Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Development of the nervous system wikipedia , lookup
Synaptogenesis wikipedia , lookup
Neuroanatomy wikipedia , lookup
Optogenetics wikipedia , lookup
Biochemistry of Alzheimer's disease wikipedia , lookup
Signal transduction wikipedia , lookup
De novo protein synthesis theory of memory formation wikipedia , lookup
910 DOI 10.1002/pmic.200600547 Proteomics 2007, 7, 910–920 RESEARCH ARTICLE Cellular processes underlying maturation of P19 neurons: Changes in protein folding regimen and cytoskeleton organization Alex Inberg*, Yoel Bogoch*, Yaniv Bledi and Michal Linial Department of Biological Chemistry, Life Sciences Institute, The Hebrew University of Jerusalem, Jerusalem, Israel Embryonal carcinoma P19 cells provide an ideal model to study molecular programs along differentiation. Upon induction by retinoic acid (RA), the cells undergo a program of differentiation that generates functioning neurons within 60 h. RA induced cells that were plated as sparse (1000 cells/mm2) or dense (4000 cells/mm2) cultures showed a marked difference in the culture morphology with the dense cultures exhibiting rapid maturation and accelerated neurite outgrowth. The protein expression levels of the sparse and dense cultures were compared 48 h following RA. Cell extracts were separated by 1-DE and 2-DE and differential expression (.fourfold) proteins were identified by MS. Here, we focus on 20 proteins associated with cytoskeletal regulation and stress-dependent protein refolding. The first group includes drebrin, cofilin, a-internexin, vimentin, and nestin. Among the proteins in the second group are subunits of the TCP-1, and several chaperones of the Hsp70 and Hsp90 families. We show that coordinated remodeling of the cytoskeleton and modulations in chaperone activity underlie the change in neurite extension rate. Furthermore, a proteomics-based analysis applied on P19 neurons demonstrated pathways underlying neuronal outgrowth, suggesting that a malfunction of such pathways leads to neuropathological conditions. Received: July 21, 2006 Revised: September 29, 2006 Accepted: November 13, 2006 Keywords: Differential expression / Embryonic cancinoma / Neurite outgrowth / Neuronal differentiation / Synaptic plasticity 1 Introduction P19 cells are embryonal carcinoma (EC) cells that serve as a model for studying differentiation processes including commitment to cell lineage [1]. Following cell aggregation in the presence of retinoic acid (RA), P19 cells differentiate into a Correspondence: Professor Michal Linial, Department of Biological Chemistry, Life Sciences Institute, The Hebrew University of Jerusalem, Jerusalem 91904, Israel E-mail: [email protected] Fax: 1972-2-6586448 Abbreviations: HSP, heat shock protein; IF, intermediate filament; NF-M, medium-sized neurofilament; RA, retinoic acid; TCP-1, Tcomplex 1 © 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim neuroectodermal lineage of neurons and glial cells. In a procedure that eliminates all dividing glial cells a homogenous postmitotic neuronal culture is maintained [2, 3]. This culture is thus suitable for studying neuronal differentiation by genomic and proteomic approaches. Undifferentiated P19 cells are fast dividing cells. In the presence of RA, morphogenesis is induced by activation of critical signaling pathways including the Wnt [4, 5] and BMP [6]. Gene expression changes associated with early stages of differentiation in P19 have been reported [7]. Interestingly, changes in gene expression along differentiation of P19 neurons resemble those of embryonal development in the mammalian CNS [8]. * Both authors contributed equally. www.proteomics-journal.com Systems Biology Proteomics 2007, 7, 910–920 Several measures define the complete program of neuronal maturation. These measures include the acquisition of NT phenotype, synapse formation, the establishment of neuronal polarity, and the determination of the rate and extent of neurite outgrowth. Determining the sequence of events of neuronal maturation is instrumental to our understanding of the development, organization, and functionality of mammalian CNS neurons. P19 neurons are suitable model to reveal the cellular program underlying neurite extension and synapse maturation. Recently, a proteomic comparative study on P19 neurons showed that neural differentiation is associated with marked changes in the expression of about 30 proteins that are either induced or repressed relative to the undifferentiated state [9]. Some of these (12 proteins) showed only a transient activation or repression during the RA application and thus can be attributed directly to the presence of RA. We applied a comparative approach to P19 cultures that were induced toward neuronal lineage. In order to uncouple the cellular pathways that contribute to neuronal induction per se with those that are critical for the maturation of neurons, we established culturing conditions that change the pace of neurite outgrowth and neuronal maturation [10]. Cells grown at a high density mature faster. We used both 2-DE and 1-DE methods followed by MALDI-TOF MS to identify proteins from P19 neuronal homogenous cultures at different stages of maturation. Using these techniques we identified differential expression profiles for about 30 proteins, 20 of which were identified reliably and reproducibly. These proteins participate in a small number of cellular processes such as cytoskeletal organization, heat shock, and the chaperone function. 2 Materials and methods 911 firm the maturation of the cultures. Maturation was determined by the ability of the culture to acquire axonal and dendritic polarity [13] and by measuring the cell response to depolarization signal by neurotransmitter release as described [14]. Days of differentiation were counted from the addition of RA, i.e. day 6 of differentiation is equivalent to 48 h after plating. 