Download Novel Blocked-Cleavable Primers for Quantitative Detection of

Novel Blocked-Cleavable Primers for Quantitative
Detection of Nucleic Acid Sequences Using rhPCR
Integrated DNA Technologies (IDT) has developed a novel method for the detection of nucleic acid sequences in a
complex sample that has improved specificity and decreased background compared to traditional approaches. The
method employs a variant of the polymerase chain reaction (PCR) that uses 3’-end blocked primers which cannot
prime DNA synthesis. A cleavable RNA linkage is positioned near the 3’ end of the primer. Following hybridization to
a complementary sequence, the terminal blocking group is removed by action of a thermostable RNase H2 enzyme.
Importantly, the RNase H2 enzyme, which is simply added as a component of the PCR master mix, functions in real time
during PCR. The unblocking reaction is exquisitely sensitive to correct base pairing and requires that the primer be in
duplex form. The unblocking step is inhibited by the presence of a base mismatch in the vicinity of the cleavage site.
Through this mechanism, the blocked primers provide improved specificity when compared to unmodified primers,
resulting in reduced mispriming and eliminating primer-dimer formation. This allows for a greater number of PCR cycles to be run, giving the potential for increased sensitivity. The method is called RNase H–dependent PCR (rhPCR) [1].
rhPCR can be performed in both end-point and real-time modes. The assay can be run using a fluorescent intercalating
detection method such as SYBR® Green I, or as a 5’ nuclease (aka “TaqMan” or “PrimeTime”) fluorescent probe assay. The
basic reaction scheme is outlined in Figure 1.
Blocked-cleavable primers prevent PCR
R
R
RNase H2 primer cleavage
Rp
OH
rhPCR can use
standard 2-step
or 3-step cycling
OH
pR
DNA polymerase extends
newly unblocked primers
KEY:
Figure 1. “rhPCR” Reaction Scheme.
R
R
Blocked-cleavable primers
OH
Unblocked (activated) primers
pR
Cleavage fragment with 5 phos
Cleavable RNA in primers
Novel Blocked-Cleavable Primers for Quantitative
Detection of Nucleic Acid Sequences Using rhPCR
Elimination of primer dimers
While careful selection of priming sites often prevents primer dimer formation, it is sometimes necessary to position primers
in unfavorable locations and primer dimers can be a significant problem. An HCV amplicon was described that employed
primers optimized to amplify viral nucleic acids across a broad spectrum of serotypes which was compromised by the
formation of multiple primer dimer species (see Roche patent US06001611). Short primer dimer species dominated the
reaction, effectively excluding amplification of the desired longer HCV product. This HCV system was employed to demonstrate the ability of rhPCR to eliminate primer-dimers. Amplification products made using HCV primers in PCR vs. rhPCR were
visualized by gel electrophoresis. Standard PCR resulted mostly in formation of useless primer dimer products while rhPCR
eliminated this problem and only the desired 242 bp HCV amplicon was seen. Results are shown in Figure 2 below. Working
via a similar mechanism, blocked-cleavable primers can also reduce primer cross-reactivity in highly multiplexed assays.
Unmodified Primers
Blocked-cleavable primers
ST280A For:
GCAGAAAGCGTCTAGCCATGGCGTTA
GCAGAAAGCGTCTAGCCATGGCGTTAgTATG-x
ST778AA Rev:
GCAAGCACCCTATCAGGCAGTACCACAA GCAAGCACCCTATCAGGCAGTACCACAAgGCCT-x
Figure 2. Elimination of Primer-Dimers in an HCV Assay Using rhPCR. U – unmodified primers; B – blocked-cleavable primers.
CAGT = DNA, cagu = RNA, and x = C3 spacer (blocking group).
Improved Performance of Multiplex Reactions
As discussed above, primer-dimers can cause significant problems, even in non-multiplex amplification reactions, and can
ruin a complex reaction. The effects of primer-dimers are magnified in multiplex PCR because undesired primer–primer interactions make it difficult to mix multiple primers together while retaining the performance achieved when each reaction
is run individually. Primer-dimers result in the appearance of nonspecific amplification products and reduced efficiency of
the desired amplification reactions because reaction components/substrates are consumed by short primer-dimer amplicons, which replicate at higher efficiency than longer amplicons. Use of blocked-cleavable primers in rhPCR can significantly
improve multiplex reaction performance.
Figure 3 shows the development of a 15-plex PCR assay (using 30 primers) visualized by gel electrophoresis. Individual reactions are efficient, each producing the single desired amplification product, but the same primers fail when combined as a
15-plex reaction. The multiplex reaction was rescued by converting to blocked-cleavable primers and rhPCR.
