Download -Chain Gene Promoter ζ Antigen Receptor Elf

Elf-1 Regulates Basal Expression from the T Cell
Antigen Receptor ζ-Chain Gene Promoter
This information is current as
of August 3, 2017.
Subscription
Permissions
Email Alerts
J Immunol 1998; 160:2794-2801; ;
http://www.jimmunol.org/content/160/6/2794
This article cites 42 articles, 28 of which you can access for free at:
http://www.jimmunol.org/content/160/6/2794.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 1998 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
References
Barbara L. Rellahan, Jane P. Jensen, Thomas K. Howcroft, Dinah
S. Singer, Ezio Bonvini and Allan M. Weissman
Elf-1 Regulates Basal Expression from the T Cell Antigen
Receptor z-Chain Gene Promoter1
Barbara L. Rellahan,2* Jane P. Jensen,† Thomas K. Howcroft,‡ Dinah S. Singer,‡
Ezio Bonvini,* and Allan M. Weissman†
T
he ability of T cells to recognize foreign Ags is dependent
on cell surface expression of the multisubunit TCR. Cell
surface expression of TCRs, in turn, requires the proper
assembly of complete receptors in the endoplasmic reticulum.
While most TCR components are synthesized in excess and are
degraded either in the endoplasmic reticulum or in lysosomes, the
TCR-z subunit is synthesized in limiting amounts. Because of this,
the level of expression of z regulates the assembly of complete
receptors and ultimately the steady state cell surface expression of
TCRs (1; reviewed in Ref. 2). The importance of regulated z transcription in normal T cell development is underscored by the profound defects in thymocyte development exhibited by mice that
either overexpress or are deficient in expression of z (3, 4). In
addition to its role in receptor assembly, z is a key signal transducing component of the TCR that couples TCR engagement to
the activation of protein tyrosine kinases. In fact, z is capable of
activating T cells independently of the other TCR components
(5–7) and is itself a substrate for activation-dependent tyrosine
phosphorylation (8, 9) as well as ubiquitination (10).
When the 59 region of the z gene was evaluated for elements
responsible for its tissue-specific expression, an extended promoter
*Laboratory of Immunobiology, Center for Biologics Evaluation and Research, Food
and Drug Administration, Bethesda, MD 20892; and †Laboratory of Immune Cell
Biology, National Cancer Institute, and ‡Experimental Immunology Branch, National
Cancer Institute, National Institutes of Health, Bethesda, MD 20892
Received for publication July 24, 1997. Accepted for publication November 18, 1997.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported in part by a National Research Council Associateship (to
B.L.R.).
2
Address correspondence and reprint requests to Dr. Barbara L. Rellahan, Laboratory
of Immunobiology, Center for Biologics Evaluation and Research, Food and Drug
Administration, Building 29B, Room 5E16, HFM 564, 1401 Rockville Pike, Rockville, MD 20892. E-mail address: [email protected]
Copyright © 1998 by The American Association of Immunologists
was identified between 2307 and 158 relative to the most 39
major site of transcription initiation (11). This region includes at
least two distinct basal promoter elements that independently initiate transcription from the z gene. Neither element contains a
TATA box, nor are they overly GC rich. One of these elements,
designated Pz1, extends from 269 to 158 and has equivalent activity in T cell and some non-T cell lines. The other promoter
element, Pz2, localizes to a 17-bp stretch between 2120 and
2103. Pz2 demonstrates high basal activity in T cells, but only
marginal activity in non-T cell lines, and constitutes the only example of a tissue-restricted promoter for a TCR subunit. There are
several potential binding sites for T cell-specific transcription factors within the z promoter, including three GATA-3 binding sites
(12, 13) between 2268 and 2247 and two canonical Ets-family
binding sites (14) at 2135 and 252.
Members of the Ets proto-oncogene family share a high degree
of homology in their DNA binding domains. These DNA binding
domains are characterized by basic and a-helical subdomains that
are homologous to those of heat shock factors (14 –17). Ets family
proteins bind to a GGAA/T core motif, with the relative specificity
of individual family members dependent upon flanking sequences
(14). T lymphocytes express several different Ets proteins, some of
which play a role in basal and activation-dependent expression of
T cell-specific genes, such as those encoding IL-2, the IL-2R
b-chain, p56lck, the TCR-a and TCR-b chains, and CD4 (18 –23).
Elf-1, a member of this transcription factor family, is required for
inducible T cell-specific trans-activation of a number of genes
(24 –29). The ability of Elf-1 to mediate activation-dependent gene
expression appears to be due to both its release from the retinoblastoma gene product (Rb) after activation and its interaction with
other activation-dependent transcription factors (24 –30). This report demonstrates that Elf-1 interacts with the two Ets binding sites
within the TCR-z gene promoter and that this Elf-1 association is
required for basal expression from the TCR-z promoter.
0022-1767/98/$02.00
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
In mature T cells, limited synthesis of the TCR-z subunit is primarily responsible for regulating surface expression of TCRs.
Transcription of z is directed by a complex promoter that includes two potential binding sites for the Ets family of transcription
factors at 252 (zEBS1) and 2135 (zEBS2). Mutation of these two sites results in a marked reduction of transcription from this
promoter. Using electrophoretic mobility shift analysis, Elf-1 was demonstrated to be the Ets family member that binds to these
sites. One site, zEBS1, matches the optimal Elf-1 consensus sequence in eight of nine bases, making it the best match of any known
mammalian Elf-1 binding site. A role for Elf-1 in TCR-z trans-activation was confirmed by ectopic expression of Elf-1 in COS-7
cells. This resulted in an increase in TCR-z promoter activity that mapped to zEBS1 and zEBS2. Additional support for the
involvement of Elf-1 in TCR-z trans-activation derives from the finding that a GAL4-Elf-1 fusion protein trans-activated TCR-z
promoter constructs that had been modified to contain GAL4 DNA binding sites. These results demonstrate that Elf-1 plays an
essential role in the trans-activation of a constitutively expressed T cell-specific gene, and that trans-activation occurs in the context
of the native promoter in both lymphoid and nonlymphoid cells. Taken together with the existing literature, these data also suggest
that the requirement for inducible factors in Elf-1-mediated trans-activation may decrease as the affinity and number of Elf-1 sites
increase. The Journal of Immunology, 1998, 160: 2794 –2801.