2.2 Western analysis Cultures at the indicated differentiation stage were scraped with a rubber policeman in a homogenization buffer (25 mM Tris-HCl at pH 8.4, 0.5% NP-40, 150 mM NaCl, 1 mM PMFS, 0.3 M sucrose), and processed by a glass homogenizer. The nuclei and mitochondria were separated by centrifugation (16006g, 10 min, 47C) and discarded. The supernatant was centrifuged for 20 min at 360 0006g in the TLA100 rotor Beckman centrifuge, then at 100 0006g for 1 h resulting in a membranous pellet and a cytosolic fraction. The membranous pellet was resuspended in a 0.6 mL acidic buffer (0.15 M NaCl, 50 mM glycine, pH 2.5, 5 min on ice) and recentrifuged as above. To remove membrane associated proteins, a high salt (0.8 M KCl) solution was added and centrifugation was repeated (18 0006g, 20 min, at 47C) to obtain a purified membranous fraction. Soluble and membranous fractions were separated by a 5–15% SDS-PAGE gradient. Gels were transferred to NC membranes and the protein transfer was validated by Ponceau S Solution (Sigma). Membranes were blocked (1 h at room temperature with 5% nonfat milk powder in TBST buffer (10 mM TrisHCl, pH 7.6, 150 mM NaCl, and 0.1% v/v Tween 20). Following incubation with the appropriate antibodies (12 h, 47C), membranes were washed (3610 min) with the TBST buffer and incubated with the appropriate peroxidase-coupled secondary antibody. Proteins were visualized using ECL Plus reagent (Amersham Biosciences). 2.1 Cell culture 2.3 Immunofluorescence studies P19 cells were originated by M. W. McBurney (University of Ottawa, Canada) and were stored at low passages. Cells were cultured and differentiated as described [11]. Briefly, cells were aggregated in the presence of 0.5 mM RA (Sigma) for 4 days. On day 4, the aggregates were treated with trypsin (0.025%, 5 min, 377C) and plated on culture-grade plates coated with poly-L-lysine (10 mg/mL, Sigma) or AB-30 [12]. All media and sera products were purchased from Biological Industries (Israel). Media were supplemented with 3.5 mM glutamine and with antibiotics (Penicillin, Streptomycin, and Amphotericin B). The cells were plated in a defined medium – DMEM supplemented with BioGro2 (25 mg/mL transferrin, 1 mg/mL insulin, 15 nM selenium, 20 mM ethanolamine, and 10 mM Hepes, pH 7.3) supplemented with 1 mg/mL fibronectin (Biological Industries). Cytosine-b-Darabinofuranoside (Ara-C, 5 mg/mL, Sigma) was added one day after plating, for two days. Medium (without fibronectin) was replaced every 48 h. Functional assays were used to con© 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim For visualization of P19 protein morphology in sparse and dense cultures, cells were induced to differentiate and plated at 1000 cells/mm2 or 4000 cells/mm2 on 35 mm plates. Cells plated on cover slips coated with poly-L-lysine (20 mg/ mL, Sigma) were used for microscopic visualization. The cultures were fixed with 4% paraformaldehyde in PBS for 30 min at 257C, washed three times with PBS (10 min each) and dried briefly with 95% ethanol. The cells following fixation on cover slips were incubated with primary antibody in blocking solution (5% normal goat serum, 1% BSA, 0.1% or 1% Triton X-100 in PBS) at 47C for 10–12 h. The cultures were then washed three times in PBS with 0.1% Triton X-100 (10 min each) and incubated with either goat antirabbit or goat antimouse antibodies conjugated to fluorescent dyes (Rhodamine Red-X or FITC, Jackson immunoresearch, PA) for 1 h at 257C. The plates were washed as before and mounted on slides in mounting buffer (90% www.proteomics-journal.com 912 A. Inberg et al. glycerol, 2% n-propyl gallate, Sigma). The cultures were visualized using an epifluorescent microscope (Axioskop, Zeiss). Cultures incubated with secondary antibody served as controls for background staining. 2.4 1-DE The total protein concentration was determined before proceeding to 1-DE or 2-DE analyses. Equal amount of protein (80 mg) was loaded for each lane. Protein concentration was determined using the enhanced BCA method according to the manufacturer’s instructions (Pierce), with BSA as standard. Crude membranous fractions were subjected to the SDS-PAGE electrophoresis as described [10]. Protein samples were diluted in Laemmli sample buffer and denatured by heat (10 min, 907C) before loading onto a 16-cm long gradient gel (8–18% polyacrylamide). The gels were fixed using 12% acetic acid, 50% ethanol solution, and stained using CBB G250 colloidal stain with subsequent distaining in water. Following destaining, gels were scanned and band intensities were determined. Relative intensities were used for estimating the differential expression levels between samples. 2.5 2-DE The soluble fraction for 2-DE was dissolved in an IEF sample buffer consisting 7 M urea, 2 M thiourea, 4% CHAPS, 40 mM DTT, and 2% v/v ampholites (pH 3–10). The samples were solubilized using an ultrasonic bath (10 min) followed by gentle vortex for 1 h at room temperature. The solution was centrifuged for 15 min at 15 0006g, and the supernatants were collected. Proteins of the soluble fractions were precipitated using the TCA-acetone precipitation method. Four volumes of ice-cold 10% TCA in acetone were added to the sample, followed by 15 min incubation at 2807C, and 1 h incubation at 2207C. The samples were centrifuged (20 0006g, 15 min, 47C), the supernatants were discarded and the pellets were washed three times with ice-cold acetone, followed by centrifugation. The pellets were dissolved in the IEF sample buffer as described above. The method enabled about 70–75% sample recovery, as determined by BCA protein assay. The IPG strips, 11 and 18 cm in length, and pH ranges of 3–10 and 4–7 were used (BioRad). Gel systems and reagents used for 2-DE were purchased from BioRad. The sample was introduced to the strips using an active in-gel sample rehydration technique; namely, the dry strips were placed on the appropriate volumes of sample solution in the IEF cellfocusing tray, and were allowed to rehydrate for 12 h, while 50 V were applied on each strip. Following the rehydration, IEF was performed according to the standard protocols. In brief, gradient voltages were applied on the strips, until total V?h values reached 45 000 or 80 000 V?h in the 11 or 18 cm IPG strips, accordingly. © 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim Proteomics 2007, 7, 910–920 Following IEF, the focused strips were removed from the focusing tray and equilibrated in order to solubilize the proteins and to reduce the disulfide bonds. The strips were placed first in a buffer containing 50 mM Tris-HCl at pH 6.8, 6 M urea, 30% v/v glycerol, 2% w/v SDS, and 2% w/v DTT for 10 min. Afterwards, the strips were placed for 10 min in the same buffer, containing 2.5% iodoacetamide replacing the DTT. Following the reduction/alkylation step, the strips were placed onto 12% SDS-PAGE gels, sealed with 1% solution of low-melting agarose in SDS running buffer containing traces of bromophenol blue dye (Sigma) and run overnight at 20% until the tracking dye reached the bottom of the gel. Gels were fixed using 12% acetic acid, 50% ethanol solution, and stained using CBB G250 colloidal stain with subsequent destaining in water. 