Download Cellular processes underlying maturation of P19 neurons: Changes

910
DOI 10.1002/pmic.200600547
Proteomics 2007, 7, 910–920
RESEARCH ARTICLE
Cellular processes underlying maturation of P19 neurons:
Changes in protein folding regimen and cytoskeleton
organization
Alex Inberg*, Yoel Bogoch*, Yaniv Bledi and Michal Linial
Department of Biological Chemistry, Life Sciences Institute, The Hebrew University of Jerusalem,
Jerusalem, Israel
Embryonal carcinoma P19 cells provide an ideal model to study molecular programs along differentiation. Upon induction by retinoic acid (RA), the cells undergo a program of differentiation
that generates functioning neurons within 60 h. RA induced cells that were plated as sparse
(1000 cells/mm2) or dense (4000 cells/mm2) cultures showed a marked difference in the culture
morphology with the dense cultures exhibiting rapid maturation and accelerated neurite outgrowth. The protein expression levels of the sparse and dense cultures were compared 48 h following RA. Cell extracts were separated by 1-DE and 2-DE and differential expression (.fourfold) proteins were identified by MS. Here, we focus on 20 proteins associated with cytoskeletal
regulation and stress-dependent protein refolding. The first group includes drebrin, cofilin,
a-internexin, vimentin, and nestin. Among the proteins in the second group are subunits of the
TCP-1, and several chaperones of the Hsp70 and Hsp90 families. We show that coordinated
remodeling of the cytoskeleton and modulations in chaperone activity underlie the change in
neurite extension rate. Furthermore, a proteomics-based analysis applied on P19 neurons
demonstrated pathways underlying neuronal outgrowth, suggesting that a malfunction of such
pathways leads to neuropathological conditions.
Received: July 21, 2006
Revised: September 29, 2006
Accepted: November 13, 2006
Keywords:
Differential expression / Embryonic cancinoma / Neurite outgrowth / Neuronal differentiation / Synaptic plasticity
1
Introduction
P19 cells are embryonal carcinoma (EC) cells that serve as a
model for studying differentiation processes including commitment to cell lineage [1]. Following cell aggregation in the
presence of retinoic acid (RA), P19 cells differentiate into a
Correspondence: Professor Michal Linial, Department of Biological Chemistry, Life Sciences Institute, The Hebrew University of
Jerusalem, Jerusalem 91904, Israel
E-mail: [email protected]
Fax: 1972-2-6586448
Abbreviations: HSP, heat shock protein; IF, intermediate filament;
NF-M, medium-sized neurofilament; RA, retinoic acid; TCP-1, Tcomplex 1
© 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
neuroectodermal lineage of neurons and glial cells. In a
procedure that eliminates all dividing glial cells a homogenous postmitotic neuronal culture is maintained [2, 3].
This culture is thus suitable for studying neuronal differentiation by genomic and proteomic approaches.
Undifferentiated P19 cells are fast dividing cells. In the
presence of RA, morphogenesis is induced by activation of
critical signaling pathways including the Wnt [4, 5] and BMP
[6].
Gene expression changes associated with early stages of
differentiation in P19 have been reported [7]. Interestingly,
changes in gene expression along differentiation of P19
neurons resemble those of embryonal development in the
mammalian CNS [8].
* Both authors contributed equally.
www.proteomics-journal.com
Systems Biology
Proteomics 2007, 7, 910–920
Several measures define the complete program of neuronal maturation. These measures include the acquisition of
NT phenotype, synapse formation, the establishment of
neuronal polarity, and the determination of the rate and
extent of neurite outgrowth. Determining the sequence of
events of neuronal maturation is instrumental to our understanding of the development, organization, and functionality
of mammalian CNS neurons. P19 neurons are suitable
model to reveal the cellular program underlying neurite
extension and synapse maturation.
Recently, a proteomic comparative study on P19 neurons
showed that neural differentiation is associated with marked
changes in the expression of about 30 proteins that are either
induced or repressed relative to the undifferentiated state [9].
Some of these (12 proteins) showed only a transient activation or repression during the RA application and thus can be
attributed directly to the presence of RA.
We applied a comparative approach to P19 cultures that
were induced toward neuronal lineage. In order to uncouple
the cellular pathways that contribute to neuronal induction
per se with those that are critical for the maturation of neurons, we established culturing conditions that change the
pace of neurite outgrowth and neuronal maturation [10].
Cells grown at a high density mature faster. We used both
2-DE and 1-DE methods followed by MALDI-TOF MS to
identify proteins from P19 neuronal homogenous cultures at
different stages of maturation. Using these techniques we
identified differential expression profiles for about 30 proteins, 20 of which were identified reliably and reproducibly.
These proteins participate in a small number of cellular processes such as cytoskeletal organization, heat shock, and the
chaperone function.
2
Materials and methods
911
firm the maturation of the cultures. Maturation was determined by the ability of the culture to acquire axonal and
dendritic polarity [13] and by measuring the cell response to
depolarization signal by neurotransmitter release as described [14]. Days of differentiation were counted from the
addition of RA, i.e. day 6 of differentiation is equivalent to
48 h after plating.
2.2 Western analysis
Cultures at the indicated differentiation stage were scraped
with a rubber policeman in a homogenization buffer (25 mM
Tris-HCl at pH 8.4, 0.5% NP-40, 150 mM NaCl, 1 mM
PMFS, 0.3 M sucrose), and processed by a glass homogenizer. The nuclei and mitochondria were separated by
centrifugation (16006g, 10 min, 47C) and discarded. The
supernatant was centrifuged for 20 min at 360 0006g in the
TLA100 rotor Beckman centrifuge, then at 100 0006g for 1 h
resulting in a membranous pellet and a cytosolic fraction.
