounds.
The research presented here describes a novel slice culture model system that
provides a “Parkinson’s in a dish” model system. Using this and in vitro cultures, we
have examined ES and adult neural stem cell differentiation, migration and integration
under a variety of conditions. Our results suggest that stem cells are greatly influenced by
their environment. Factors present during their culture can induce cell fate choices, and
can even promote hybrid cell types not normally seen in vivo. Extracellular matrix
molecules, such as laminin and fibronectin, can enhance stem cell migration, while ECM
such as chondroitin sulfate inhibits cell migration. In slice cultures laminin enhances stem
cell migration and morphological maturation. As stem cell therapy becomes more widely
available the need for information on how to condition these cells prior to transplantation
and how to best deliver and control them during and after transplantation will be key to
harnessing the power of these cells to rebuild damaged circuits and restore function.
LIST OF REFERENCES
Albin RL, Young AB, Penney JB (1995) The functional anatomy of disorders of the basal
ganglia. Trends Neurosci 18:63-64.
Altman J (1969a) Autoradiographic and histological studies of postnatal neurogenesis. 3.
Dating the time of production and onset of differentiation of cerebellar
microneurons in rats. J Comp Neurol 136:269-293.
Altman J (1969b) Autoradiographic and histological studies of postnatal neurogenesis.
IV. Cell proliferation and migration in the anterior forebrain, with special
reference to persisting neurogenesis in the olfactory bulb. J Comp Neurol
137:433-457.
Altman J, Das GD (1965) Autoradiographic and histological evidence of postnatal
hippocampal neurogenesis in rats. J Comp Neurol 124:319-335.
Altman J, Das GD (1966) Autoradiographic and histological studies of postnatal
neurogenesis. I. A longitudinal investigation of the kinetics, migration and
transformation of cells incorporating tritiated thymidine in neonate rats, with
special reference to postnatal neurogenesis in some brain regions. J Comp Neurol
126:337-389.
Anden NE, Dahlstroem A, Fuxe K, Larsson K (1965) Further Evidence for the Presence
of Nigro-Neostriatal Dopamine Neurons in the Rat. Am J Anat 116:329-333.
Anden NE, Dahlstrom A, Fuxe K, Larsson K (1966) Functional role of the nigroneostriatal dopamine neurons. Acta Pharmacol Toxicol (Copenh) 24:263-274.
Anden NE, Carlsson A, Dahlstroem A, Fuxe K, Hillarp NA, Larsson K (1964)
Demonstration and Mapping out of Nigro-Neostriatal Dopamine Neurons. Life
Sci 15:523-530.
Ansari SA, Nachanakian A, Biary NM (2002) Current surgical treatment of Parkinsons
disease. Saudi Med J 23:1319-1323.
Benninger F, Beck H, Wernig M, Tucker KL, Brustle O, Scheffler B (2003) Functional
integration of embryonic stem cell-derived neurons in hippocampal slice cultures.
J Neurosci 23:7075-7083.
77
78
Betarbet R, Sherer TB, Greenamyre JT (2005) Ubiquitin-proteasome system and
Parkinson's diseases. Exp Neurol 191 Suppl 1:S17-27.
Blandini F, Nappi G, Tassorelli C, Martignoni E (2000) Functional changes of the basal
ganglia circuitry in Parkinson's disease. Prog Neurobiol 62:63-88.
Bjorklund A, Kirik D, Rosenblad C, Georgievska B, Lundberg C, Mandel RJ (2000)
Towards a neuroprotective gene therapy for Parkinson's disease: use of
adenovirus, AAV and lentivirus vectors for gene transfer of GDNF to the
nigrostriatal system in the rat Parkinson model. Brain Res 886:82-98.
Bradbury EJ, Moon LD, Popat RJ, King VR, Bennett GS, Patel PN, Fawcett JW,
McMahon SB (2002) Chondroitinase ABC promotes functional recovery after
spinal cord injury. Nature 416:636-640.
Bradley A, Evans M, Kaufman MH, Robertson E (1984) Formation of germ-line
chimaeras from embryo-derived teratocarcinoma cell lines. Nature 309:255-256.