2.6 MS analysis The Coomassie colloidal stained spots from the 2-DE gels were cut out as small gel plugs (1–1.5 mm diameter). In the case of the 1-DE gels, the protein bands were excised as close as possible to the stained band to reduce possible contamination. The gel plugs were destained twice (or until all the dye was removed) with 200 mL of 200 mM ammonium bicarbonate (NH4HCO3) at pH 8.0 mixed in the ratio 1:1 with ACN for 45 min at 377C, then the gel pieces were dried completely in SpeedVac. In the case of the 1-DE gels, reduction/alkylation steps were added. The dry gel pieces were rehydrated in 10 mL of 0.02mg/mL of sequencing grade modified trypsin (Promega) in 10% ACN, 40 mM NH4HCO3 at pH 8.0 for 1 h at room temperature to allow the trypsin solution to diffuse into the gel pieces. If required, the gel pieces were covered with 50 mL of 10% ACN, 40 mM NH4HCO3 at pH 8.0 to prevent them from drying. The gel pieces were incubated for 16–18 h at 377C. Following the digestion, the solution was collected and put into a fresh 0.5 mL tube. Fifty microliters of 0.1% TFA were added to the gel pieces, and sonicated for 15 min. The solution was removed and combined with the solution collected in the previous step. The combined solution was dried completely using SpeedVac and resuspended in 10 mL of 0.1% TFA. This solution was used for MS protein identification. In cases of low sample concentration, high salt contamination and poor mass spectrum, a desalting step using RP ZipTip pipette tips (Millipore, MA) was applied according to the manufacturer’s instructions. MALDI-TOF MS analysis was performed on a Bruker Daltonics MICROFLEX mass spectrometer (MS). All the measurements were performed in positive ion/reflectron mode using standard working protocols. For peptide measurements, CHCA was used as a matrix (Applied Biosystems, CA), utilizing the dried droplet technique. In brief, 0.5 mL of sample solution was mixed with a similar volume of the saturated CHCA solution in 30% ACN, 0.1% TFA, spotted on a stainless steel MALDI target, and allowed to dry. The mass measurements were performed according to instrucwww.proteomics-journal.com Systems Biology Proteomics 2007, 7, 910–920 tions, with trypsin autodigestion peaks used as an internal calibrants. The monoisotopic peptide masses were identified using Bruker TOF Analysis software. The peptide masses were sent to MASCOT searching software (Matrix Science, London, UK) using Bruker BioTools software. The NCBI nonredundant protein database was used for searching, with search parameters including oxidation of methionines, carbamidomethyl cysteines, trypsin digestion with one missed cleavage, and a 50 ppm mass error window. Only unambiguously identified proteins having statistically significant searching scores were considered. ESI/MS/MS analysis was performed using a Q-TOF II mass spectrometer (Micromass, UK). The digested samples were loaded directly into the instrument, and analyzed according to the manufacturer’s instructions. The MS/MS data were subjected to database search using MASCOT searching software against the NCBI nonredundant database. 2.7 Image acquisition and data analysis The stained gels were scanned using a UMAX PowerLook II scanner and analyzed using Phoretix 2-D gel analysis software. For integration of annotation and assessing statistical significance of the functional relevance of the identified protein set, we applied the PANDORA concept [15]. Briefly, each protein is associated with a set of functional annotations from external sources (such as Gene Ontology and InterPro). For each annotation, four measures are calculated: sensitivity, specificity, p-value, and corrected p-value. For example, when studying a random set of ten proteins from the mouse proteome sharing a keyword (i.e. serine/threonine kinase), it is essential to determine whether this keyword is assigned to only ten proteins in the entire proteome (sensitivity of 1.0) or to 1000 proteins (sensitivity of 0.01). For a given annotation a, let P be the number of proteins in the set, N the number of proteins in the set that have annotation a, D the number of proteins in the background database (i.e. the mouse proteome), and K the number of proteins in the database that have annotation a. Sensitivity(a) = N/K. Sensitivity measures that what percent of the proteins with annotation a are in the set, out of the background database. Specificity(a) = N/P. Specificity measures that what percent of the protein set has annotation a. The p-value and the Benferoni correction for the p-value is according to [15] and as detailed in www.pandora.cs.huji.ac.il. 2.8 Clones, antibodies, and primers Polyclonal antibody for the medium-sized neurofilament (NF-M) is from Chemicon International (Temecula, CA). Polyclonal antibody for actin (A2066) and mAb for a-tubulin (T6024) are from Sigma-Aldrich. Synaptophysin monoclonal (SY38) is from Chemicon. Monoclonal anti-C2 actin (corre© 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 913 sponding to carboxy terminus, that is, shared by all forms of actin) and monoclonal anti-drebrin (M2F6) that detect drebrin A and E2 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Oligonucleotides used for RT-PCR were tested on a range of temperatures to establish optimal working temperature. The level of ribosomal proteins L19 is constant and used as an internal control for the RNA amounts. PCR was performed using forward: 50 CTGAAGGTCAAAGGGAATGTG30 and reverse: 50 GGACAGAGTCTTGATGATCTC30 oligonucleotides. For b-actin the following oligonucleotides were used: forward: 50 ATGGTGGGAATGGGTCAGAAG3 0 and reverse: 50 CACGCAGCTCATTGTAGAAGG30 . 