The Journal of Immunology
2795
Materials and Methods
Electrophoretic mobility shift assays
Cells and reagents
Binding reaction mixtures (20 ml) contained 6 mg of Jurkat nuclear extracts, 25,000 cpm of probe, 2 mg of poly(dI-dC) in 10 mM Tris-HCl (pH
7.5), 10 mM HEPES, 50 mM KCl, 2.5 mM DTT, 0.5 mM EDTA, and 12%
glycerol. Following incubation on ice for 30 min, DNA-protein complexes
were resolved on 5% polyacrylamide gels (acrylamide/bis-acrylamide,
29/1) run in Tris-borate buffer (22.3 mM Tris, 22.3 mM boric acid, and 0.5
mM EDTA) at 140 V for 2.5 h at room temperature. In some experiments
1 ml of specific Ab or 1 ml of unlabeled oligonucleotide competitor was
incubated with protein for 15 min on ice before the addition of probe. After
an additional 15-min incubation, samples were resolved on gels as described above. Samples that had been incubated with either of the antihuman Elf-1 Abs were resolved on polyacrylamide gels in the cold.
Jurkat and COS-7 cells were maintained as previously described (11, 31).
Restriction enzymes were purchased from either New England Biolabs
(Beverly, MA) or Pharmacia/LKB (Piscataway, NJ). Anti-human Elf-1
mAbs, 6G7 and 5A3, were provided by Dr. Jeffrey M. Leiden (University
of Chicago, Chicago, IL) and recognize NH2- and COOH-terminal
epitopes of Elf-1, respectively (J. M. Leiden, unpublished observations).
Anti-human Ets-1 (SC-350) was purchased from Santa Cruz Biotechnology (Santa Cruz, CA).
Plasmids and oligonucleotides
Luciferase and chloramphenicol acetyltransferase (CAT) assays
All plasmids were purified by double banding over cesium chloride; 15 mg
of reporter construct was used in all transfection assays, except as noted.
One microgram of a b-galactosidase construct driven by the CMV promoter was used in all studies to control for transfection efficiency. Luciferase and CAT assays were performed 24 h after transfection as previously
described (11, 31). Relative luciferase activity was calculated as the luciferase activity of the indicated constructs normalized to an empty vector
control (pGL-2 Basic) as described previously (11).
3
Abbreviations used in this paper: EMSA, electrophoretic mobility shift assay; MSVLTR, Moloney murine sarcoma virus-long terminal repeat; CAT, chloramphenicol
acetyltransferase; NF-AT, nuclear factor of activated T cells; TdT, terminal deoxynucleotidyl transferase.
Results
Ets family binding sites zEBS1 and zEBS2 are required for
transcription from the TCR-z promoter
The z promoter (2307/158) includes two minimal promoter elements, Pz1(269/158) and Pz2 (2120/2103), both of which can
direct basal levels of transcription (11) (Fig. 1A). Two potential
Ets family binding sites are located at positions 252 (zEBS1) and
2135 (zEBS2); zEBS1 is located within Pz1, and zEBS2 is located
15 bases upstream of Pz2 (Fig. 1A). To assess the significance of
zEBS1 on transcription from Pz1, zEBS1 was mutated in a construct that contained only the Pz1 promoter (Pz1DzEBS1). Transient expression in Jurkat cells demonstrated that mutation of
zEBS1 resulted in a 75% reduction in Pz1 activity (Fig. 1B), suggesting that a factor that binds to this site is required for Pz1
activity.
To determine the role of the two Ets binding sites in transcription from the full-length z promoter (2307/158), one or both elements were mutated to generate FLDzEBS1, FLDzEBS2, and
FLDzEBS112, respectively. While mutation of either zEBS1 or
zEBS2 had no effect on promoter activity in Jurkat cells, mutation
of both zEBS1 and zEBS2 resulted in an 80% decrease in z promoter activity (Fig. 1C). These data suggest that TCR-z gene transcription is substantially dependent upon an Ets element, and that
either zEBS1 or zEBS2 is capable of supporting transcription from
the TCR-z promoter.
Elf-1 binds to both zEBS1 and zEBS2
To identify proteins that bind zEBS1, EMSAs were performed.
Using Jurkat nuclear extracts and a 32P-labeled double-stranded
oligonucleotide probe encompassing zEBS1 (266 to 233), a single prominent complex, C1, was observed (Fig. 2A, first lane). C1
was competed by an unlabeled zEBS1 oligonucleotide, but not by
an oligonucleotide in which zEBS1 was mutated (266/233 Ets
M) or by a zEBS2 oligonucleotide that had a mutated Ets site
(2147/2119 Ets M). This demonstrates that C1 arises due to specific binding to zEBS1. DNA binding by Ets family proteins is
dependent on the core consensus sequence, with specificity imparted by flanking nucleotide sequences (14). Therefore, in
EMSAs, competition using oligonucleotides that bind particular
family members with high affinity may be used to discriminate
among Ets family members (22). Because resting T cells express
Ets-1, Ets-2, and Elf-1, canonical binding sites for these proteins
were used as competitors for the formation of C1. As shown (Fig.