The membranous pellet was resuspended in a 0.6 mL acidic
buffer (0.15 M NaCl, 50 mM glycine, pH 2.5, 5 min on ice)
and recentrifuged as above. To remove membrane associated
proteins, a high salt (0.8 M KCl) solution was added and
centrifugation was repeated (18 0006g, 20 min, at 47C) to
obtain a purified membranous fraction. Soluble and membranous fractions were separated by a 5–15% SDS-PAGE
gradient. Gels were transferred to NC membranes and the
protein transfer was validated by Ponceau S Solution
(Sigma). Membranes were blocked (1 h at room temperature
with 5% nonfat milk powder in TBST buffer (10 mM TrisHCl, pH 7.6, 150 mM NaCl, and 0.1% v/v Tween 20). Following incubation with the appropriate antibodies (12 h,
47C), membranes were washed (3610 min) with the TBST
buffer and incubated with the appropriate peroxidase-coupled secondary antibody. Proteins were visualized using ECL
Plus reagent (Amersham Biosciences).
2.1 Cell culture
2.3 Immunofluorescence studies
P19 cells were originated by M. W. McBurney (University of
Ottawa, Canada) and were stored at low passages. Cells were
cultured and differentiated as described [11]. Briefly, cells
were aggregated in the presence of 0.5 mM RA (Sigma) for
4 days. On day 4, the aggregates were treated with trypsin
(0.025%, 5 min, 377C) and plated on culture-grade plates
coated with poly-L-lysine (10 mg/mL, Sigma) or AB-30 [12].
All media and sera products were purchased from Biological
Industries (Israel). Media were supplemented with 3.5 mM
glutamine and with antibiotics (Penicillin, Streptomycin,
and Amphotericin B). The cells were plated in a defined medium – DMEM supplemented with BioGro2 (25 mg/mL
transferrin, 1 mg/mL insulin, 15 nM selenium, 20 mM ethanolamine, and 10 mM Hepes, pH 7.3) supplemented with
1 mg/mL fibronectin (Biological Industries). Cytosine-b-Darabinofuranoside (Ara-C, 5 mg/mL, Sigma) was added one
day after plating, for two days. Medium (without fibronectin)
was replaced every 48 h. Functional assays were used to con© 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
For visualization of P19 protein morphology in sparse and
dense cultures, cells were induced to differentiate and plated at 1000 cells/mm2 or 4000 cells/mm2 on 35 mm plates.
Cells plated on cover slips coated with poly-L-lysine (20 mg/
mL, Sigma) were used for microscopic visualization. The
cultures were fixed with 4% paraformaldehyde in PBS for
30 min at 257C, washed three times with PBS (10 min each)
and dried briefly with 95% ethanol. The cells following
fixation on cover slips were incubated with primary antibody in blocking solution (5% normal goat serum, 1% BSA,
0.1% or 1% Triton X-100 in PBS) at 47C for 10–12 h. The
cultures were then washed three times in PBS with 0.1%
Triton X-100 (10 min each) and incubated with either goat
antirabbit or goat antimouse antibodies conjugated to fluorescent dyes (Rhodamine Red-X or FITC, Jackson immunoresearch, PA) for 1 h at 257C. The plates were washed as
before and mounted on slides in mounting buffer (90%
www.proteomics-journal.com
912
A. Inberg et al.
glycerol, 2% n-propyl gallate, Sigma). The cultures were
visualized using an epifluorescent microscope (Axioskop,
Zeiss). Cultures incubated with secondary antibody served
as controls for background staining.
2.4 1-DE
The total protein concentration was determined before proceeding to 1-DE or 2-DE analyses. Equal amount of protein
(80 mg) was loaded for each lane. Protein concentration was
determined using the enhanced BCA method according to
the manufacturer’s instructions (Pierce), with BSA as standard. Crude membranous fractions were subjected to the
SDS-PAGE electrophoresis as described [10]. Protein samples were diluted in Laemmli sample buffer and denatured
by heat (10 min, 907C) before loading onto a 16-cm long
gradient gel (8–18% polyacrylamide). The gels were fixed
using 12% acetic acid, 50% ethanol solution, and stained
using CBB G250 colloidal stain with subsequent distaining
in water. Following destaining, gels were scanned and band
intensities were determined. Relative intensities were used
for estimating the differential expression levels between
samples.
2.5 2-DE
The soluble fraction for 2-DE was dissolved in an IEF sample
buffer consisting 7 M urea, 2 M thiourea, 4% CHAPS,
40 mM DTT, and 2% v/v ampholites (pH 3–10). The samples
were solubilized using an ultrasonic bath (10 min) followed
by gentle vortex for 1 h at room temperature. The solution
was centrifuged for 15 min at 15 0006g, and the supernatants were collected. Proteins of the soluble fractions were
precipitated using the TCA-acetone precipitation method.
Four volumes of ice-cold 10% TCA in acetone were added to
the sample, followed by 15 min incubation at 2807C, and 1 h
incubation at 2207C. The samples were centrifuged
(20 0006g, 15 min, 47C), the supernatants were discarded
and the pellets were washed three times with ice-cold acetone, followed by centrifugation. The pellets were dissolved
in the IEF sample buffer as described above. The method
enabled about 70–75% sample recovery, as determined by
BCA protein assay.
The IPG strips, 11 and 18 cm in length, and pH ranges of
3–10 and 4–7 were used (BioRad). Gel systems and reagents
used for 2-DE were purchased from BioRad. The sample was
introduced to the strips using an active in-gel sample rehydration technique; namely, the dry strips were placed on the
appropriate volumes of sample solution in the IEF cellfocusing tray, and were allowed to rehydrate for 12 h, while
50 V were applied on each strip. Following the rehydration,
IEF was performed according to the standard protocols. In
brief, gradient voltages were applied on the strips, until total
V?h values reached 45 000 or 80 000 V?h in the 11 or 18 cm
IPG strips, accordingly.