2
Multiplex 15 Amplicons
Figure 3. Blocked-Cleavable Primers Improve Multiplex PCR Performance. A 15-amplicon PCR was run as
(1) 15 individual reactions and pooled (control); (2) a 15-plex rhPCR using blocked-cleavable primers; and (3) a
15-plex PC using standard, unmodified primers. [Image courtesy of Jenn Jakubowski, Syzygy Biotech.]
Improved Specificity: Discriminating Closely-Related Genes
Human tumors are often grown in immune-deficit rodent systems as a routine part of oncology research. The human tumor
mass becomes infiltrated with rodent fibroblasts and endothelial cells. Even though sequences differ between these xenogeneic orthologs, cross reactivity can be a significant problem, and sometimes the researcher is unaware of this cross-reactivity problem.
As a demonstration of the improved specificity of the rhPCR method, standard primers for a known human HRAS SYBR
Green qPCR assay were used in RT-qPCR (55 cycles) with either human or rat cDNA. Despite what appears to be relatively
large differences in sequence between species at the priming sites, the human primers misprimed and generated a “false
positive” signal in the rat cDNA (ΔCq = 11; Figure 4A). The same primer sequences were converted to the blocked-cleavable
primer format and were used with the same target cDNA samples. Using rhPCR, a correct “true positive” signal was observed
using human cDNA and no amplification was detected using rat cDNA in the 55-cycle reaction (Figure 4B).
A.
B.
Figure 4. Improved Specificity of rhPCR. (A) Human HRAS primers were used in a SYBR® Green RT-qPCR
(55 cycle) using either human or rat cDNA. (B) Alignment of human HRAS primer sequences with rat Hras.
CAGT = DNA, cagu = RNA, and x = C3 spacer (blocking group)
3
Novel Blocked-Cleavable Primers for Quantitative
Detection of Nucleic Acid Sequences Using rhPCR
Improved Specificity: SNP Detection
Single nucleotide polymorphisms (SNPs) are common and often correlate with important biological traits. The ability to
accurately discriminate between different alleles is critical for modern diagnostics. A mismatch at or near the RNA base has a
large effect on the ability of RNase H2 to cleave a blocked-cleavable primer and can be used as the basis for SNP discrimination. When designing the blocked-cleavable primer, position the SNP at the RNA base. Note that it is also important to know
the location of any additional SNPs in your target gene to be sure that other polymorphisms, which can influence cleavage
or priming efficiency (affect primer Tm), are not near the cleavage site.
As a demonstration of the improved SNP discrimination of the rhPCR method, primers specific for a known human SNP
(rs4939827 in the SMAD7 gene) were used in a SYBR Green qPCR assay. Reactions were run for 45 cycles using 2 ng human genomic DNA homozygous “TT” or “CC” at this locus and either unmodified, traditional allele-specific PCR primers or
blocked-cleavable rhPCR primers. Standard allele-specific primers resulted in mismatch discrimination of <2.0 cycles. Using
the blocked-cleavable primers, discrimination of the rU:G (black curves) and rC:A (blue curves) mismatches were 12.6 and
12.1 cycles, respectively (Figure 5).
Allele-Specific PCR Primers
Blocked-Cleavable Primers
C-For:
CAGCCTCATCCAAAAGAGGAAAC
CAGCCTCATCCAAAAGAGGAAAcAGGA-x
T-For:
CAGCCTCATCCAAAAGAGGAAAT
CAGCCTCATCCAAAAGAGGAAAuAGGA-x
Rev:
CTCACTCTAAACCCCAGCATT
CTCACTCTAAACCCCAGCATTgTCTG-x
Where CAGT = DNA, cagu = RNA, and x = C3 spacer (blocking group); position of the SNP is underlined.
Figure 5. SNP Detection Using rhPCR. The data show greater discrimination of SNPs by blocked-cleavable primers.
4
As a further example of the utility of rhPCR in SNP discrimination, 31 different human genomic DNA samples from the Coriell
repository were studied using the rs4939827/SMAD7 assay described in Figure 4. PCR was performed in real-time (45 cycles)
and end-point (35 cycles) formats. In every case, the correct genotype (homozygous T/T, heterozygous T/C or homozygous
C/C) was easily called (Figure 6).
A.
B.
Figure 6. Real-Time and End-Point rhPCR Analysis of 31 Human Genomic DNA Samples at the rs4939827/SMAD7 Locus.
(A). Cq values. (B) Fluorescence intensities.
Rare Allele Detection
rhPCR is a form of “biased amplification”, which can be used for rare allele detection, one of the most demanding applications for PCR. An rhPCR SYBR Green qPCR assay was designed for the rs4939827 SNP in the SMAD7 gene (see Figures 4–6
above). Non-discriminatory, standard PCR primers were used for the control reactions. Allele detection was performed using
rhPCR with new GEN2 blocked-cleavable primers (which show slightly improved SNP discrimination over the original GEN1
primer design).