2B), a known high affinity binding site for Elf-1 (E74) competed
for formation of C1 even more efficiently than did an unlabeled
zEBS1-containing oligonucleotide. Consensus binding sites for
Ets-1 (MSV-LTR) and Ets-2 (MSV-LTR and polyomavirus enhancer activator 3 (PEA3) were at least 10-fold less efficient at
competition than unlabeled zEBS1. These data suggest that Elf-1
is the Ets family member that binds to zEBS1. To establish that
Elf-1 was present in the C1 complex, supershift analyses were
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
The human Elf-1 expression vector pcDElf-1 (25) was provided by
W. Leonard (National Heart, Lung, and Blood Institute, National Institutes
of Health, Bethesda, MD). TCR-z promoter constructs from 2307 to 158
and from 269 to 158 have been described previously (11). The Ets element mutants FLDzEBS1 and FLDzEBS2 were generated by PCR. To
generate FLDzEBS1, a sense oligonucleotide with a 6-bp mutation (indicated in boldface) in the 252 Ets binding site (CCATGATCAGGGGAGG
TAGCTGCAG) and a 39 antisense oligonucleotide (TATATAAGCTTTC
CCTCAGAAAGAGGCTGGG) were used in PCR with 2307/158 DNA
as a template. Similarly, an antisense oligonucleotide containing the same
mutation (ACCTCCCCTGATCATGGAGGACTGTGGGGCC) and a 59
sense oligonucleotide (TATATCTCGAGCCATCGAGAACTTGTATTT
GCC) were used for amplification. Products were purified, combined, and
reamplified with the 59 sense and 39 antisense oligonucleotides. The resulting fragment was cloned into pGL-2 Basic after digestion with HindIII
and XhoI. FLDzEBS2 was generated in the same manner with a sense
oligonucleotide that contained a mutation in zEBS2 (mutation in boldface;
CCAGGGCATATGGCCTGTGAACCGAAAGGG) and an antisense oligonucleotide with the same mutation (CACAGGCCATATGCCCT
GGAGGTTTGAGGGTTTG). The same design used to make FLDzEBS1
was used to make FLDzEBS112, except with FLDzEBS2 as the original
PCR template. Pz1DzEBS1 was generated using a sense oligonucleotide
with a point mutation in zEBS1 (indicated in boldface; TATATCTC
GAGGGCCCCACAGTCCTCCACTTGCTGGGG) and the already described 39 oligonucleotide primer. The GAL4-VP16 expression construct
(32) was provided by V. Seyfert (National Cancer Institute, National Institutes of Health). G5BCAT-SP (33) was provided by G. Chinnadurai (St.
Louis University Medical Center, St. Louis, MO), and pSG424 (32) was
provided by M. Ptashne (Harvard University, Boston, MA). To generate
GAL4-ELF, an EcoRV site was placed into pSG424 by cloning a doublestranded oligonucleotide with an EcoRV site into the BamHI/KpnI sites of
the pSG424 polylinker. This construct was designated pSG424.RV. Elf-1
was excised from pcDElf-1 by digestion with EcoRV and XbaI and cloned
into the EcoRV and XbaI sites of pSG424.RV.
The double-stranded oligonucleotides used in electrophorectic mobility
shift assays (EMSAs)3 were as follows (the Ets site motif is underlined, and
mutations of this site are in boldface): TCR-z 266/233, 59-TCGAGA
CAGTCCTCCACTTCCTGGGGAGGTAGCTGCA-39; 266/233 mutation (266/233 Ets M), 59-AGACAGTCCTCCATGATCAGGGGAGG
TAGCTGCA-39; TCR-z 2147/2119, 59-TCGAGAACCTCCAGGGCTT
CCTGCCTGTGAACCA-39; 2147/2119 mutation (2147/2119 Ets M),
59-TCGAGAACCTCCAGGGCATATGGCCTGTGAACCA-39;
E74,
59-AGCTTCTCTAGCTGAATAACCGGAAGTAACTCATCG-39 (22);
MSV-LTR, 59-AGCTTCTCGGAGAGCGGAAGCGCGCG-39 (22); and
polyoma virus enhancer activator 3 (PEA3), 59-AGCTTCGAGCAGGAAGT
TCGG-39 (22). Oligonucleotides were synthesized on an Applied Biosystems
model 392 synthesizer (Foster City, CA).
2796
ELF-1 REGULATES THE TCR-z PROMOTER
performed with two mAbs with specificities for different regions of
human Elf-1 (Fig. 2C). Addition of either Ab resulted in a complete supershift of C1, while the formation and mobility of C1
were unaffected by Abs to Ets-1, Fli-1, or NF-AT (data not
shown). These findings establish Elf-1 as the Ets family member
that interacts with zEBS1.
Parallel studies were performed on the upstream Ets site,
zEBS2, using a 32P-labeled double-stranded zEBS2-containing
oligonucleotide probe (bases 2147 to 2119). As with zEBS1, a
single prominent complex (C2) was observed that was competed
by unlabeled zEBS2 but not by a mutated 2147 to 2119 oligonucleotide in which the Ets consensus sequence was altered
(2147/2119 Ets M; Fig. 3). Competition studies again suggested
that Elf-1 was binding zEBS2, since the E74 and zEBS1 (266 to
233) oligonucleotides both competed at least as efficiently as unlabeled zEBS2 (Fig. 3 and data not shown). However, a canonical
Ets-1 binding site (MSV-LTR) also inhibited formation of C2,
although to a lesser extent than E74 and zEBS1 (Fig. 3 and data not
shown). To determine whether Elf-1 or Ets-1 was binding to
zEBS2 in EMSA, Abs specific for Ets-1 or Elf-1 were evaluated in
supershift assays. Two different anti-Elf-1 mAbs completely supershifted C2 (Fig. 3), whereas the anti-Ets-1 Ab affected neither
the formation nor the mobility of C2. Thus, like C1, the C2 complex contains Elf-1.