3 Results In order to focus on specific subprograms in neuronal differentiation that lead to neurite outgrowth and synapse maturation, we compared two P19 cultures. RA induced cells were plated as sparse (1000 cells/mm2) or dense (4000 cells/ mm2) cultures. While the P19 cultures were identical in their time of differentiation, only the dense culture exhibits a rapid maturation and an accelerated neurite outgrowth rate. 3.1 Induction of P19 leads to homogeneous nondividing neuron culture P19 cells respond to RA by differentiating into neuron and glial cells. In order to maintain a pure neuronal population for further analysis we eliminated the dividing cells (see Section 2) and remained with a postmitotic culture. The study of P19 differentiation using proteomic technologies relies on the homogeneity of the cultures (Fig. 1). All visible neurons were intensely stained by a neurofilament antibody (NF-M) confirming the neuronal nature of the extended neurites. These culturing conditions, which eliminate nonneuronal cell types, were maintained for all further analyses. Figure 1. Cultures of P19 neurons on day 8 of differentiation. The P19 cell culture was induced in the presence of RA (4 days). Immunostaining was performed for 72 h after plating (day 8 of differentiation) following fixation with 4% paraformaldehyde and using antibodies to NF-M. Secondary antibodies were goat antirabbit-TRITC. S (sparse) and D (dense) are cultures of slow and fast rate of neurite outgrowth, respectively. Note that the neurons in the fast growing culture are thicker. Bar: 20 mm. www.proteomics-journal.com 914 A. Inberg et al. We have previously demonstrated [13] that the rates of neurite growth and synapse maturation are strongly dependent on culturing conditions. The condition that caused the difference in the pace of neuronal outgrowth and in the entire developmental process is defined by a four-fold change in initial cell concentration of plating. As early as 12 h following plating, a marked difference in neurite length between cultures of different densities was observed. We sought to determine the time window along P19 differentiation in which proteins that participate in determining neurite outgrowth rate are differentially expressed. To this end, we monitored the change in expression of several neuronal specific proteins under conditions of slow and fast neurite extension. We quantified the expression of representative proteins from days 4 to 10 of differentiation in sparse and dense cultures [13]. The cytoskeletal protein NF-M, a member of the NF triplet family, was already maximally expressed on days 4 and 5 of differentiation. However, GAP43, a growth associated protein which is concentrated in axons and growth-cones, is maximally expressed on days 6 and 7 in dense and sparse cultures, respectively. Finally, the expression of synaptoagmin, the Ca21 sensor of the synaptic vesicle, lagged behind and accumulated only on days 8–9 of differentiation. We concluded that maximal changes in proteins that are associated with neurite growth occur on days 6 and 7 of differentiation, similar to the GAP-43 expression profile. Therefore, in this study we focused on protein expression that occurs at this time window of P19 neuronal differentiation. The result of plating cells at different densities has an immediate impact on the culture morphology. The dense culture reaches an entangled neurite network already on day 7 of differentiation whereas the cells plated as a sparse culture mature at a slower rate and reach maturation only after 8–9 days of differentiation. Figure 1 illustrates the morphol- Proteomics 2007, 7, 910–920 ogy of such cultures on day 8 of differentiation. At this stage, both the cultures have already gained axonal and dendritic polarity [10]. Under these conditions, we collected the differentiated neurons on days 6–7 after differentiation and used a proteomics analysis to reveal the process underlying this phenomenon. 3.2 Identification of differentially expressed proteins We have shown that the protein and transcription profiles of P19 culture change during differentiation [16]. Proteins were separated by electrophoresis on 2-D gels. The membranous and insoluble fractions that are poorly resolved by 2-D gels were analyzed by a high resolution 1-DE. Figure 2 shows an 8–18% gradient SDS-gel of P19 on days 6 and 7 of differentiation in sparse (S) and dense (D) plated cultures. We focused on protein bands whose expression was strongly enhanced or suppressed in the dense and sparse cultures. Some of the protein bands (Fig. 2, asterisk) were highly expressed in the sparse culture and their expression was gradually diminished in dense culture, a trend that continued during maturation of the neurons (not shown). We consider these proteins as good markers for early events that are associated with the rate of neurite extension. To ensure a higher resolution and better coverage, we performed 2-D gel separation that provided a representation of the major proteins in the soluble protein fraction. A sample of a differential gel is shown in Fig. 3. Differentially expressed proteins were excised and identified. Peptides were analyzed by MALDI-TOF MS and by ESI MS/MS analysis for final identification. There are ,400 identified separable protein spots in each of the small gels (11 cm) and about 600 spots in the large gels (18 cm). We analyzed only those spots with the most significant differential expression. Figure 2. 