© 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Proteomics 2007, 7, 910–920
Following IEF, the focused strips were removed from the
focusing tray and equilibrated in order to solubilize the proteins and to reduce the disulfide bonds. The strips were
placed first in a buffer containing 50 mM Tris-HCl at pH 6.8,
6 M urea, 30% v/v glycerol, 2% w/v SDS, and 2% w/v DTT
for 10 min. Afterwards, the strips were placed for 10 min in
the same buffer, containing 2.5% iodoacetamide replacing
the DTT. Following the reduction/alkylation step, the strips
were placed onto 12% SDS-PAGE gels, sealed with 1% solution of low-melting agarose in SDS running buffer containing traces of bromophenol blue dye (Sigma) and run overnight at 20% until the tracking dye reached the bottom of the
gel. Gels were fixed using 12% acetic acid, 50% ethanol solution, and stained using CBB G250 colloidal stain with
subsequent destaining in water.
2.6 MS analysis
The Coomassie colloidal stained spots from the 2-DE gels
were cut out as small gel plugs (1–1.5 mm diameter). In the
case of the 1-DE gels, the protein bands were excised as close
as possible to the stained band to reduce possible contamination. The gel plugs were destained twice (or until all
the dye was removed) with 200 mL of 200 mM ammonium
bicarbonate (NH4HCO3) at pH 8.0 mixed in the ratio 1:1 with
ACN for 45 min at 377C, then the gel pieces were dried
completely in SpeedVac. In the case of the 1-DE gels, reduction/alkylation steps were added. The dry gel pieces were
rehydrated in 10 mL of 0.02mg/mL of sequencing grade modified trypsin (Promega) in 10% ACN, 40 mM NH4HCO3 at
pH 8.0 for 1 h at room temperature to allow the trypsin solution to diffuse into the gel pieces. If required, the gel pieces
were covered with 50 mL of 10% ACN, 40 mM NH4HCO3 at
pH 8.0 to prevent them from drying. The gel pieces were
incubated for 16–18 h at 377C. Following the digestion, the
solution was collected and put into a fresh 0.5 mL tube. Fifty
microliters of 0.1% TFA were added to the gel pieces, and
sonicated for 15 min. The solution was removed and combined with the solution collected in the previous step. The
combined solution was dried completely using SpeedVac and
resuspended in 10 mL of 0.1% TFA. This solution was used
for MS protein identification. In cases of low sample concentration, high salt contamination and poor mass spectrum, a desalting step using RP ZipTip pipette tips (Millipore, MA) was applied according to the manufacturer’s
instructions.
MALDI-TOF MS analysis was performed on a Bruker
Daltonics MICROFLEX mass spectrometer (MS). All the
measurements were performed in positive ion/reflectron
mode using standard working protocols. For peptide measurements, CHCA was used as a matrix (Applied Biosystems,
CA), utilizing the dried droplet technique. In brief, 0.5 mL of
sample solution was mixed with a similar volume of the
saturated CHCA solution in 30% ACN, 0.1% TFA, spotted
on a stainless steel MALDI target, and allowed to dry. The
mass measurements were performed according to instrucwww.proteomics-journal.com
Systems Biology
Proteomics 2007, 7, 910–920
tions, with trypsin autodigestion peaks used as an internal
calibrants.
The monoisotopic peptide masses were identified using
Bruker TOF Analysis software. The peptide masses were
sent to MASCOT searching software (Matrix Science, London, UK) using Bruker BioTools software. The NCBI nonredundant protein database was used for searching, with
search parameters including oxidation of methionines, carbamidomethyl cysteines, trypsin digestion with one missed
cleavage, and a 50 ppm mass error window. Only unambiguously identified proteins having statistically significant
searching scores were considered.
ESI/MS/MS analysis was performed using a Q-TOF II
mass spectrometer (Micromass, UK). The digested samples
were loaded directly into the instrument, and analyzed
according to the manufacturer’s instructions. The MS/MS
data were subjected to database search using MASCOT
searching software against the NCBI nonredundant database.
2.7 Image acquisition and data analysis
The stained gels were scanned using a UMAX PowerLook II
scanner and analyzed using Phoretix 2-D gel analysis software.
For integration of annotation and assessing statistical
significance of the functional relevance of the identified protein set, we applied the PANDORA concept [15]. Briefly, each
protein is associated with a set of functional annotations
from external sources (such as Gene Ontology and InterPro).
For each annotation, four measures are calculated: sensitivity, specificity, p-value, and corrected p-value. For example,
when studying a random set of ten proteins from the mouse
proteome sharing a keyword (i.e. serine/threonine kinase), it
is essential to determine whether this keyword is assigned to
only ten proteins in the entire proteome (sensitivity of 1.0) or
to 1000 proteins (sensitivity of 0.01). For a given annotation
a, let P be the number of proteins in the set, N the number of
proteins in the set that have annotation a, D the number of
proteins in the background database (i.e. the mouse proteome), and K the number of proteins in the database that
have annotation a. Sensitivity(a) = N/K. Sensitivity measures
that what percent of the proteins with annotation a are in the
set, out of the background database. Specificity(a) = N/P.
Specificity measures that what percent of the protein set has
annotation a. The p-value and the Benferoni correction for
the p-value is according to [15] and as detailed in www.pandora.cs.huji.ac.il.
2.8 Clones, antibodies, and primers
Polyclonal antibody for the medium-sized neurofilament
(NF-M) is from Chemicon International (Temecula, CA).
Polyclonal antibody for actin (A2066) and mAb for a-tubulin
(T6024) are from Sigma-Aldrich. Synaptophysin monoclonal
(SY38) is from Chemicon. Monoclonal anti-C2 actin (corre© 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
913
sponding to carboxy terminus, that is, shared by all forms of
actin) and monoclonal anti-drebrin (M2F6) that detect drebrin A and E2 were purchased from Santa Cruz Biotechnology
(Santa Cruz, CA). Oligonucleotides used for RT-PCR were
tested on a range of temperatures to establish optimal working temperature. The level of ribosomal proteins L19 is constant and used as an internal control for the RNA amounts.
PCR was performed using forward: 50 CTGAAGGTCAAAGGGAATGTG30 and reverse: 50 GGACAGAGTCTTGATGATCTC30 oligonucleotides. For b-actin the following
oligonucleotides were used: forward: 50 ATGGTGGGAATGGGTCAGAAG3 0 and reverse: 50 CACGCAGCTCATTGTAGAAGG30 .