Braissant O, Wahli W (1998) Differential expression of peroxisome proliferator-activated
receptor-alpha, -beta, and -gamma during rat embryonic development.
Endocrinology 139:2748-2754.
Brazelton TR, Rossi FM, Keshet GI, Blau HM (2000) From marrow to brain: expression
of neuronal phenotypes in adult mice. Science 290:1775-1779.
Brotchie JM, Lee J, Venderova K (2005) Levodopa-induced dyskinesia in Parkinson's
disease. J Neural Transm 112:359-391.
Castellani RJ, Siedlak SL, Perry G, Smith MA (2000) Sequestration of iron by Lewy
bodies in Parkinson's disease. Acta Neuropathol (Berl) 100:111-114.
Cha GH, Kim S, Park J, Lee E, Kim M, Lee SB, Kim JM, Chung J, Cho KS (2005)
Parkin negatively regulates JNK pathway in the dopaminergic neurons of
Drosophila. Proc Natl Acad Sci U S A 102:10345-10350.
Chambers I, Colby D, Robertson M, Nichols J, Lee S, Tweedie S, Smith A (2003)
Functional expression cloning of Nanog, a pluripotency sustaining factor in
embryonic stem cells. Cell 113:643-655.
Deane KH, Spieker S, Clarke CE (2004) Catechol-O-methyltransferase inhibitors for
levodopa-induced complications in Parkinson's disease. Cochrane Database Syst
Rev:CD004554.
Diamond A, Jankovic J (2005) The effect of deep brain stimulation on quality of life in
movement disorders. J Neurol Neurosurg Psychiatry 76:1188-1193.
79
Doetsch F, Garcia-Verdugo JM, Alvarez-Buylla A (1999a) Regeneration of a germinal
layer in the adult mammalian brain. Proc Natl Acad Sci U S A 96:11619-11624.
Doetsch F, Caille I, Lim DA, Garcia-Verdugo JM, Alvarez-Buylla A (1999b)
Subventricular zone astrocytes are neural stem cells in the adult mammalian brain.
Cell 97:703-716.
Draper JS, Andrews PW (2002) Embryonic stem cells: advances toward potential
therapeutic use. Curr Opin Obstet Gynecol 14:309-315.
Dunnett SB, Rogers DC, Richards SJ (1989) Nigrostriatal reconstruction after 6-OHDA
lesions in rats: combination of dopamine-rich nigral grafts and nigrostriatal
"bridge" grafts. Exp Brain Res 75:523-535.
Franklin BJ, Paxinos, G.T. (1996) The Mouse Brain in Stereotaxic Coordinates. New
York: Academic Press.
Freed CR, Rosenberg NL, Schneck SA, Breeze RE (1992) Improved drug responsiveness
following fetal tissue implant for Parkinson's disease. Neurochem Int 20
Suppl:321S-327S.
Freed CR, Greene PE, Breeze RE, Tsai WY, DuMouchel W, Kao R, Dillon S, Winfield
H, Culver S, Trojanowski JQ, Eidelberg D, Fahn S (2001) Transplantation of
embryonic dopamine neurons for severe Parkinson's disease. N Engl J Med
344:710-719.
Gasser T (2005) Genetics of Parkinson's disease. Curr Opin Neurol 18:363-369.
Gates MA, O'Brien TF, Faissner A, Steindler DA (1993) Neuron-glial interactions during
the in vivo and in vitro development of the nigrostriatal circuit. J Chem Neuroanat
6:179-189.
George EL, Georges-Labouesse EN, Patel-King RS, Rayburn H, Hynes RO (1993)
Defects in mesoderm, neural tube and vascular development in mouse embryos
lacking fibronectin. Development 119:1079-1091.
Gerlach M, Riederer P (1996) Animal models of Parkinson's disease: an empirical
comparison with the phenomenology of the disease in man. J Neural Transm
103:987-1041.
Gerlach M, Double KL, Ben-Shachar D, Zecca L, Youdim MB, Riederer P (2003)
Neuromelanin and its interaction with iron as a potential risk factor for
dopaminergic neurodegeneration underlying Parkinson's disease. Neurotox Res
5:35-44.