Elf-1 trans-activates the TCR-z promoter
Because Jurkat cells express substantial levels of Elf-1, ectopic
expression of Elf-1 would not be expected to appreciably affect
transcription from the TCR-z promoter in these cells, and in fact,
no up-regulation was observed in transient transfection assays
(data not shown). To determine whether Elf-1 can support z promoter activity in T cells, a fusion protein, GAL4-ELF, containing
the DNA binding domain of GAL4 (amino acids 1–147) and the
entire human Elf-1 protein (amino acids 1– 619), was assayed for
its ability to activate two TCR-z promoter constructs containing
engineered GAL4 binding sites (Pz1.2xGAL4 and FL.GAL4).
Pz1.2xGAL4 consists of the Pz1 promoter region (269/158) with
a mutated zEBS1 and two GAL4 binding sites immediately upstream of 269 (Fig. 4). Coexpression of the GAL4-Elf-1 fusion
protein in Jurkat cells resulted in trans-activation of Pz1.2xGAL4
in a dose-dependent manner (Fig. 4, A and B). FL.GAL4 includes
a full z promoter (2307/158) in which zEBS1 was destroyed by
point mutation, and zEBS2 replaced with a GAL4 DNA binding
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
FIGURE 1. The binding sites zEBS1
and zEBS2 are required for transcription
from the TCR-z chain promoter. A, Schematic representation of the TCR-z promoter region. The relative location and
sequence of the Ets-binding sites, zEBS1
and zEBS2, in the TCR-z chain promoter
are shown. The positions of the core promoters (Pz1 (;) and Pz2 (3)) are indicated. Major sites of transcription initiation are indicated with arrows. B,
Evaluation of the role of zEBS1 in Pz1
activity. C, Assessment of the role of
zEBS1 and zEBS2 in transcription from
the full TCR-z promoter region. Shown
are the relative luciferase activities for
the promoter constructs that are schematized to the left of each graph. The data in
each panel are derived from triplicate
points from a representative experiment;
error bars indicate 6SD.
The Journal of Immunology
2797
FIGURE 2. Elf-1 is the Ets family
member that binds to zEBS1. EMSAs
used the 32P-labeled 266/233 (zEBS1)
probe and 6 mg of Jurkat nuclear extract. A
and B show competition analysis with the
indicated unlabeled double-stranded oligonucleotides. 266/233 Ets M and
2147/2119 Ets M are oligonucleotides
that have a mutated Ets binding site. In A,
100 ng of competitor oligonucleotide was
used; in B, competitors were used at either
10 or 100 ng as indicated. C, Supershift
analysis of the C1 complex using either of
two mAbs that recognize distinct epitopes
in human Elf-1 (5A3 and 6G7) or no Ab
(none).
FIGURE 3. Elf-1 is the Ets family member that binds to zEBS2.
EMSAs used the 32P-labeled 2147/2119 (zEBS2) probe and 6 mg of
Jurkat nuclear extract. Competition analysis was performed with 100 ng of
the indicated cold oligonucleotide competitor. The 2147/2119 Ets M oligonucleotide competitor has a mutation in the zEBS2 site. Supershift analysis was performed with either of two anti-human Elf-1 mAbs (5A3 and
6G7), an anti-Ets-1 antiserum, or no Ab.
(33) (illustrated in Table I). Interestingly, although GAL4-ELF
trans-activated G5BCAT-SP in Jurkat cells, the up-regulation was
three- to fivefold less than that seen with Pz1.2xGAL, despite the
fact that G5BCAT-SP has three additional GAL4 binding sites
(Table I). To ensure that G5BCAT-SP could be activated through
its GAL4 binding sites in Jurkat cells, an expression plasmid
(GAL4-VP16) encoding the GAL4-DNA binding domain and the
acidic activation domain of the strong viral activator, VP16 (34),
was evaluated for its ability to activate both Pz1.2xGAL4 and
G5BCAT-SP. As shown (Table I), both constructs were substantially up-regulated by GAL4-VP16, although the up-regulation of
G5BCAT-SP by GAL4-VP16 was higher than that seen for
Pz1.2xGAL. These data indicate that the observed difference in the
ability of GAL4-ELF to activate Pz1.2xGAL4 compared with
G5BCAT-SP is not due to an inability of G5BCAT-SP to be activated in Jurkat cells. Therefore, these data suggest that there is
selectivity in the ability of GAL-ELF to activate GAL4 binding
site-containing promoters and that Elf-1 is able to trans-activate
the TCR-z promoter more efficiently than the TATA box containing G5BCAT-SP promoter. Our results using a GAL4-ELF fusion
protein together with the findings that Elf-1 is the Ets family member that normally binds to both zEBS1 and zEBS2 support a role
for Elf-1 in regulating TCR-z gene transcription.
To determine whether Elf-1 could directly augment the activity
of the TCR-z promoter, Elf-1 was ectopically expressed in COS-7
cells, which have low endogenous levels of Elf-1 compared with
Jurkat cells (B. L. Rellahan and A. M. Weissman, unpublished
observations). No reproducible Elf-1-mediated enhancement was
seen in TCR-z promoter constructs with either only one or no
intact Elf-1 sites (Fig. 5 and data not shown). However, overexpression of Elf-1 did result in a consistent three- to fourfold upregulation of expression from the full-length wild-type TCR-z promoter (Fig. 5). These findings indicate that Elf-1 can activate the
TCR-z promoter in nonlymphoid cells and, together with previous
data, establishes a role for Elf-1 in regulating basal transcription
from the TCR-z promoter.