3
Results
In order to focus on specific subprograms in neuronal differentiation that lead to neurite outgrowth and synapse
maturation, we compared two P19 cultures. RA induced cells
were plated as sparse (1000 cells/mm2) or dense (4000 cells/
mm2) cultures. While the P19 cultures were identical in their
time of differentiation, only the dense culture exhibits a
rapid maturation and an accelerated neurite outgrowth rate.
3.1 Induction of P19 leads to homogeneous
nondividing neuron culture
P19 cells respond to RA by differentiating into neuron and
glial cells. In order to maintain a pure neuronal population
for further analysis we eliminated the dividing cells (see
Section 2) and remained with a postmitotic culture. The
study of P19 differentiation using proteomic technologies
relies on the homogeneity of the cultures (Fig. 1). All visible
neurons were intensely stained by a neurofilament antibody
(NF-M) confirming the neuronal nature of the extended
neurites. These culturing conditions, which eliminate nonneuronal cell types, were maintained for all further analyses.
Figure 1. Cultures of P19 neurons on day 8 of differentiation. The
P19 cell culture was induced in the presence of RA (4 days).
Immunostaining was performed for 72 h after plating (day 8 of
differentiation) following fixation with 4% paraformaldehyde and
using antibodies to NF-M. Secondary antibodies were goat antirabbit-TRITC. S (sparse) and D (dense) are cultures of slow and
fast rate of neurite outgrowth, respectively. Note that the neurons
in the fast growing culture are thicker. Bar: 20 mm.
www.proteomics-journal.com
914
A. Inberg et al.
We have previously demonstrated [13] that the rates of
neurite growth and synapse maturation are strongly dependent on culturing conditions. The condition that caused
the difference in the pace of neuronal outgrowth and in the
entire developmental process is defined by a four-fold change
in initial cell concentration of plating. As early as 12 h following plating, a marked difference in neurite length between cultures of different densities was observed.
We sought to determine the time window along P19 differentiation in which proteins that participate in determining
neurite outgrowth rate are differentially expressed. To this
end, we monitored the change in expression of several neuronal specific proteins under conditions of slow and fast
neurite extension. We quantified the expression of representative proteins from days 4 to 10 of differentiation in sparse
and dense cultures [13]. The cytoskeletal protein NF-M, a
member of the NF triplet family, was already maximally
expressed on days 4 and 5 of differentiation. However, GAP43, a growth associated protein which is concentrated in axons
and growth-cones, is maximally expressed on days 6 and 7 in
dense and sparse cultures, respectively. Finally, the expression
of synaptoagmin, the Ca21 sensor of the synaptic vesicle, lagged behind and accumulated only on days 8–9 of differentiation. We concluded that maximal changes in proteins that are
associated with neurite growth occur on days 6 and 7 of differentiation, similar to the GAP-43 expression profile. Therefore, in this study we focused on protein expression that
occurs at this time window of P19 neuronal differentiation.
The result of plating cells at different densities has an
immediate impact on the culture morphology. The dense
culture reaches an entangled neurite network already on day
7 of differentiation whereas the cells plated as a sparse culture mature at a slower rate and reach maturation only after
8–9 days of differentiation. Figure 1 illustrates the morphol-
Proteomics 2007, 7, 910–920
ogy of such cultures on day 8 of differentiation. At this stage,
both the cultures have already gained axonal and dendritic
polarity [10]. Under these conditions, we collected the differentiated neurons on days 6–7 after differentiation and used a
proteomics analysis to reveal the process underlying this
phenomenon.
3.2 Identification of differentially expressed proteins
We have shown that the protein and transcription profiles of
P19 culture change during differentiation [16]. Proteins were
separated by electrophoresis on 2-D gels. The membranous
and insoluble fractions that are poorly resolved by 2-D gels
were analyzed by a high resolution 1-DE. Figure 2 shows an
8–18% gradient SDS-gel of P19 on days 6 and 7 of differentiation in sparse (S) and dense (D) plated cultures. We
focused on protein bands whose expression was strongly
enhanced or suppressed in the dense and sparse cultures.
Some of the protein bands (Fig. 2, asterisk) were highly
expressed in the sparse culture and their expression was
gradually diminished in dense culture, a trend that continued during maturation of the neurons (not shown). We
consider these proteins as good markers for early events that
are associated with the rate of neurite extension.
To ensure a higher resolution and better coverage, we
performed 2-D gel separation that provided a representation
of the major proteins in the soluble protein fraction. A sample of a differential gel is shown in Fig. 3. Differentially
expressed proteins were excised and identified. Peptides
were analyzed by MALDI-TOF MS and by ESI MS/MS analysis for final identification. There are ,400 identified separable protein spots in each of the small gels (11 cm) and about
600 spots in the large gels (18 cm). We analyzed only those
spots with the most significant differential expression.
Figure 2. 1-DE separation of membranous and
insoluble P19 extracts. (A) Protein extracts were
prepared from cultures on days 6 and 7 of differentiation, separated into soluble and insoluble
fractions, and the insoluble fraction was separated by an 8–18% gradient SDS-PAGE. Some of
the protein bands that differed significantly between the cultures are marked. Arrowheads
mark proteins that were suppressed in the Dense
(D) culture relative to Sparse (S) and asterisks
mark proteins that were induced in the S relative
to D cultures. MW denotes the molecular weight
marker (in kDa). Zoom of specific area of the gel
illustrates apparent differences in protein
expression. (B) Example of a protein band that is
suppressed in the dense culture. This protein
was identified as nestin. (C) A set of proteins that
shows alteration in the intensity of several proteins in the range of 35 kDa. Among these are
prohibitin, a marker for switching from a dividing to a nondividing postmitotic cell culture.