Gibb WR, Lees AJ (1988) The relevance of the Lewy body to the pathogenesis of
idiopathic Parkinson's disease. J Neurol Neurosurg Psychiatry 51:745-752.
80
Glinka Y, Gassen M, Youdim MB (1997) Mechanism of 6-hydroxydopamine
neurotoxicity. J Neural Transm Suppl 50:55-66.
Gorell JM, Johnson CC, Rybicki BA, Peterson EL, Kortsha GX, Brown GG, Richardson
RJ (1997) Occupational exposures to metals as risk factors for Parkinson's
disease. Neurology 48:650-658.
Gould E, Reeves AJ, Graziano MS, Gross CG (1999) Neurogenesis in the neocortex of
adult primates. Science 286:548-552.
Greenamyre JT, Betarbet R, Sherer TB (2003) The rotenone model of Parkinson's
disease: genes, environment and mitochondria. Parkinsonism Relat Disord 9
Suppl 2:S59-64.
Grimpe B, Dong S, Doller C, Temple K, Malouf AT, Silver J (2002) The critical role of
basement membrane-independent laminin gamma 1 chain during axon
regeneration in the CNS. J Neurosci 22:3144-3160.
Gritti A, Rosati B, Lecchi M, Vescovi AL, Wanke E (2000) Excitable properties in
astrocytes derived from human embryonic CNS stem cells. Eur J Neurosci
12:3549-3559.
Hadjantonakis AK, Gertsenstein M, Ikawa M, Okabe M, Nagy A (1998) Generating
green fluorescent mice by germline transmission of green fluorescent ES cells.
Mech Dev 76:79-90.
Hauser RA, Freeman TB, Snow BJ, Nauert M, Gauger L, Kordower JH, Olanow CW
(1999) Long-term evaluation of bilateral fetal nigral transplantation in Parkinson
disease. Arch Neurol 56:179-187.
Heikkila RE, Sonsalla PK (1992) The MPTP-treated mouse as a model of parkinsonism:
how good is it? Neurochem Int 20 Suppl:299S-303S.
Hirsch EC, Faucheux BA (1998) Iron metabolism and Parkinson's disease. Mov Disord
13 Suppl 1:39-45.
Hofland HE, Shephard L, Sullivan SM (1996) Formation of stable cationic lipid/DNA
complexes for gene transfer. Proc Natl Acad Sci U S A 93:7305-7309.
Ianus A, Holz GG, Theise ND, Hussain MA (2003) In vivo derivation of glucosecompetent pancreatic endocrine cells from bone marrow without evidence of cell
fusion. J Clin Invest 111:843-850.
Ignatova TN, Kukekov VG, Laywell ED, Suslov ON, Vrionis FD, Steindler DA (2002)
Human cortical glial tumors contain neural stem-like cells expressing astroglial
and neuronal markers in vitro. Glia 39:193-206.
81
Isacson O, Bjorklund L, Pernaute RS (2001) Parkinson's disease: interpretations of
transplantation study are erroneous. Nat Neurosci 4:553.
Isacson O, Bjorklund LM, Schumacher JM (2003) Toward full restoration of synaptic
and terminal function of the dopaminergic system in Parkinson's disease by stem
cells. Ann Neurol 53 Suppl 3:S135-146; discussion S146-138.
Jenner P (2003) Oxidative stress in Parkinson's disease. Ann Neurol 53 Suppl 3:S26-36;
discussion S36-28.
Johnston TH, Brotchie JM (2004) Drugs in development for Parkinson's disease. Curr
Opin Investig Drugs 5:720-726.
Joseph C, Chassan JB, Koch ML (1978) Levodopa in Parkinson disease: a long-term
appraisal of mortality. Ann Neurol 3:116-118.
Jung CG, Hida H, Nakahira K, Ikenaka K, Kim HJ, Nishino H (2004) Pleiotrophin
mRNA is highly expressed in neural stem (progenitor) cells of mouse ventral
mesencephalon and the product promotes production of dopaminergic neurons
from embryonic stem cell-derived nestin-positive cells. Faseb J 18:1237-1239.