1-DE separation of membranous and insoluble P19 extracts. (A) Protein extracts were prepared from cultures on days 6 and 7 of differentiation, separated into soluble and insoluble fractions, and the insoluble fraction was separated by an 8–18% gradient SDS-PAGE. Some of the protein bands that differed significantly between the cultures are marked. Arrowheads mark proteins that were suppressed in the Dense (D) culture relative to Sparse (S) and asterisks mark proteins that were induced in the S relative to D cultures. MW denotes the molecular weight marker (in kDa). Zoom of specific area of the gel illustrates apparent differences in protein expression. (B) Example of a protein band that is suppressed in the dense culture. This protein was identified as nestin. (C) A set of proteins that shows alteration in the intensity of several proteins in the range of 35 kDa. Among these are prohibitin, a marker for switching from a dividing to a nondividing postmitotic cell culture. © 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.com Systems Biology Proteomics 2007, 7, 910–920 915 3.3 Differentially expressed neuronal cytoskeleton proteins Synapse maturation is associated with changes in cytoskeleton modification proteins (Table 1). The proteomics view provides an opportunity for an unbiased survey of several components of the neuronal cytoskeleton. The neuronal cytoskeleton is composed of (i) actin-based microfilaments, (ii) tubulin-based microtubules, and (iii) intermediate filaments (IFs) such as the NF triple bundles. Among the proteins that were identified as differentially expressed between the two experimental cultures (Table 1), we detected at least one representative for each of these three functional groups. Among the proteins that were identified by their differential expression profile, two are subunits of actin (b and g). These actins were induced in the dense plated culture relative to the sparse culture. Furthermore, these differentially expressed proteins were identified independently in the membranous insoluble fraction as well as in the soluble fraction (Table 1). We tested whether the developmental change observed in the b-actin (Table 1) protein is also detected at the mRNA level. We performed RT-PCR using primers specific for b-actin and mRNA of P19 on days 5 and 6 of differentiation. P19 neurons in the dense culture express a high level of b-actin as early as day 5 and this trend continues to day 6 of differentiation (Fig. 5). However, on day 7 and later the difference in b-actin expression of the two cultures becomes attenuated (not shown). Several proteins that modulate actin Figure 3. Representative sections of large 2-D gels. Each section contains about 100 protein spots. “S” and “D” denote sparse and dense cultures, respectively. Only a few protein spots were differentially expressed according to the set fold change criteria (.four-fold). Most of the proteins were unambiguously identified using a PMF method (Fig. 4). An example of the mass spectra of two proteins matricin (CCT-g) and Hsp73 is shown in Fig. 4. In some cases, in order to facilitate the identification and to ensure better coverage of the protein, several peptides were subjected to MS/MS analysis. Table 1 summarizes the proteins identified by MALDITOF MS and confirmed by MS/MS peptide sequencing. Only proteins having .four-fold difference in the dense relative to sparse culture were considered differentially expressed. Several of the proteins were identified in the soluble as well as in the insoluble fraction. Table 1. List of proteins that were identified in independent experiments (in 2–4 experiments out of a total of five experiments on independent P19 neuronal cultures) and whose identification is confirmed by peptide coverage of .10% (by amino acids). 2-D, soluble fraction analyzed by 2-DE. M, membranous and insoluble fraction analyzed by 1-DE Full name Gene name UniProt NCBI gi Activator of HSP90 Alpha-internexin Annexin A5 Beta actin Cofilin-1 Drebrin E, A Gamma actin Heat shock 70 kDa protein 1L Heat shock protein 8 Heat shock protein HSP90-beta Nestin Prohibitin T-complex protein 1 subunit alpha B T-complex protein 1 subunit eta T-complex protein 1 subunit gamma T-complex protein 1 subunit theta T-complex protein 1 subunit zeta Tubulin alpha-1 chain Tubulin beta-5 chain Vimentin Ahsa1 Ina Anxa5 Actb Cfl1 Dbn1 Actg1 Hspa1l Hspa8 Hsp90ab1 Nes Phb Cct1 Cct7 Cct3 Cct8 Cct6a Tuba1 Tubb5 Vim Q8BK64 P46660 P48036 P60710 P18760 Q9QXS6 P63260 P16627 Q5FWJ6 P11499 P21263 P35232 P11983 P80313 P80318 P42932 P80317 P68369 P99024 P20152 22122514 38 117 94730353 55 818 13277612 35 752 49865 41 737 116849 18 428 20454881 77 156 809561 40 992 56757584 70 637 76779312 70 871 123681 83 194 128067 198 606 464371 29 804 1729865 60 449 549060 59 596 549059 60 630 1174621 59 424 549061 57 873 55977479 50 085 56754803 49 671 138536 53 556 © 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim MW (Da) Method Relative Comment to Sparse Reference M M 2-D 2-D/M M M 2-D/M M 2-D/M M M M 2-D/M M 2-D M M M M 2-D/M Down Up Up Up Up Down Up Down Down Down Down Down Up Up Up Up Up Up Up Down [31] [32] [33] [23] [34] [35] [23] [36] [36] [36] [36] [37] [29] [29] [29] [29] [29] [38] [38] [39] Activator of Hsp90 NF maturation Neuronal protection Filaments in dendrites & growth cones Actin dynamics modifier Dendritic shape modifier Filaments in dendrites & growth cones Neuroprotection, Stress response Neuroprotection, Stress response Neuroprotection, Stress response Replaced by neurofilaments Regulating proliferation TCP folding complex TCP folding complex TCP folding complex TCP folding complex TCP folding complex Axonal tracks Axonal tracks Class-III intermediate filaments www.proteomics-journal.com 916 A. Inberg et al. Proteomics 2007, 7, 910–920 Figure 4. MS and identification of an excised protein band from 2-DE. (A) The mass spectrum of the Hsp73 protein. The protein was identified by PMF, with seven matched peaks. One of the identified peaks was subjected to MS/MS analysis, with results further corroborating the identity of the protein. (B) The mass spectrum of the matricin. The identification was based on six matched peaks. (C) Partial sequence assignment of the matched peptides (m/z 878.317) marked with an asterisk on (B) and circled. The partial sequence