© 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
www.proteomics-journal.com
Systems Biology
Proteomics 2007, 7, 910–920
915
3.3 Differentially expressed neuronal cytoskeleton
proteins
Synapse maturation is associated with changes in cytoskeleton modification proteins (Table 1). The proteomics view
provides an opportunity for an unbiased survey of several
components of the neuronal cytoskeleton. The neuronal
cytoskeleton is composed of (i) actin-based microfilaments,
(ii) tubulin-based microtubules, and (iii) intermediate filaments (IFs) such as the NF triple bundles. Among the proteins that were identified as differentially expressed between
the two experimental cultures (Table 1), we detected at least
one representative for each of these three functional groups.
Among the proteins that were identified by their differential expression profile, two are subunits of actin (b and g).
These actins were induced in the dense plated culture relative to the sparse culture. Furthermore, these differentially
expressed proteins were identified independently in the
membranous insoluble fraction as well as in the soluble
fraction (Table 1).
We tested whether the developmental change observed in
the b-actin (Table 1) protein is also detected at the mRNA
level. We performed RT-PCR using primers specific for
b-actin and mRNA of P19 on days 5 and 6 of differentiation.
P19 neurons in the dense culture express a high level of
b-actin as early as day 5 and this trend continues to day 6 of
differentiation (Fig. 5). However, on day 7 and later the difference in b-actin expression of the two cultures becomes
attenuated (not shown). Several proteins that modulate actin
Figure 3. Representative sections of large 2-D gels. Each section
contains about 100 protein spots. “S” and “D” denote sparse and
dense cultures, respectively. Only a few protein spots were differentially expressed according to the set fold change criteria
(.four-fold).
Most of the proteins were unambiguously identified
using a PMF method (Fig. 4). An example of the mass spectra of two proteins matricin (CCT-g) and Hsp73 is shown in
Fig. 4. In some cases, in order to facilitate the identification
and to ensure better coverage of the protein, several peptides
were subjected to MS/MS analysis.
Table 1 summarizes the proteins identified by MALDITOF MS and confirmed by MS/MS peptide sequencing.
Only proteins having .four-fold difference in the dense
relative to sparse culture were considered differentially
expressed. Several of the proteins were identified in the soluble as well as in the insoluble fraction.
Table 1. List of proteins that were identified in independent experiments (in 2–4 experiments out of a total of five experiments on independent P19 neuronal cultures) and whose identification is confirmed by peptide coverage of .10% (by amino acids). 2-D, soluble
fraction analyzed by 2-DE. M, membranous and insoluble fraction analyzed by 1-DE
Full name
Gene
name
UniProt
NCBI gi
Activator of HSP90
Alpha-internexin
Annexin A5
Beta actin
Cofilin-1
Drebrin E, A
Gamma actin
Heat shock 70 kDa protein 1L
Heat shock protein 8
Heat shock protein HSP90-beta
Nestin
Prohibitin
T-complex protein 1 subunit alpha B
T-complex protein 1 subunit eta
T-complex protein 1 subunit gamma
T-complex protein 1 subunit theta
T-complex protein 1 subunit zeta
Tubulin alpha-1 chain
Tubulin beta-5 chain
Vimentin
Ahsa1
Ina
Anxa5
Actb
Cfl1
Dbn1
Actg1
Hspa1l
Hspa8
Hsp90ab1
Nes
Phb
Cct1
Cct7
Cct3
Cct8
Cct6a
Tuba1
Tubb5
Vim
Q8BK64
P46660
P48036
P60710
P18760
Q9QXS6
P63260
P16627
Q5FWJ6
P11499
P21263
P35232
P11983
P80313
P80318
P42932
P80317
P68369
P99024
P20152
22122514
38 117
94730353
55 818
13277612
35 752
49865 41 737
116849 18 428
20454881
77 156
809561 40 992
56757584
70 637
76779312
70 871
123681 83 194
128067 198 606
464371 29 804
1729865 60 449
549060 59 596
549059 60 630
1174621 59 424
549061 57 873
55977479
50 085
56754803
49 671
138536 53 556
© 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
MW
(Da)
Method
Relative Comment
to Sparse
Reference
M
M
2-D
2-D/M
M
M
2-D/M
M
2-D/M
M
M
M
2-D/M
M
2-D
M
M
M
M
2-D/M
Down
Up
Up
Up
Up
Down
Up
Down
Down
Down
Down
Down
Up
Up
Up
Up
Up
Up
Up
Down
[31]
[32]
[33]
[23]
[34]
[35]
[23]
[36]
[36]
[36]
[36]
[37]
[29]
[29]
[29]
[29]
[29]
[38]
[38]
[39]
Activator of Hsp90
NF maturation
Neuronal protection
Filaments in dendrites & growth cones
Actin dynamics modifier
Dendritic shape modifier
Filaments in dendrites & growth cones
Neuroprotection, Stress response
Neuroprotection, Stress response
Neuroprotection, Stress response
Replaced by neurofilaments
Regulating proliferation
TCP folding complex
TCP folding complex
TCP folding complex
TCP folding complex
TCP folding complex
Axonal tracks
Axonal tracks
Class-III intermediate filaments
www.proteomics-journal.com
916
A. Inberg et al.
Proteomics 2007, 7, 910–920
Figure 4. MS and identification of an excised protein band from 2-DE. (A) The mass spectrum of the Hsp73 protein. The protein was identified by PMF, with seven matched peaks. One of the identified peaks was subjected to MS/MS analysis, with results further corroborating
the identity of the protein. (B) The mass spectrum of the matricin. The identification was based on six matched peaks. (C) Partial sequence
assignment of the matched peptides (m/z 878.317) marked with an asterisk on (B) and circled. The partial sequence NVLLD along with the
sequence tag matches the tryptic peptide NVLLDPQLVPGGGASEMAVAHALTEK.
dynamics were also identified by the proteomics approach
including cofilin and drebrin. Cofilin is an actin modulator
that is expressed at high levels. The other actin-binding protein is drebrin (Fig. 2, double asterisk). Drebrin was identified as a ,120 kDa band rather than the expected 70–75 kDa.
This discrepancy in apparent size can be attributed to an
uneven distribution of certain amino acids in the sequence
[17].