Kearns SM, Laywell ED, Kukekov VK, Steindler DA (2003) Extracellular matrix effects
on neurosphere cell motility. Exp Neurol 182:240-244.
Kearns SM, Scheffler B, Goetz AK, Lin DD, Baker HD, Roper SN, Mandel RJ, Steindler
DA (2006) A method for a more complete in vitro Parkinson's model: Slice
culture bioassay for modeling maintenance and repair of the nigrostriatal circuit. J
Neurosci Methods.
Keller GM (1995) In vitro differentiation of embryonic stem cells. Curr Opin Cell Biol
7:862-869.
Kluge A, Hailer NP, Horvath TL, Bechmann I, Nitsch R (1998) Tracing of the
entorhinal-hippocampal pathway in vitro. Hippocampus 8:57-68.
Kornack DR, Rakic P (2001) Cell proliferation without neurogenesis in adult primate
neocortex. Science 294:2127-2130.
Kress GJ, Reynolds IJ (2005) Dopaminergic neurotoxins require excitotoxic stimulation
in organotypic cultures. Neurobiol Dis.
Kuhn HG, Dickinson-Anson H, Gage FH (1996) Neurogenesis in the dentate gyrus of the
adult rat: age-related decrease of neuronal progenitor proliferation. J Neurosci
16:2027-2033.
82
Lai BC, Marion SA, Teschke K, Tsui JK (2002) Occupational and environmental risk
factors for Parkinson's disease. Parkinsonism Relat Disord 8:297-309.
Landolt RM, Vaughan L, Winterhalter KH, Zimmermann DR (1995) Versican is
selectively expressed in embryonic tissues that act as barriers to neural crest cell
migration and axon outgrowth. Development 121:2303-2312.
Laywell ED, Dorries U, Bartsch U, Faissner A, Schachner M, Steindler DA (1992)
Enhanced expression of the developmentally regulated extracellular matrix
molecule tenascin following adult brain injury. Proc Natl Acad Sci U S A
89:2634-2638.
Laywell ED, Rakic P, Kukekov VG, Holland EC, Steindler DA (2000) Identification of a
multipotent astrocytic stem cell in the immature and adult mouse brain. Proc Natl
Acad Sci U S A 97:13883-13888.
Laywell ED, Kukekov VG, Suslov O, Zheng T, Steindler DA (2002) Production and
analysis of neurospheres from acutely dissociated and postmortem CNS
specimens. Methods Mol Biol 198:15-27.
Laywell ED, Kearns SM, Zheng T, Chen KA, Deng J, Chen HX, Roper SN, Steindler DA
(2005) Neuron-to-astrocyte transition: phenotypic fluidity and the formation of
hybrid asterons in differentiating neurospheres. J Comp Neurol 493:321-333.
Linert W, Herlinger E, Jameson RF, Kienzl E, Jellinger K, Youdim MB (1996)
Dopamine, 6-hydroxydopamine, iron, and dioxygen--their mutual interactions and
possible implication in the development of Parkinson's disease. Biochim Biophys
Acta 1316:160-168.
Lois C, Alvarez-Buylla A (1993) Proliferating subventricular zone cells in the adult
mammalian forebrain can differentiate into neurons and glia. Proc Natl Acad Sci
U S A 90:2074-2077.
Lozano AM, Eltahawy H (2004) How does DBS work? Suppl Clin Neurophysiol 57:733736.
Lucking CB, Durr A, Bonifati V, Vaughan J, De Michele G, Gasser T, Harhangi BS,
Meco G, Denefle P, Wood NW, Agid Y, Brice A (2000) Association between
early-onset Parkinson's disease and mutations in the parkin gene. French
Parkinson's Disease Genetics Study Group. N Engl J Med 342:1560-1567.
Lyons KE, Pahwa R (2005) Long-term benefits in quality of life provided by bilateral
subthalamic stimulation in patients with Parkinson disease. J Neurosurg 103:252255.
83
Magavi SS, Leavitt BR, Macklis JD (2000) Induction of neurogenesis in the neocortex of
adult mice. Nature 405:951-955.