NVLLD along with the sequence tag matches the tryptic peptide NVLLDPQLVPGGGASEMAVAHALTEK. dynamics were also identified by the proteomics approach including cofilin and drebrin. Cofilin is an actin modulator that is expressed at high levels. The other actin-binding protein is drebrin (Fig. 2, double asterisk). Drebrin was identified as a ,120 kDa band rather than the expected 70–75 kDa. This discrepancy in apparent size can be attributed to an uneven distribution of certain amino acids in the sequence [17]. © 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim Drebrin expression was maximal in the sparse culture on day 6 of differentiation and its level was reduced substantially on day 7 of differentiation (Fig. 2). We performed a Western analysis to quantify the level of drebrin in the different fractions (Fig. 6B). We ensured that identical amounts of proteins were loaded for the comparative analysis. Drebrin is mostly detected as an insoluble fraction. In the insoluble fraction, the amount of drebrin on day 7 of differentiation is www.proteomics-journal.com Proteomics 2007, 7, 910–920 Systems Biology 917 The final group of neuronal cytoskeleton that was identified in our studies belongs to the IFs, including vimentin, which is expressed in the neuronal progenitor in neurons and glia, and nestin. We identified both vimentin and nestin to be repressed in the dense culture and a-internexin to be induced. Figure 5. Expression of b-actin along P19 neuronal differentiation. The RNA used for the RT-PCR was extracted from the P19 neurons at the indicated days of differentiation. The number of PCR cycles was optimized to match the dynamic range of the reaction. Each set of primers was tested three independent times with ,10% variation between independent experiments. A representative result is shown for the expression of b-actin. Expression levels of the ribosomal L19 gene were used for calibration and were identical in all the samples. reduced by 40% relative to the amounts on day 6 of differentiation in the sparse culture (Fig. 6A). Thus analyzing proteins by both 1-D and 2-D gels serves to detect the protein partition into soluble and insoluble fractions, as in the case of drebrin. To view the subcellular fractionation of drebrin on day 6 of differentiation, we compared the distribution of actin to that of drebrin in the P19 neuronal culture. Figure 6C indicates that drebrin is not uniformly distributed in the cells but rather is clustered in puncta in the cell body (Fig. 6C) and in axons where it is clustered in discrete foci. The distribution of b-actin in the sparse culture shows a similar pattern of expression. Unlike the cytoskeletal proteins, the amounts of synaptophysin, the hallmark of small synaptic vesicles, is identical in the sparse and dense cultures (Fig. 6B). 3.4 Synapse maturation is associated with an increase in stress-dependent folding function The largest groups of proteins that are differentially expressed (increased in the dense culture relative to the sparse culture) are molecular chaperones of the T-complex 1 (TCP-1) that assists the folding of proteins upon ATP hydrolysis. Specifically the TCP-1 complex is known to play a role, in vitro, in the folding of actin [18] and tubulin [19]. As such, they play a role as linkers between the increase in cytoskeleton expression (Table 1) and the capacity of the neurons to cope with the fast rate of protein production. An additional group of proteins that were repressed in the dense culture are a set of high molecular weight heat shock proteins (HSPs) of the Hsp70 and Hsp90 families. It has been suggested that Hsp70 regulates tubulin polymerization either directly or indirectly, through association with tau [20]. Another explanation for the high level of HSP proteins in the early stage of differentiation may be the putative role of HSP in regulating the activity of several transcription factors [20]. 3.5 Knowledge gain by integration of annotations In the proteomics research presented here, due to lack of sensitivity of the method used and the limitation of resolution (mainly for the insoluble fraction), we expected only the Figure 6. Drebrin expression and subcellular localization. (A) Histogram from Western analysis of drebrin expression on days 6 and 7 of differentiation for soluble and insoluble fractions. Data from Western blots were quantified and presented as relative intensity. Student t-test was performed and significance levels at p,0.01 (asterisk) between the level of expression on days 6 and 7 for the sparse cultures. (B) Results of Western blot analysis of P19 soluble and insoluble fractions for drebrin and synaptopysin (physin) are shown for day 6 of differentiation. To ensure better quantification of the result, each sample was partitioned and loaded at a ratio of 0.2 and 1.0 of the sample. Each experiment was repeated three times with ,15% variation among experiments. There was no significant difference between the amounts detected for the insoluble fraction on days 6 and 7 for S and D. Immunostaining of drebrin and b-actin in sparse culture on day 7 of differentiation is shown. The particlelike structures along the axons are visible for both proteins. The organization of the proteins in foci along the axon is in line with the increased fraction of the insoluble fraction of drebrin and b-actin along P19 differentiation. © 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.com 918 A. Inberg et al. Proteomics 2007, 7, 910–920 Table 2. Significant keywords for differentially expressed proteins (listed in Table 1) according to PANDORA. There are 8530 InterPro keywords that are divided into Family and Domain (according to the InterPro database). InterPro keywords have a statistically significant value as defined by a corrected p-value, that is, lower than 0.01. Sens, sensitivity; Spec, specificity, for details see Section 2 InterPro type Keyword Number of proteins in the set Sens Spec p-Value Corrected p-value Family Domain Family Family Domain Domain Domain Domain Family Family Chaperonin TCP-1 GroEL-like chaperone, ATPase Chaperonin Cpn60/TCP-1 Chaperonin