© 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Drebrin expression was maximal in the sparse culture on
day 6 of differentiation and its level was reduced substantially on day 7 of differentiation (Fig. 2). We performed a
Western analysis to quantify the level of drebrin in the different fractions (Fig. 6B). We ensured that identical amounts
of proteins were loaded for the comparative analysis. Drebrin
is mostly detected as an insoluble fraction. In the insoluble
fraction, the amount of drebrin on day 7 of differentiation is
www.proteomics-journal.com
Proteomics 2007, 7, 910–920
Systems Biology
917
The final group of neuronal cytoskeleton that was identified in our studies belongs to the IFs, including vimentin,
which is expressed in the neuronal progenitor in neurons and
glia, and nestin. We identified both vimentin and nestin to be
repressed in the dense culture and a-internexin to be induced.
Figure 5. Expression of b-actin along P19 neuronal differentiation. The RNA used for the RT-PCR was extracted from the P19
neurons at the indicated days of differentiation. The number of
PCR cycles was optimized to match the dynamic range of the
reaction. Each set of primers was tested three independent times
with ,10% variation between independent experiments. A
representative result is shown for the expression of b-actin.
Expression levels of the ribosomal L19 gene were used for calibration and were identical in all the samples.
reduced by 40% relative to the amounts on day 6 of differentiation in the sparse culture (Fig. 6A). Thus analyzing
proteins by both 1-D and 2-D gels serves to detect the protein
partition into soluble and insoluble fractions, as in the case
of drebrin. To view the subcellular fractionation of drebrin on
day 6 of differentiation, we compared the distribution of
actin to that of drebrin in the P19 neuronal culture. Figure
6C indicates that drebrin is not uniformly distributed in the
cells but rather is clustered in puncta in the cell body (Fig. 6C)
and in axons where it is clustered in discrete foci. The distribution of b-actin in the sparse culture shows a similar
pattern of expression. Unlike the cytoskeletal proteins, the
amounts of synaptophysin, the hallmark of small synaptic
vesicles, is identical in the sparse and dense cultures
(Fig. 6B).
3.4 Synapse maturation is associated with an
increase in stress-dependent folding function
The largest groups of proteins that are differentially expressed (increased in the dense culture relative to the sparse culture) are molecular chaperones of the T-complex 1 (TCP-1)
that assists the folding of proteins upon ATP hydrolysis.
Specifically the TCP-1 complex is known to play a role, in
vitro, in the folding of actin [18] and tubulin [19]. As such,
they play a role as linkers between the increase in cytoskeleton expression (Table 1) and the capacity of the neurons to
cope with the fast rate of protein production. An additional
group of proteins that were repressed in the dense culture
are a set of high molecular weight heat shock proteins
(HSPs) of the Hsp70 and Hsp90 families. It has been suggested that Hsp70 regulates tubulin polymerization either
directly or indirectly, through association with tau [20].
Another explanation for the high level of HSP proteins in the
early stage of differentiation may be the putative role of HSP
in regulating the activity of several transcription factors [20].
3.5 Knowledge gain by integration of annotations
In the proteomics research presented here, due to lack of
sensitivity of the method used and the limitation of resolution (mainly for the insoluble fraction), we expected only the
Figure 6. Drebrin expression and subcellular
localization. (A) Histogram from Western analysis
of drebrin expression on days 6 and 7 of differentiation for soluble and insoluble fractions. Data
from Western blots were quantified and presented as relative intensity. Student t-test was
performed and significance levels at p,0.01
(asterisk) between the level of expression on days
6 and 7 for the sparse cultures. (B) Results of
Western blot analysis of P19 soluble and insoluble fractions for drebrin and synaptopysin (physin) are shown for day 6 of differentiation. To
ensure better quantification of the result, each
sample was partitioned and loaded at a ratio of
0.2 and 1.0 of the sample. Each experiment was
repeated three times with ,15% variation among
experiments. There was no significant difference
between the amounts detected for the insoluble
fraction on days 6 and 7 for S and D. Immunostaining of drebrin and b-actin in sparse culture
on day 7 of differentiation is shown. The particlelike structures along the axons are visible for both
proteins. The organization of the proteins in foci
along the axon is in line with the increased fraction of the insoluble fraction of drebrin and
b-actin along P19 differentiation.
© 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
www.proteomics-journal.com
918
A. Inberg et al.
Proteomics 2007, 7, 910–920
Table 2. Significant keywords for differentially expressed proteins (listed in Table 1) according to PANDORA. There are 8530 InterPro
keywords that are divided into Family and Domain (according to the InterPro database). InterPro keywords have a statistically
significant value as defined by a corrected p-value, that is, lower than 0.01. Sens, sensitivity; Spec, specificity, for details see
Section 2
InterPro type
Keyword
Number of
proteins
in the set
Sens
Spec
p-Value
Corrected
p-value
Family
Domain
Family
Family
Domain
Domain
Domain
Domain
Family
Family
Chaperonin TCP-1
GroEL-like chaperone, ATPase
Chaperonin Cpn60/TCP-1
Chaperonin Cpn60
Intermediate filament, DNA-binding region
Actin-binding, cofilin/tropomyosin type
Tubulin/FtsZ, GTPase
Tubulin/FtsZ, C-terminal
Tubulin family
Heat shock protein Hsp70
5
5
5
4
2
2
2
2
2
2
0.278
0.172
0.143
0.250
0.133
0.111
0.069
0.067
0.053
0.050
0.294
0.294
0.294
0.235
0.118
0.118
0.118
0.118
0.118
0.118
1.85e-14
2.57e-13
7.01e-13
1.27e-11
6.24e-6
9.09e-6
2.41e-5
2.58e-5
4.16e-5
4.61e-5
3.88e-13
5.39e-12
1.47e-11
2.67e-10
1.31e-4
1.91e-4
5.06e-4
5.41e-4
8.73e-4
9.69e-4
most significant changes in protein expression to be detected. Nevertheless, in order to attribute these findings to
potential cellular processes and unified functional annotations, it is often important to be able to quantitatively assess
the set of identified proteins in terms of functional significance relative to the random set of that size. We used PANDORA [15] to investigate the significance of keywords for the
20 proteins listed in Table 1. Table 2 presents the p-value for
the appearance of the most significant annotations from a
database of InterPro annotations [21]. The keywords found to
be associated with a very high statistical significance are
chaperone, folding, and neuronal cytoskeleton.
fractions were ignored in the experiments reported, and (iii)
protein expression changes of the undifferentiated or RA
induced phase are not included in our study.