Martin MJ, Muotri A, Gage F, Varki A (2005) Human embryonic stem cells express an
immunogenic nonhuman sialic acid. Nat Med 11:228-232.
Matthias K, Kirchhoff F, Seifert G, Huttmann K, Matyash M, Kettenmann H, Steinhauser
C (2003) Segregated expression of AMPA-type glutamate receptors and
glutamate transporters defines distinct astrocyte populations in the mouse
hippocampus. J Neurosci 23:1750-1758.
McNaught KS, Bjorklund LM, Belizaire R, Isacson O, Jenner P, Olanow CW (2002)
Proteasome inhibition causes nigral degeneration with inclusion bodies in rats.
Neuroreport 13:1437-1441.
Moon LD, Brecknell JE, Franklin RJ, Dunnett SB, Fawcett JW (2000) Robust
regeneration of CNS axons through a track depleted of CNS glia. Exp Neurol
161:49-66.
Morrison SJ, Shah NM, Anderson DJ (1997) Regulatory mechanisms in stem cell
biology. Cell 88:287-298.
Mueller JC, Fuchs J, Hofer A, Zimprich A, Lichtner P, Illig T, Berg D, Wullner U,
Meitinger T, Gasser T (2005) Multiple regions of alpha-synuclein are associated
with Parkinson's disease. Ann Neurol 57:535-541.
Niwa H, Miyazaki J, Smith AG (2000) Quantitative expression of Oct-3/4 defines
differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet 24:372376.
Novak U, Kaye AH (2000) Extracellular matrix and the brain: components and function.
J Clin Neurosci 7:280-290.
Okabe S, Forsberg-Nilsson K, Spiro AC, Segal M, McKay RD (1996) Development of
neuronal precursor cells and functional postmitotic neurons from embryonic stem
cells in vitro. Mech Dev 59:89-102.
Olanow CW, Goetz CG, Kordower JH, Stoessl AJ, Sossi V, Brin MF, Shannon KM,
Nauert GM, Perl DP, Godbold J, Freeman TB (2003) A double-blind controlled
trial of bilateral fetal nigral transplantation in Parkinson's disease. Ann Neurol
54:403-414.
84
Olanow CW, Agid Y, Mizuno Y, Albanese A, Bonuccelli U, Damier P, De Yebenes J,
Gershanik O, Guttman M, Grandas F, Hallett M, Hornykiewicz O, Jenner P,
Katzenschlager R, Langston WJ, LeWitt P, Melamed E, Mena MA, Michel PP,
Mytilineou C, Obeso JA, Poewe W, Quinn N, Raisman-Vozari R, Rajput AH,
Rascol O, Sampaio C, Stocchi F (2004) Levodopa in the treatment of Parkinson's
disease: current controversies. Mov Disord 19:997-1005.
Pals P, Lincoln S, Manning J, Heckman M, Skipper L, Hulihan M, Van den Broeck M,
De Pooter T, Cras P, Crook J, Van Broeckhoven C, Farrer MJ (2004) alphaSynuclein promoter confers susceptibility to Parkinson's disease. Ann Neurol
56:591-595.
Pankratz N, Foroud T (2004) Genetics of Parkinson disease. NeuroRx 1:235-242.
Parkinson J (1817) An Essay on the Shaking Palsy. London: Whittingham and Rowland.
Perryman SV, Sylvester KG (2006) Repair and regeneration: opportunities for
carcinogenesis from tissue stem cells. J Cell Mol Med 10:292-308.
Petit A, Kawarai T, Paitel E, Sanjo N, Maj M, Scheid M, Chen F, Gu Y, Hasegawa H,
Salehi-Rad S, Wang L, Rogaeva E, Fraser P, Robinson B, St George-Hyslop P,
Tandon A (2005) Wild-type PINK1 prevents basal and induced neuronal
apoptosis, a protective effect abrogated by Parkinson disease-related mutations. J
Biol Chem 280:34025-34032.
Polymeropoulos MH, Lavedan C, Leroy E, Ide SE, Dehejia A, Dutra A, Pike B, Root H,
Rubenstein J, Boyer R, Stenroos ES, Chandrasekharappa S, Athanassiadou A,
Papapetropoulos T, Johnson WG, Lazzarini AM, Duvoisin RC, Di Iorio G, Golbe
LI, Nussbaum RL (1997) Mutation in the alpha-synuclein gene identified in
families with Parkinson's disease. Science 276:2045-2047.