Cpn60 Intermediate filament, DNA-binding region Actin-binding, cofilin/tropomyosin type Tubulin/FtsZ, GTPase Tubulin/FtsZ, C-terminal Tubulin family Heat shock protein Hsp70 5 5 5 4 2 2 2 2 2 2 0.278 0.172 0.143 0.250 0.133 0.111 0.069 0.067 0.053 0.050 0.294 0.294 0.294 0.235 0.118 0.118 0.118 0.118 0.118 0.118 1.85e-14 2.57e-13 7.01e-13 1.27e-11 6.24e-6 9.09e-6 2.41e-5 2.58e-5 4.16e-5 4.61e-5 3.88e-13 5.39e-12 1.47e-11 2.67e-10 1.31e-4 1.91e-4 5.06e-4 5.41e-4 8.73e-4 9.69e-4 most significant changes in protein expression to be detected. Nevertheless, in order to attribute these findings to potential cellular processes and unified functional annotations, it is often important to be able to quantitatively assess the set of identified proteins in terms of functional significance relative to the random set of that size. We used PANDORA [15] to investigate the significance of keywords for the 20 proteins listed in Table 1. Table 2 presents the p-value for the appearance of the most significant annotations from a database of InterPro annotations [21]. The keywords found to be associated with a very high statistical significance are chaperone, folding, and neuronal cytoskeleton. fractions were ignored in the experiments reported, and (iii) protein expression changes of the undifferentiated or RA induced phase are not included in our study. Axons purified from cultures of injury-conditioned adult dorsal root ganglion neurons were used in another proteomic study [22]. Interestingly, there is a strong overlap with proteins that exhibit axonal translation capacity and the proteins reported in our study. Among the shared proteins are bactin, vimentin, and cofilin. In addition, several HSPs were identified including Hsp60 and Hsp70. We assume that the increase in neurites of the dense (Fig. 1) relative to the sparse cultures also correlates with the enrichment of proteins with the capacity to be transported and synthesized in axons. 4 4.2 Accelerated rate of neurite extension is dependent on enhanced folding capacity with induction of neuronal cytoskeleton Discussion 4.1 Proteomics overview of P19 neurons and other developing neurons Recently, a proteomics-based survey on stages in the differentiation process of P19 neurons was carried out [9]. The results of this study are 28 differentially expressed proteins. Examples are proteins of transcription and translation (53 kDa BRG1-associated factor, eukaryotic initiation factor 4A, several ribosomal proteins). Additional groups detected are signal transduction, several energy producing enzymes, cell protection proteins, and cytoskeletal proteins. The level of overlap with our set is rather limited. Still, some overlap applies to the cytoskeleton elements, especially the increased amounts of cofilin and b- and g-actin. The reasons for the relatively low overlap in protein identification for differentially expressed proteins are numerous: (i) differences in the ages of the cultures; we focused on P19 cells on day 6 of differentiation rather than day 8 of differentiation, (ii) most of the insoluble fractions (including TCP-1, IFs) are poorly represented in the 2-D analysis of the soluble fraction. These © 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim The importance of cytoskeletal dynamics to the maturation of the neurons and neurite extension has been reported in several models. For example, induction of b- and g-actins was reported along the differentiation of neuroblastoma cells [23]. In developing and adult cerebellar cortex b-actin (but not a-actin or g-actin) is localized to dendritic spines, structures which are known to retain morphological plasticity in the adult brain [24]. Clearly, it is not only the amount of the actin proteins that determines the fate of the growing neurites but also the equilibrium between actin polymerization and depolymerization. Indeed the degree of axon branching and the stability of varicosities and synaptic sites are dominated by the level of actin, cofilin, drebrin, and other actin-binding proteins. Furthermore, one of the earliest changes induced by neurotrophines (e.g. NT-3) in the neuron is the remodeling of the cytoskeleton and especially the actin filaments [25]. Immunostaining of P19 culture (Fig. 6) reveals that actin and drebrin molecules partition between the cell body pool and www.proteomics-journal.com Systems Biology Proteomics 2007, 7, 910–920 some local foci along the axons (Fig. 6). We assume that these structures along the axons are part of the insoluble pool of cytoskeletal elements that was analyzed in this study. Interestingly, the reduction in the expression of drebrin (Fig. 6A) precedes the formation of dendrites or mature spines. Thus, the expected role of drebrin in the formation of dendrite-like structures in P19 neuron is questionable [26]. We expect that changing the stoichiometry of drebrin and actin will change the binding capacity for other actinbinding proteins and consequently the dynamics of neurite outgrowth. We concluded that regulation of drebrin and actin dynamics is achieved mainly by relocation of drebrin molecules along the maturation process. The coordination of TCP-1 subunits, which are the major neuronal chaperonins, with the phenomenon of accelerated neurite extension suggests that a high capacity of folding is required to cope with the enhanced production of cytoskeletal proteins. In our study, we show the link between accelerated neurite outgrowth with actin filament organization and subsequent folding. 