Axons purified from cultures of injury-conditioned adult
dorsal root ganglion neurons were used in another proteomic study [22]. Interestingly, there is a strong overlap with
proteins that exhibit axonal translation capacity and the proteins reported in our study. Among the shared proteins are bactin, vimentin, and cofilin. In addition, several HSPs were
identified including Hsp60 and Hsp70. We assume that the
increase in neurites of the dense (Fig. 1) relative to the sparse
cultures also correlates with the enrichment of proteins with
the capacity to be transported and synthesized in axons.
4
4.2 Accelerated rate of neurite extension is
dependent on enhanced folding capacity with
induction of neuronal cytoskeleton
Discussion
4.1 Proteomics overview of P19 neurons and other
developing neurons
Recently, a proteomics-based survey on stages in the differentiation process of P19 neurons was carried out [9]. The
results of this study are 28 differentially expressed proteins.
Examples are proteins of transcription and translation
(53 kDa BRG1-associated factor, eukaryotic initiation factor
4A, several ribosomal proteins). Additional groups detected
are signal transduction, several energy producing enzymes,
cell protection proteins, and cytoskeletal proteins. The level
of overlap with our set is rather limited. Still, some overlap
applies to the cytoskeleton elements, especially the increased
amounts of cofilin and b- and g-actin. The reasons for the
relatively low overlap in protein identification for differentially expressed proteins are numerous: (i) differences in the
ages of the cultures; we focused on P19 cells on day 6 of differentiation rather than day 8 of differentiation, (ii) most of
the insoluble fractions (including TCP-1, IFs) are poorly
represented in the 2-D analysis of the soluble fraction. These
© 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
The importance of cytoskeletal dynamics to the maturation of
the neurons and neurite extension has been reported in several models. For example, induction of b- and g-actins was
reported along the differentiation of neuroblastoma cells [23].
In developing and adult cerebellar cortex b-actin (but not
a-actin or g-actin) is localized to dendritic spines, structures
which are known to retain morphological plasticity in the
adult brain [24]. Clearly, it is not only the amount of the actin
proteins that determines the fate of the growing neurites but
also the equilibrium between actin polymerization and depolymerization. Indeed the degree of axon branching and the
stability of varicosities and synaptic sites are dominated by the
level of actin, cofilin, drebrin, and other actin-binding proteins. Furthermore, one of the earliest changes induced by
neurotrophines (e.g. NT-3) in the neuron is the remodeling of
the cytoskeleton and especially the actin filaments [25].
Immunostaining of P19 culture (Fig. 6) reveals that actin and
drebrin molecules partition between the cell body pool and
www.proteomics-journal.com
Systems Biology
Proteomics 2007, 7, 910–920
some local foci along the axons (Fig. 6). We assume that these
structures along the axons are part of the insoluble pool of
cytoskeletal elements that was analyzed in this study. Interestingly, the reduction in the expression of drebrin (Fig. 6A)
precedes the formation of dendrites or mature spines. Thus,
the expected role of drebrin in the formation of dendrite-like
structures in P19 neuron is questionable [26].
We expect that changing the stoichiometry of drebrin
and actin will change the binding capacity for other actinbinding proteins and consequently the dynamics of neurite
outgrowth. We concluded that regulation of drebrin and
actin dynamics is achieved mainly by relocation of drebrin
molecules along the maturation process.
The coordination of TCP-1 subunits, which are the major
neuronal chaperonins, with the phenomenon of accelerated
neurite extension suggests that a high capacity of folding is
required to cope with the enhanced production of cytoskeletal proteins. In our study, we show the link between accelerated neurite outgrowth with actin filament organization and
subsequent folding.
4.3 Neurite extension proteins and neuropathologies
Our study helps in highlighting the key processes in establishing a fast growing culture that resembles CNS neurons.
We suggest that the levels and function of chaperones and
chaperonins which lead to correct folding and distribution of
actin in the brain can be directly linked to neurodegenerative
diseases. This assumption is supported by the recent observation that proteasomes are recruited to dendrites as a result
of activation and that most of them are connected with insoluble actin in the dendrites [27].
Support for the key role of TCP-1 in maintaining healthy
functional neurons comes from studies in which 2-DE followed by MALDI-TOF MS was performed on fetal Down
syndrome brains. Interestingly and similar to our findings,
several HSPs were identified to be altered and a and b-TCP-1
showed a significant decrease in amounts in the second trimester brain [28]. A similar analysis has been performed in
patients with Alzheimer’s disease. TCP-1 ratio to b-tubulin is
significantly decreased in the temporal, frontal, parietal cortex, and in the thalamus of patients with Alzheimer’s disease
[29].
Neuronal cytoskeleton dynamics strongly correlates with
CNS and PNS pathologies. Interestingly, some of the proteins identified in the maturation state such as nestin, are
known to participate specifically in regeneration and brain
repair. During embryogenesis, transient expression of nestin
signals the commitment of progenitor cells to differentiate.
Up regulation of nestin expression has been reported following injury, leading to the speculation that nestin may be
involved in brain repair [30]. In P19 nestin was seen in
growth cone, supporting its role in neurite growth in line
with our proteomics results. Thus during neurite growth and
maturation, proteins that participate in actin stability are
likely to play an active role.
© 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
919
As most of the proteins that were identified in our study
are related not only to cytoskeletal modulation but also to the
chaperon refolding process, we assume that these are the
main processes that can be attributed to the change in the
rate of neurite growth and neuronal maturation. Our results
support the notion that chaperone-refolding processes are
not activated as a protection mode in a stress response but
rather participate in scenarios where a cellular demand for
efficiency in protein production, protein transport, and
shipment is introduced. The combination of a proteomicsbased study on homogenous cultures with subcellular visualization is essential for studying dynamic processes in neurons. Furthermore, using a limited scale of comparative proteomics we were still able to propose a functional mechanistic network in a highly dynamic environment such as
neuronal growth.