Priyadarshi A, Khuder SA, Schaub EA, Shrivastava S (2000) A meta-analysis of
Parkinson's disease and exposure to pesticides. Neurotoxicology 21:435-440.
Rakic P (1985) DNA synthesis and cell division in the adult primate brain. Ann N Y
Acad Sci 457:193-211.
Rogers SL, Letourneau PC, Palm SL, McCarthy J, Furcht LT (1983) Neurite extension
by peripheral and central nervous system neurons in response to substratumbound fibronectin and laminin. Dev Biol 98:212-220.
Rosegay H (1944) An experimental investigation of the connections between the corpus
striatum and the substantia nigra in the cat. Journal of Comparative Neurology
80:293-321.
85
Rybicki BA, Johnson CC, Peterson EL, Kortsha GX, Gorell JM (1999) A family history
of Parkinson's disease and its effect on other PD risk factors. Neuroepidemiology
18:270-278.
Scheffler B, Schmandt T, Schroder W, Steinfarz B, Husseini L, Wellmer J, Seifert G,
Karram K, Beck H, Blumcke I, Wiestler OD, Steinhauser C, Brustle O (2003)
Functional network integration of embryonic stem cell-derived astrocytes in
hippocampal slice cultures. Development 130:5533-5541.
Shimura H, Schlossmacher MG, Hattori N, Frosch MP, Trockenbacher A, Schneider R,
Mizuno Y, Kosik KS, Selkoe DJ (2001) Ubiquitination of a new form of alphasynuclein by parkin from human brain: implications for Parkinson's disease.
Science 293:263-269.
Silberstein P, Oliviero A, Di Lazzaro V, Insola A, Mazzone P, Brown P (2005)
Oscillatory pallidal local field potential activity inversely correlates with limb
dyskinesias in Parkinson's disease. Exp Neurol 194:523-529.
Singleton AB, Farrer M, Johnson J, Singleton A, Hague S, Kachergus J, Hulihan M,
Peuralinna T, Dutra A, Nussbaum R, Lincoln S, Crawley A, Hanson M,
Maraganore D, Adler C, Cookson MR, Muenter M, Baptista M, Miller D,
Blancato J, Hardy J, Gwinn-Hardy K (2003) alpha-Synuclein locus triplication
causes Parkinson's disease. Science 302:841.
Smeyne RJ, Jackson-Lewis V (2005) The MPTP model of Parkinson's disease. Brain Res
Mol Brain Res 134:57-66.
Smith AG, Heath JK, Donaldson DD, Wong GG, Moreau J, Stahl M, Rogers D (1988)
Inhibition of pluripotential embryonic stem cell differentiation by purified
polypeptides. Nature 336:688-690.
Steindler DA, Cooper NG, Faissner A, Schachner M (1989) Boundaries defined by
adhesion molecules during development of the cerebral cortex: the J1/tenascin
glycoprotein in the mouse somatosensory cortical barrel field. Dev Biol 131:243260.
Steindler DA, O'Brien TF, Laywell E, Harrington K, Faissner A, Schachner M (1990)
Boundaries during normal and abnormal brain development: in vivo and in vitro
studies of glia and glycoconjugates. Exp Neurol 109:35-56.
Steindler DA (1993) Glial boundaries in the developing nervous system. Annu Rev
Neurosci 16:445-470.
86
Takagi Y, Takahashi J, Saiki H, Morizane A, Hayashi T, Kishi Y, Fukuda H, Okamoto
Y, Koyanagi M, Ideguchi M, Hayashi H, Imazato T, Kawasaki H, Suemori H,
Omachi S, Iida H, Itoh N, Nakatsuji N, Sasai Y, Hashimoto N (2005)
Dopaminergic neurons generated from monkey embryonic stem cells function in a
Parkinson primate model. J Clin Invest 115:102-109.