Discussion
Transcription from the TCR-z gene is directed by a TATA-less
promoter that extends from 158 to 2307 relative to the most 39
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
site. This promoter was similarly trans-activated by the GAL4Elf-1 fusion (Fig. 4B). No increase was seen with reporter constructs that did not contain a GAL4 binding site (Fig. 4B and data
not shown). These data indicate that Elf-1 can mediate trans-activation of the z promoter.
It has been suggested that activation domains differ in their ability to function with distinct core promoters (34), and there is evidence to suggest Elf-1 may be more efficient at activating Inrcontaining promoters than promoters that only have a TATA box
(35). To investigate whether there was selectivity in the ability of
the GAL4-ELF fusion protein to activate GAL4 binding site-containing promoters, the trans-activation of a synthetic promoter
construct G5BCAT-SP by GAL4-ELF was assessed. In G5BCATSP, transcription of the CAT gene is under the control of an E1b
TATA box with several upstream Sp1 and GAL4 binding sites
ELF-1 REGULATES THE TCR-z PROMOTER
2798
major site of transcription initiation (11). The contributions of two
binding sites in this region for the Ets family of transcription factors (designated zEBS1 and zEBS2) were assessed for their ability
Table I. GAL4-ELF preferentially activates the TCR-z promoter
compared with an E1b TATA promoter construct
Fold Activation
Exp. 1
Pz1.2xGAL
G5BCAT-SP
Exp. 2
GAL4-ELF
GAL4-VP16
GAL4-ELF
GAL4-VP16
15.2
4.7
12.9
28.2
13.6
2.8
9.4
13.2
Jurkat cells were transfected with 7.5 mg of either Pz1.2xGAL4 or G5BCAT-SP
as indicated, and 10 mg of either the GAL4-ELF or the GAL4-VP16 expression
plasmids. The reporter constructs, Pz1.2xGAL4 and G5BCAT-SP, are shown schematically above the table. Fold activation from two independent experiments are
presented and were calculated as described in Figure 4.
to regulate TCR-z promoter expression. We found that in Jurkat
cells, one Ets binding site must be intact for efficient transcription
from the TCR-z promoter. Elimination of both Ets binding sites
resulted in a marked reduction in TCR-z promoter expression.
Multiple lines of evidence suggest that Elf-1 is the Ets family
member that regulates the TCR-z promoter through zEBS1 and
zEBS2. First, an EMSA supershift analysis demonstrated that
Elf-1 physically interacts with both zEBS1 and zEBS2. Second,
ectopic expression of Elf-1 in COS-7 cells resulted in an increase
in TCR-z promoter activity that mapped to zEBS1 and zEBS2.
Finally, a GAL4-Elf-1 fusion protein efficiently enhanced transcription from the TCR-z promoter in Jurkat cells when directed to
the z promoter through either one or two tandem GAL4 binding
sites. Taken together, these data indicate that Elf-1 regulates
TCR-z promoter activity.
It has been proposed that the ability of Ets family members to
mediate trans-activation depends on interactions with other DNA
binding proteins (36). Elf-1 has been demonstrated to functionally
interact with inducible transcription factors such as activating protein-1, NF-kB, and NF-AT (24, 25, 27, 28) and physically associate with HMG-I(Y), Jun family members, and the NF-kB proteins, p50 and c-Rel (29, 37, 38). Determination of the optimal
consenus sequence for Elf-1 binding has made it clear that a
number of Elf-1 binding sites, particularly those in inducible
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
FIGURE 4. A GAL4-ELF-1 fusion protein trans-activates the full z-chain promoter and Pz1. A and B Jurkat cells were cotransfected with 7.5 mg of the
indicated promoter construct and 1 to 10 mg of the GAL4-ELF-1 expression plasmid as indicated. Fold activation was calculated by dividing the luciferase
activity of cells transfected with the GAL4-ELF-1 expression plasmid by the luciferase activity of cells transfected with the pSG424.RV control vector.
Transfections had a total of 17.5 mg of DNA (A) or 12.5 mg of DNA (B), with differences being made up with the pSG424.RV vector. The data shown
are representative of three independent experiments.
The Journal of Immunology
2799
promoters and enhancers, are of relatively low affinity (39).
This together with the aforementioned transcription factor interactions suggest that the in vivo binding of Elf-1 to DNA is
stabilized by the formation of transcriptionally active multiprotein complexes (29, 36 –39).
Elf-1 is expressed in thymocytes, and its expression pattern is
unaffected by T cell activation (30, 35). TCR-z, unlike other Elf-1
targets, is constitutively expressed in all T cell lineages and
throughout much of T cell development. Furthermore, the TCR-z
promoter can be trans-activated by Elf-1 in nonlymphoid cells.
The latter property may be due to the presence of two TCR-z Elf-1
sites, one of which (zEBS1: CCAGGAAGT) is the best match
(eight of nine bases) with the optimal Elf-1 consensus sequence
(consensus: CCCGGAAGT) of all known Elf-1 sites, suggesting
that it is among the highest affinity Elf-1 binding sites yet identified
(39) (Fig. 6). The assignment of relative affinities of Elf-1 binding
sites based on consensus sequence homology (39) is supported by
EMSA experiments in which Elf-1 had an approximately 10-fold
higher affinity for zEBS1 compared with zEBS2 (data not shown),
FIGURE 6. Comparison of Elf-1 binding sites.
Shown is a comparison of published Elf-1 binding
sites. A single asterisk and a double asterisk are
used to denote identical sequences from two different genes. The 8-bp sequence that is shared between the noninducible and viral genes is
underlined.
the latter being a six of nine match with the consensus
sequence (39).