4.3 Neurite extension proteins and neuropathologies Our study helps in highlighting the key processes in establishing a fast growing culture that resembles CNS neurons. We suggest that the levels and function of chaperones and chaperonins which lead to correct folding and distribution of actin in the brain can be directly linked to neurodegenerative diseases. This assumption is supported by the recent observation that proteasomes are recruited to dendrites as a result of activation and that most of them are connected with insoluble actin in the dendrites [27]. Support for the key role of TCP-1 in maintaining healthy functional neurons comes from studies in which 2-DE followed by MALDI-TOF MS was performed on fetal Down syndrome brains. Interestingly and similar to our findings, several HSPs were identified to be altered and a and b-TCP-1 showed a significant decrease in amounts in the second trimester brain [28]. A similar analysis has been performed in patients with Alzheimer’s disease. TCP-1 ratio to b-tubulin is significantly decreased in the temporal, frontal, parietal cortex, and in the thalamus of patients with Alzheimer’s disease [29]. Neuronal cytoskeleton dynamics strongly correlates with CNS and PNS pathologies. Interestingly, some of the proteins identified in the maturation state such as nestin, are known to participate specifically in regeneration and brain repair. During embryogenesis, transient expression of nestin signals the commitment of progenitor cells to differentiate. Up regulation of nestin expression has been reported following injury, leading to the speculation that nestin may be involved in brain repair [30]. In P19 nestin was seen in growth cone, supporting its role in neurite growth in line with our proteomics results. Thus during neurite growth and maturation, proteins that participate in actin stability are likely to play an active role. © 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 919 As most of the proteins that were identified in our study are related not only to cytoskeletal modulation but also to the chaperon refolding process, we assume that these are the main processes that can be attributed to the change in the rate of neurite growth and neuronal maturation. Our results support the notion that chaperone-refolding processes are not activated as a protection mode in a stress response but rather participate in scenarios where a cellular demand for efficiency in protein production, protein transport, and shipment is introduced. The combination of a proteomicsbased study on homogenous cultures with subcellular visualization is essential for studying dynamic processes in neurons. Furthermore, using a limited scale of comparative proteomics we were still able to propose a functional mechanistic network in a highly dynamic environment such as neuronal growth. We thank the Kennedy Lee Trust for their support in the MALDI TOF. This research could not be conducted without their generous support. This study was initiated by Sharon Tayar and Julia Weiner. A. I. was supported by the Sudarsky Center for Computational Biology. 5 References [1] Bain, G., Ray, W. J., Yao, M., Gottlieb, D. I., Bioessays 1994, 16, 343–348. [2] Bain, G., Gottlieb, D. I., Perspect. Dev. Neurobiol. 1998, 5, 175–178. [3] Finley, M. F., Kulkarni, N., Huettner, J. E., J. Neurosci. 1996, 16, 1056–1065. [4] Smolich, B. D., Papkoff, J., Dev. Biol. 1994, 166, 300–310. [5] Tang, K., Yang, J., Gao, X., Wang, C. et al., Biochem. Biophys. Res. Commun. 2002, 293, 167–173. [6] Bani-Yaghoub, M., Felker, J. M., Sans, C., Naus, C. C., Exp. Neurol. 2000, 162, 13–26. [7] Wei, Y., Harris, T., Childs, G., Differentiation 2002, 70, 204– 219. [8] Pachernik, J., Bryja, V., Esner, M., Kubala, L. et al., Physiol. Res. 2005, 54, 115–122. [9] An, J., Yuan, Q., Wang, C., Liu, L. et al., Proteomics 2005, 5, 1656–1668. [10] Parnas, D., Linial, M., Brain Res. Dev. Brain Res. 1997, 101, 115–124. [11] Parnas, D., Linial, M., Int. J. Dev. Neurosci. 1995, 13, 767–781. [12] Bledi, Y., Domb, A. J., Linial, M., Brain Res. Brain Res. Protoc. 2000, 5, 282–289. [13] Parnas, D., Linial, M., J. Mol. Neurosci. 1997, 8, 115–130. [14] Parnas, D., Linial, M., Brain Res. Brain Res. Protoc. 1998, 2, 333–338. [15] Kaplan, N., Vaaknin, A., Linial, M., Nucleic Acids Res. 2003, 31, 5617–5626. www.proteomics-journal.com 920 A. Inberg et al. [16] Bogoch, Y., Bledi, Y., Tayar, S., Linial, M., in: Silman, I. (Ed.), Cholinergic Mechanisms: Function and Dysfunction, Taylor & Francis 2004, pp. 137–144. [17] Keon, B. H., Jedrzejewski, P. T., Paul, D. L., Goodenough, D. A., J. Cell Sci. 2000, 113, 325–336. [18] Llorca, O., McCormack, E. A., Hynes, G., Grantham, J. et al., Nature 1999, 402, 693–696. [19] Melki, R., Rommelaere, H., Leguy, R., Vandekerckhove, J., Ampe, C., Biochemistry 1996, 35, 10422–10435. [20] Calabrese, V., Scapagnini, G., Ravagna, A., Giuffrida Stella, A. M., Butterfield, D. A., Dev. Neurosci. 2002, 24, 1–13. [21] Mulder, N. J., Apweiler, R., Attwood, T. K., Bairoch, A. et al., Brief Bioinform. 2002, 3, 225–235. [22] Willis, D., Li, K. W., Zheng, J. Q., Chang, J. H. et al., J. Neurosci. 2005, 25, 778–791. [23] Ulloa, L., Avila, J., Eur. J. Neurosci. 1996, 8, 1441–1451. [24] Micheva, K. D., Vallee, A., Beaulieu, C., Herman, I. M., Leclerc, N., Eur. J. Neurosci. 1998, 10, 3785–3798. [25] Zhang, H. L., Singer, R. H., Bassell, G. J., J. Cell Biol. 1999, 147, 59–70. [26] Takahashi, H., Sekino, Y., Tanaka, S., Mizui, T. et al., J. Neurosci. 2003, 23, 6586–6595. [27] Bingol, B., Schuman, E. M., Curr. Opin. Neurobiol. 2005, 15, 536–541. © 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim Proteomics 2007, 7, 910–920 [28] Yoo, B. C., Fountoulakis, M., Dierssen, M., Lubec, G., J. Neural. Transm. Suppl. 2001, 321–334. [29] Schuller, E., Gulesserian, T., Seidl, R., Cairns, N., Lube, G., Life Sci. 2001, 69, 263–270. [30] Yan, Y., Yang, J., Bian, W., Jing, N., Neurosci. Lett. 2001, 302, 89–92. [31] Panaretou, B., Siligardi, G., Meyer, P., Maloney, A. et al., Mol. Cell 2002, 10, 1307–1318. [32] Kaplan, M. P., Chin, S. S., Fliegner, K. H., Liem, R. K., J. Neurosci. 1990, 10, 2735–2748. [33] Han, S., Zhang, K. H., Lu, P. H., Xu, X. M., Acta Pharmacol. Sin. 2004, 25, 602–610. [34] Jang, D. H., Han, J. H., Lee, S. H., Lee, Y. S. et al., Proc. Natl. Acad. Sci. USA 2005, 102, 16072–16077. [35] Asada, H., Uyemura, K., Shirao, T., J. Neurosci. Res. 1994, 38, 149–159. [36] Walsh, D., Li, Z., Wu, Y., Nagata, K., Cell Mol. Life Sci. 1997, 53, 198–211. [37] Mishra, S., Murphy, L. C., Murphy, L. J., J. Cell Mol. Med. 2006, 10, 353–363. [38] Nunez, J., Dev. Neurosci. 1986, 8, 125–141. [39] Ho, C. L., Liem, R. K., Cancer Metastasis Rev. 1996, 15, 483– 497. www.proteomics-journal.com