Theise ND, Nimmakayalu M, Gardner R, Illei PB, Morgan G, Teperman L, Henegariu O,
Krause DS (2000) Liver from bone marrow in humans. Hepatology 32:11-16.
Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshall VS,
Jones JM (1998) Embryonic stem cell lines derived from human blastocysts.
Science 282:1145-1147.
Treloar HB, Nurcombe V, Key B (1996) Expression of extracellular matrix molecules in
the embryonic rat olfactory pathway. J Neurobiol 31:41-55.
Triarhou LC (2002) Biology and pathology of the Weaver mutant mouse. Adv Exp Med
Biol 517:15-42.
Triarhou LC, Norton J, Ghetti B (1988) Mesencephalic dopamine cell deficit involves
areas A8, A9 and A10 in weaver mutant mice. Exp Brain Res 70:256-265.
Ungerstedt U (1968) 6-Hydroxy-dopamine induced degeneration of central monoamine
neurons. Eur J Pharmacol 5:107-110.
Valente EM, Abou-Sleiman PM, Caputo V, Muqit MM, Harvey K, Gispert S, Ali Z, Del
Turco D, Bentivoglio AR, Healy DG, Albanese A, Nussbaum R, GonzalezMaldonado R, Deller T, Salvi S, Cortelli P, Gilks WP, Latchman DS, Harvey RJ,
Dallapiccola B, Auburger G, Wood NW (2004) Hereditary early-onset
Parkinson's disease caused by mutations in PINK1. Science 304:1158-1160.
Valldeoriola F, Martinez-Rodriguez J, Tolosa E, Rumia J, Alegret M, Pilleri M, Ferrer E
(2002) Four year follow-up study after unilateral pallidotomy in advanced
Parkinson's disease. J Neurol 249:1671-1677.
Walter BL, Vitek JL (2004) Surgical treatment for Parkinson's disease. Lancet Neurol
3:719-728.
Weiss S, Dunne C, Hewson J, Wohl C, Wheatley M, Peterson AC, Reynolds BA (1996)
Multipotent CNS stem cells are present in the adult mammalian spinal cord and
ventricular neuroaxis. J Neurosci 16:7599-7609.
Xu C, Inokuma MS, Denham J, Golds K, Kundu P, Gold JD, Carpenter MK (2001)
Feeder-free growth of undifferentiated human embryonic stem cells. Nat
Biotechnol 19:971-974.
87
Youdim MB, Ben-Shachar D, Riederer P (1989) Is Parkinson's disease a progressive
siderosis of substantia nigra resulting in iron and melanin induced
neurodegeneration? Acta Neurol Scand Suppl 126:47-54.
Zeng X, Cai J, Chen J, Luo Y, You ZB, Fotter E, Wang Y, Harvey B, Miura T, Backman
C, Chen GJ, Rao MS, Freed WJ (2004) Dopaminergic differentiation of human
embryonic stem cells. Stem Cells 22:925-940.
Zhang Y, Gao J, Chung KK, Huang H, Dawson VL, Dawson TM (2000) Parkin functions
as an E2-dependent ubiquitin- protein ligase and promotes the degradation of the
synaptic vesicle-associated protein, CDCrel-1. Proc Natl Acad Sci U S A
97:13354-13359.
Zipori D (2005) The stem state: plasticity is essential, whereas self-renewal and hierarchy
are optional. Stem Cells 23:719-726.
BIOGRAPHICAL SKETCH
Sean Kearns was born October 29th 1977 in Gainesville, Florida and attended
Eastside high school’s International Baccalaureate (I.B.) program where a psychology
class sparked his interest in neuroscience. Sean attended the University of Florida and
received his degree in neuroscience in 2000. From there he decided to pursue
neuroscience in the newly completed McKnight Brain Institute. A fortuitous meeting
with Dr. Dennis Steindler led Sean to the new and exciting field of stem cell biology.
Sean pursued his Ph.D. doing research relating to Parkinson’s disease and potential
therapies using adult and embryonic stem cells. When not in the lab, Sean is an avid Star
Wars fan and collector. He also makes time each year to go someplace new to camp,
hike, and fish. He shares his home with his lovely wife Debbie, and their two cats Tigger
and Starbuck.
88