Our results indicate that Elf-1-mediated trans-activation of the
TCR-z promoter does not require acute activation. Consistent with
this, binding of Elf-1 to zEBS1 has been observed in nuclear extracts from both unactivated and activated human peripheral blood
T cells (our unpublished observations). Whether the ability of
Elf-1 to mediate activation of the TCR-z promoter requires other
interacting transcription factors remains to be determined. The
ubiquitously expressed transcription factor Sp1 is one likely candidate. Sp1 binds to sites downstream from both zEBS1 and
zEBS2 (B. L. Rellahan and A. M. Weissman, unpublished observations) and is known to cooperate with Ets-1 in regulating tissuespecific promoters (40, 41). However, the presence of two high
affinity Elf-1 sites (eight of nine and six of nine matches) in close
proximity to each other makes it also reasonable to speculate that
Elf-1 might bind the TCR-z promoter in vivo without a requirement for other stabilizing factors. The requirement for both zEBS1
and zEBS2 for TCR-z promoter activity in COS-7 cells suggests
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
FIGURE 5. Elf-1 trans-activation of TCR-z in COS-7 requires zEBS1 and zEBS2. COS-7 cells were transfected with 7.5 mg of the indicated TCR-z
promoter constructs and 7.5 mg of a Elf-1 expression vector (pcDELF-1) or the control vector (pCDNA-1). Shown is the mean relative luciferase activity
from five independent experiments 6 SE.
ELF-1 REGULATES THE TCR-z PROMOTER
2800
TCR-z or alter the requirement for other interacting DNA binding
proteins remains to be determined. Finally, while this study establishes a role for Elf-1 in expression from the TCR-z promoter, the
fact that the tissue distribution of TCR-z is more restricted than
that of Elf-1 itself suggests that other factors also contribute to the
restricted expression of this TCR component.
Acknowledgments
The authors thank J. M. Leiden for supplying the 6G7 and 5A3 mAbs,
W. J. Leonard for pcDElf-1, M. Ptashne for pSG424, G. Chinnadurai for
G5BCAT-SP, and V. Seyfert for the GAL4-VP16 expression plasmid. The
authors acknowledge W. J. Leonard, R. Brown, J. Laborda, and P. Middelstadt for invaluable discussions and review of this manuscript.
References
1. Weissman, A. M., S. J. Frank, D. G. Orloff, M. Mercep, J. D. Ashwell, and
R. D. Klausner. 1989. Role of the z chain in the expression of the T cell antigen
receptor: genetic reconstitution studies. EMBO J. 8:3651.
2. Ashwell, J. D., and A. M. Weissman. 1995. T cell antigen receptor genes, gene
products and co-receptors. In Clinical Immunology Principles and Practice.
R. R. Rich, T. A. Fleisher, B. D. Schwartz, W. T. Shearer, and W. Strober, eds.
Mosby-Year Book, St. Louis, p. 69.
3. Love, P. E., E. W. Shores, M. D. Johnson, M. L. Tremblay, E. J. Lee,
A. Grinberg, S. P. Huang, A. Singer, and H. Westphal. 1993. T cell development
in mice that lack the z chain of the T cell antigen receptor complex. Science
261:918.
4. Love, P. E., E. W. Shores, E. J. Lee, A. Grinberg, T. I. Munitz, H. Westphal, and
A. Singer. 1994. Differential effects of z and h transgenes on early a/b T cell
development. J. Exp. Med. 179:1485.
5. Irving, B. A., and A. Weiss. 1991. The cytoplasmic domain of the T cell receptor
z chain is sufficient to couple to receptor-associated signal transduction pathways.
Cell 64:891.
6. Letourneur, F., and R. D. Klausner. 1991. T-cell and basophil activation through
the cytoplasmic tail of T-cell-receptor z family proteins. Proc. Natl. Acad. Sci.
USA 88:8905.
7. Romeo, C., and B. Seed. 1991. Cellular immunity to HIV activated by CD4 fused
to T cell or Fc receptor polypeptides. Cell 64:1037.
8. Samelson, L. E., M. D. Patel, A. M. Weissman, J. B. Harford, and R. D. Klausner.
1986. Antigen activation of murine T cells induces tyrosine phosphorylation of a
polypeptide associated with the T cell antigen receptor. Cell 46:1083.
9. Baniyash, M., P. Garcia-Morales, E. Luong, L. E. Samelson, and R. D. Klausner.
1988. The T cell antigen receptor z chain is tyrosine phosphorylated upon activation. J. Biol. Chem. 263:18225.
10. Cenciarelli, C., D. Hou, K.-C. Hsu, B. L. Rellahan, D. L. Wiest, H. T. Smith,
V. A. Fried, and A. M. Weissman. 1992. Activation-induced ubiquitination of the
T cell antigen receptor. Science 257:795.
11. Rellahan, B. L., J. P. Jensen, and A. M. Weissman. 1994. Transcriptional regulation of the T cell antigen receptor z subunit: identification of a tissue-restricted
promoter. J. Exp. Med. 180:1529.
12. Ko, L. J., and J. D. Engel. 1993. DNA-binding specificities of the GATA transcription factor family. Mol. Cell. Biol. 13:4011.
13. Merika, M., and S. H. Orkin. 1993. DNA-binding specificity of GATA family
transcription factors. Mol. Cell. Biol. 13:3999.
14. Wang, C. Y., B. Petryniak, I. C. Ho, C. B. Thompson, and J. M. Leiden. 1992.
Evolutionarily conserved Ets family members display distinct DNA binding specificities. J. Exp. Med. 175:1391.