A standard curve for quantification was made using known amounts of “C” allele DNA. For rare allele detection, genomic
DNA representing 66,000 copies of the “T” allele was present in all reactions and 0, 6 (1:10,000), or 66 (1:1000) copies of “C”
allele genomic DNA was spiked into each reaction mix. PCR and rhPCR were performed.
Using rhPCR, the presence of the “C” allele was easily detected when spiked into a background of competing “T” allele DNA
at a 1:1000 ratio (ΔCq = 8).
Using rhPCR, the presence of the “C” allele was distinguished when spiked into a background of competing “T” allele DNA at
a 1:10,000 ratio (ΔCq = 3).
Complete results are shown below in Table 1.
Copies of “T” Allele
0
0
0
66000
66000
66000
Copies of “C” Allele
66
6
0
66
6
0
Control PCR* (Cq)
32.2
35.9
>40
21.1
21.2
21.0
C-Allele–Specific rhPCR† (Cq)
31.4
34.6
>40
31.9
34.8
37.9
* Control PCR Primers
†
Blocked-Cleavable Primers
rs4939827 For:
CAGCCTCATCCAAAAGAGGAAA
For rC:
CAGCCTCATCCAAAAGAGGAAAcAxxA
rs4939827 Rev:
CTCACTCTAAACCCCAGCATT
Rev :
CTCACTCTAAACCCCAGCATT
Table 1. Rare Allele Detection Using rhPCR. CAGT = DNA, cagu = RNA, and x = C3 spacer (blocking group)
5
Novel Blocked-Cleavable Primers for Quantitative
Detection of Nucleic Acid Sequences Using rhPCR
Designing Blocked-Cleavable Primers
IDT is continuing to develop new applications for rhPCR and make improvements to protocols and primer design. The current best practice of rhPCR involves two different designs of blocked-cleavable primers, GEN1 and GEN2. Different primer
designs are recommended for different applications. GEN2 primers show higher specificity, but are slightly more expensive
and require use of higher RNase H2 enzyme concentrations; therefore, in general, IDT recommends their use primarily for
applications where the added specificity they confer is necessary (Table 2). The basic designs for GEN1 and GEN2 primers
are shown in Figures 7 and 8.
GEN1 Blocked-Cleavable Primers
GEN2 Blocked-Cleavable Primers
Improving specificity of routine PCR
Genotyping
Reducing primer-dimer formation
Multiplex reactions: 2–20 amplicons
Rare-allele detection
Multiplex reactions: 10–~100+ amplicons
Table 2. Recommended Uses for Specific Designs of Blocked-Cleavable Primers.
Figure 7. Design of GEN1
Blocked-Cleavable Primers.
Figure 8. Design of GEN2
Blocked-Cleavable Primers.
6
Summary: Key Features of the rhPCR Assay
•
The assay uses two synthetic oligonucleotides, blocked-cleavable forward (“For”) and reverse (“Rev”) primers.
•
The assay uses two enzymes, a thermostable DNA polymerase and a thermostable RNase H2 (available from IDT at
www.idtdna.com/order/kits.aspx?type=rnaseh2).
•
The assay can be performed in either end-point or real-time modes.
•
The assay is quantitative when run in real-time format.
•
Primers are non-functional prior to unblocking by RNase H2.
•
Unblocking is achieved via cleavage at a single RNA residue placed near the 3’ end of the primer. Cleavage removes the
blocking group leaving a 3’-OH, resulting in a species capable of priming DNA synthesis.
•
PCR amplification does not begin until primer unblocking occurs, which is mediated by a thermostable enzyme at
elevated temperature. The thermostable RNase H2 enzyme has minimal activity at room temperature, automatically
conferring a “hot start” character to the reaction and eliminating the need for a “hot start” DNA polymerase.
•
Cleavage is sensitive to match/mismatch resulting in very high specificity for base sequence in this region. Accuracy is
suitable for use in SNP discrimination and is superior to standard allele-specific PCR.
•
The assay is fully compatible with SYBR Green I dye or 5’ nuclease detection methods.
•
Applications/benefits of rhPCR
èè
èè
èè
èè
èè
Eliminate primer-dimer artifacts
Improve performance of multiplex reactions
Eliminate cross reactivity and amplification of related genes
SNP discrimination
Rare allele detection
References
1.
Dobosy JR, Rose SD, et al. (2011) RNase H-dependent PCR (rhPCR): improved specificity and single nucleotide polymorphism detection using blocked cleavable primers. BMC Biotechnol, 11:80.
7