We thank the Kennedy Lee Trust for their support in the
MALDI TOF. This research could not be conducted without their
generous support. This study was initiated by Sharon Tayar and
Julia Weiner. A. I. was supported by the Sudarsky Center for
Computational Biology.
5
References
[1] Bain, G., Ray, W. J., Yao, M., Gottlieb, D. I., Bioessays 1994,
16, 343–348.
[2] Bain, G., Gottlieb, D. I., Perspect. Dev. Neurobiol. 1998, 5,
175–178.
[3] Finley, M. F., Kulkarni, N., Huettner, J. E., J. Neurosci. 1996,
16, 1056–1065.
[4] Smolich, B. D., Papkoff, J., Dev. Biol. 1994, 166, 300–310.
[5] Tang, K., Yang, J., Gao, X., Wang, C. et al., Biochem. Biophys.
Res. Commun. 2002, 293, 167–173.
[6] Bani-Yaghoub, M., Felker, J. M., Sans, C., Naus, C. C., Exp.
Neurol. 2000, 162, 13–26.
[7] Wei, Y., Harris, T., Childs, G., Differentiation 2002, 70, 204–
219.
[8] Pachernik, J., Bryja, V., Esner, M., Kubala, L. et al., Physiol.
Res. 2005, 54, 115–122.
[9] An, J., Yuan, Q., Wang, C., Liu, L. et al., Proteomics 2005, 5,
1656–1668.
[10] Parnas, D., Linial, M., Brain Res. Dev. Brain Res. 1997, 101,
115–124.
[11] Parnas, D., Linial, M., Int. J. Dev. Neurosci. 1995, 13, 767–781.
[12] Bledi, Y., Domb, A. J., Linial, M., Brain Res. Brain Res. Protoc.
2000, 5, 282–289.
[13] Parnas, D., Linial, M., J. Mol. Neurosci. 1997, 8, 115–130.
[14] Parnas, D., Linial, M., Brain Res. Brain Res. Protoc. 1998, 2,
333–338.
[15] Kaplan, N., Vaaknin, A., Linial, M., Nucleic Acids Res. 2003,
31, 5617–5626.
www.proteomics-journal.com
920
A. Inberg et al.
[16] Bogoch, Y., Bledi, Y., Tayar, S., Linial, M., in: Silman, I. (Ed.),
Cholinergic Mechanisms: Function and Dysfunction, Taylor
& Francis 2004, pp. 137–144.
[17] Keon, B. H., Jedrzejewski, P. T., Paul, D. L., Goodenough, D.
A., J. Cell Sci. 2000, 113, 325–336.
[18] Llorca, O., McCormack, E. A., Hynes, G., Grantham, J. et al.,
Nature 1999, 402, 693–696.
[19] Melki, R., Rommelaere, H., Leguy, R., Vandekerckhove, J.,
Ampe, C., Biochemistry 1996, 35, 10422–10435.
[20] Calabrese, V., Scapagnini, G., Ravagna, A., Giuffrida Stella,
A. M., Butterfield, D. A., Dev. Neurosci. 2002, 24, 1–13.
[21] Mulder, N. J., Apweiler, R., Attwood, T. K., Bairoch, A. et al.,
Brief Bioinform. 2002, 3, 225–235.
[22] Willis, D., Li, K. W., Zheng, J. Q., Chang, J. H. et al., J. Neurosci. 2005, 25, 778–791.
[23] Ulloa, L., Avila, J., Eur. J. Neurosci. 1996, 8, 1441–1451.
[24] Micheva, K. D., Vallee, A., Beaulieu, C., Herman, I. M.,
Leclerc, N., Eur. J. Neurosci. 1998, 10, 3785–3798.
[25] Zhang, H. L., Singer, R. H., Bassell, G. J., J. Cell Biol. 1999,
147, 59–70.
[26] Takahashi, H., Sekino, Y., Tanaka, S., Mizui, T. et al., J. Neurosci. 2003, 23, 6586–6595.
[27] Bingol, B., Schuman, E. M., Curr. Opin. Neurobiol. 2005, 15,
536–541.
© 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Proteomics 2007, 7, 910–920
[28] Yoo, B. C., Fountoulakis, M., Dierssen, M., Lubec, G., J.
Neural. Transm. Suppl. 2001, 321–334.
[29] Schuller, E., Gulesserian, T., Seidl, R., Cairns, N., Lube, G.,
Life Sci. 2001, 69, 263–270.
[30] Yan, Y., Yang, J., Bian, W., Jing, N., Neurosci. Lett. 2001, 302,
89–92.
[31] Panaretou, B., Siligardi, G., Meyer, P., Maloney, A. et al., Mol.
Cell 2002, 10, 1307–1318.
[32] Kaplan, M. P., Chin, S. S., Fliegner, K. H., Liem, R. K., J. Neurosci. 1990, 10, 2735–2748.
[33] Han, S., Zhang, K. H., Lu, P. H., Xu, X. M., Acta Pharmacol.
Sin. 2004, 25, 602–610.
[34] Jang, D. H., Han, J. H., Lee, S. H., Lee, Y. S. et al., Proc. Natl.
Acad. Sci. USA 2005, 102, 16072–16077.
[35] Asada, H., Uyemura, K., Shirao, T., J. Neurosci. Res. 1994,
38, 149–159.
[36] Walsh, D., Li, Z., Wu, Y., Nagata, K., Cell Mol. Life Sci. 1997,
53, 198–211.
[37] Mishra, S., Murphy, L. C., Murphy, L. J., J. Cell Mol. Med.
2006, 10, 353–363.
[38] Nunez, J., Dev. Neurosci. 1986, 8, 125–141.
[39] Ho, C. L., Liem, R. K., Cancer Metastasis Rev. 1996, 15, 483–
497.
www.proteomics-journal.com