15. Seth, A., and T. S. Papas. 1990. The c-ets-1 proto-oncogene has oncogenic activity and is positively autoregulated. Oncogene 5:1761.
16. Macleod, K., D. Leprince, and D. Stehelin. 1992. The ets gene family. Trends
Biochem. Sci. 17:251.
17. Landsman, D., and A. P. Wolffe. 1995. Common sequence and structural features
in the heat-shock factor and Ets families of DNA-binding domains. Trends Biochem. Sci. 20:225.
18. Ho, I. C., N. K. Bhat, L. R. Gottschalk, T. Lindsten, C. B. Thompson, T. S. Papas,
and J. M. Leiden. 1990. Sequence-specific binding of human Ets-1 to the T cell
receptor a-gene enhancer. Science 250:814.
19. Salmon, P., A. Giovane, B. Wasylyk, and D. Klatzmann. Characterization of the
human CD4 gene promoter: transcription from the CD4 gene core promoter is
tissue-specific and is activated by Ets proteins. Proc. Natl. Acad. Sci. USA 90:
7739.
20. Leung, S., S. McCracken, J. Ghysdael, and N. G. Miyamoto. 1993. Requirement
of an ETS-binding element for transcription of the human lck type I promoter.
Oncogene 8:989.
21. Gottschalk, L. R., and J. M. Leiden. 1990. Identification and functional characterization of the human T-cell receptor b gene transcriptional enhancer: common
nuclear proteins interact with the transcriptional regulatory elements of the T-cell
receptor a and b genes. Mol. Cell. Biol. 10:5486.
22. Lin, J. X., N. K. Bhat, S. John, W. S. Queale, and W. J. Leonard. 1993. Characterization of the human interleukin-2 receptor b-chain gene promoter: regulation of promoter activity by ets gene products. Mol. Cell. Biol. 13:6201.
23. Romano-Spica, V., P. Georgiou, H. Suzuki, T. S. Papas, and N. K. Bhat. 1995.
Role of ETS1 in IL-2 gene expression. J. Immunol. 154:2724.
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
that under certain conditions, interactions between these sites may
play a role in mediating trans-activation.
As already noted, the zEBS1 Elf-1 binding site in the TCR-z
promoter is an eight of nine base pair match with the optimal Elf-1
consensus sequence. In comparison, genes whose expression is
dependent on T cell activation generally have sites that match the
consensus sequence at fewer nucleotides than zEBS1 and therefore
are presumably of lower affinity (Fig. 6). In particular, the Elf-1
sites within the IL-2R a subunit (29), IL-3 (27), and granulocytemacrophage CSF (28) genes match the consensus sequence in six,
six, and five of nine bases, respectively (39), and the two IL-2 gene
Elf-1 sites match the consensus sequence in only four of nine bases
(25). The developmentally regulated TdT and CD4 genes have
Elf-1 sites that are better matches than the T cell activation-dependent genes (35, 42). Both CD4 and TdT are trans-activated by
Elf-1 through single Elf-1 sites that are seven of nine matches with
the consensus sequence (39) and share an eight-base core sequence
with zEBS1 (CAGGAAGT). Each of these genes is transcribed
constitutively during specific stages of thymocyte development
(35), and in mature cells CD4 expression defines a subpopulation
of T lymphocytes (2). Despite the fact that the TdT Elf-1 site is a
close match to the Elf-1 consensus site, ectopic Elf-1 expression is
not sufficient to mediate trans-activation through an unmodified
TdT promoter in nonlymphoid cells (35). However, placing a concatamer of three Elf-1 sites upstream of the TdT promoter allowed
trans-activation by Elf-1 in nonlymphoid cells (35).
This requirement for multiple Elf-1 binding sites in nonlymphoid cells, seen with the TdT promoter, is consistent with our
observations that both Elf-1 sites in the TCR-z promoter are required for trans-activation in COS-7 cells. This suggests that the
presence of multiple Elf-1 binding sites may overcome requirements for stabilizing cofactors or may compensate for lower functional levels of Elf-1. Notably, in addition to TCR-z and the IL-2
gene, the HIV-2 (24, 43) and Human T-cell leukemia virus type I
(HTLV-1) (26) enhancers both have two Elf-1 binding sites. Both
of these viral enhancers exhibit one Elf-1 binding site that is a
good match with the consensus (seven of nine match) and one that
is only a five of nine base pair match. This is analogous to the
TCR-z promoter and in contrast to the IL-2 gene, whose two sites
are only a four of nine base match with the consensus. Moreover,
the HIV-2 PUB2 site shares the common eight-base core sequence
with zEBS1, CD4, and TdT. It is of note that the murine TCR-z
promoter also exhibits two Elf-1 binding sites in analogous locations to those found in the human gene (44). Murine zEBS1 has
one nucleotide change compared with its human counterpart, resulting in a seven of nine base match with the consensus sequence.
Strikingly, murine zEBS2 exhibits two nucleotide changes compared with human zEBS2. This results in murine zEBS2 having the
identical nine-base core sequence found in human zEBS1 (Fig. 6).
One view of the existing data, which elaborates on those of
others (35, 39), is that Elf-1 activation of genes is regulated by the
number and the affinity of cognate sites for this factor within a
given promoter or enhancer. Genes that are acutely regulated as a
consequence of cellular activation have relatively low affinity Elf-1
binding sites, minimizing their potential to be activated by constitutive levels of available Elf-1, and they require additional factors
to stabilize Elf-1 binding. Genes that are developmentally regulated exhibit sites that are better matches with the consensus sequence and therefore are likely to have higher affinities for Elf-1.
The TCR-z gene, which is expressed constitutively throughout
most of T cell development and is not known to be acutely regulated, has multiple Elf-1 sites, including one of apparently high
affinity. The extent to which interactions between neighboring
Elf-1 sites function to sustain Elf-1-mediated trans-activation of
The Journal of Immunology
34. Emami, K. H., W. W. Navarre, and S. T. Smale. 1995. Core promoter specificities
of the Sp1 and VP16 transcriptional activation domains. Mol. Cell. Biol. 15:5906.
35. Ernst, P., K. Hahm, N. Davis, M. F. Roussel, C. W. Turck, and S. T. Smale. 1996.
A potential for Elf-1 in terminal transferase gene regulation. Mol. Cell. Biol.
16:6121.
36. Brown, T. A., and S. L. McKnight. 1992. Specificities of protein-protein and
protein-DNA interaction of GABP a and two newly defined ets-related proteins.
Genes Dev. 6:2502.
37. Bassuk, A. G., and J. M. Leiden. 1995. A direct physical association between
ETS and AP-1 transcription factors in normal human T cells. Immunity 3:223.
38. John, S., C. M. Robbins, and W. J. Leonard. 1996. An IL-2 response element in
the human IL-2 receptor a chain promoter is a composite element that binds
Stat5, Elf-1, HMG-I(Y) and a GATA family protein. EMBO J. 15:5627.
39. John, S., R. Marais, R. Child, Y. Light, and W. J. Leonard. 1996. Importance of
low affinity Elf-1 sites in the regulation of lymphoid-specific inducible gene expression. J. Exp. Med. 183:743.
40. Gegonne, A., R. Bosselut, R. A. Bailly, and J. Ghysdael. 1993. Synergistic activation of the HTLV1 LTR Ets-responsive region by transcription factors Ets1
and Sp1. EMBO J. 12:1169.
41. Dittmer, J., A. Gegonne, S. D. Gitlin, J. Ghysdael, and J. N. Brady. 1994. Regulation of parathyroid hormone-related protein (PTHrP) gene expression: Sp1
binds through an inverted CACCC motif and regulates promoter activity in cooperation with Ets1. J. Biol. Chem. 269:21428.
42. Wurster, A. L., G. Siu, J. M. Leiden, and S. Hedrick. 1994. Elf-1 binds to a
critical element in a second CD4 enhancer. Mol. Cell. Biol. 14:6452.
43. Markovitz, D. M., M. J. Smith, J. Hilfinger, M. C. Hannibal, B. Petryniak, and
G. J. Nabel. 1992. Activation of the human immunodeficiency virus type 2 enhancer is dependent on purine box and kB regulatory elements. J. Virol. 66:5479.
44. Wang, L., N. Bronstein, V. Hsu, and M. Baniyash. 1995. Transcriptional regulation of the murine TCR z gene. Int. Immunol. 7:1627.
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
24. Leiden, J. M., C. Y. Wang, B. Petryniak, D. M. Markovitz, G. J. Nabel, and
C. B. Thompson. 1992. A novel Ets-related transcription factor, Elf-1, binds to
human immunodeficiency virus type 2 regulatory elements that are required for
inducible trans activation in T cells. J. Virol. 66:5890.
25. Thompson, C. B., C. Y. Wang, I. C. Ho, P. R. Bohjanen, B. Petryniak, C. H. June,
S. Miesfeldt, L. Zhang, G. J. Nabel, B. Karpinski, and J. M. Leiden. 1992. cisacting sequences required for inducible interleukin-2 enhancer function bind a
novel Ets-related protein, Elf-1. Mol. Cell. Biol. 12:1043.
26. Clark, N. M., M. J. Smith, J. M. Hilfinger, and D. M. Markovitz. 1993. Activation
of the human T-cell leukemia virus type I enhancer is mediated by binding sites
for Elf-1 and the pets factor. J. Virol. 67:5522.
27. Gottschalk, L. R., D. M. Giannola, and S. G. Emerson. 1993. Molecular regulation of the human IL-3 gene: inducible T cell-restricted expression requires intact
AP-1 and Elf-1 nuclear protein binding sites. J. Exp. Med. 178:1681.
28. Wang, C. Y., A. G. Bassuk, L. H. Boise, C. B. Thompson, R. Bravo, and
J. M. Leiden. 1994. Activation of the granulocyte-macrophage colony-stimulating factor promoter in T cells requires cooperative binding of Elf-1 and AP-1
transcription factors. Mol. Cell. Biol. 14:1153.
29. John, S., R. B. Reeves, J. X. Lin, R. Child, J. M. Leiden, C. B. Thompson, and
W. J. Leonard. 1995. Regulation of cell-type-specific interleukin-2 receptor
a-chain gene expression: potential role of physical interactions between Elf-1,
HMG-I(Y), and NF-kB family proteins. Mol. Cell. Biol. 15:1786.
30. Wang, C. Y., B. Petryniak, C. B. Thompson, W. G. Kaelin, and J. M. Leiden.
1993. Regulation of the Ets-related transcription factor Elf-1 by binding to the
retinoblastoma protein. Science 260:1330.
31. Howcroft, T. K., L. A. Palmer, J. Brown, B. Rellahan, F. Kashanchi, J. N. Brady,
and D. S. Singer. 1995. HIV Tat represses transcription through Sp1-like elements in the basal promoter. Immunity 3:127.
32. Sadowski, I., J. Ma, S. Triezenberg, and M. Ptashne. 1988. GAL4-VP16 is an
unusually potent transcriptional activator. Nature 335:563.
33. Kamine, J., T. Subramanian, and G. Chinnadurai. 1991. Sp1-dependent activation
of a synthetic promoter by human immunodeficiency virus type 1 Tat protein.
Proc. Natl. Acad. Sci. USA 88:8510.
2801