Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Polycomb Group Proteins and Cancer wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Neuronal ceroid lipofuscinosis wikipedia , lookup
Protein moonlighting wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Mir-92 microRNA precursor family wikipedia , lookup
Point mutation wikipedia , lookup
Human Molecular Genetics, 2015, Vol. 24, No. 13 3775–3791 doi: 10.1093/hmg/ddv123 Advance Access Publication Date: 9 April 2015 Original Article ORIGINAL ARTICLE biogenesis and recapitulate features of syndromic ciliopathies Rivka A. Rachel1, Erin A. Yamamoto1, Mrinal K. Dewanjee1, Helen L. May-Simera1,†, Yuri V. Sergeev1, Alice N. Hackett1, Katherine Pohida1, Jeeva Munasinghe2, Norimoto Gotoh1, Bill Wickstead3, Robert N. Fariss1, Lijin Dong1, Tiansen Li1 and Anand Swaroop1,* 1 National Eye Institute, 2National Institute of Neurological Disease and Stroke, National Institutes of Health, Bethesda, MD 20892, USA and 3School of Life Sciences, University of Nottingham, Nottingham, UK *To whom correspondence should be addressed at: Neurobiology-Neurodegeneration and Repair Laboratory, National Eye Institute, MSC0610, 6 Center Drive, Bethesda, MD 20892, USA. Tel: +1 3014355754; Fax: +1 3014809917; Email: [email protected] Abstract Distinct mutations in the centrosomal-cilia protein CEP290 lead to diverse clinical findings in syndromic ciliopathies. We show that CEP290 localizes to the transition zone in ciliated cells, precisely to the region of Y-linkers between central microtubules and plasma membrane. To create models of CEP290-associated ciliopathy syndromes, we generated Cep290ko/ko and Cep290gt/gt mice that produce no or a truncated CEP290 protein, respectively. Cep290ko/ko mice exhibit early vision loss and die from hydrocephalus. Retinal photoreceptors in Cep290ko/ko mice lack connecting cilia, and ciliated ventricular ependyma fails to mature. The minority of Cep290ko/ko mice that escape hydrocephalus demonstrate progressive kidney pathology. Cep290gt/gt mice die at mid-gestation, and the occasional Cep290gt/gt mouse that survives shows hydrocephalus and severely cystic kidneys. Partial loss of CEP290-interacting ciliopathy protein MKKS mitigates lethality and renal pathology in Cep290gt/gt mice. Our studies demonstrate domain-specific functions of CEP290 and provide novel therapeutic paradigms for ciliopathies. Introduction Defects in primary cilia biogenesis or associated functions can lead to pleiotropic phenotypes in syndromic diseases, collectively termed ‘ciliopathies’ (1,2). Recent studies have begun to unravel complex genotype–phenotype relationships in ciliopathies that are caused by mutations in dozens of different genes (3–5). Affected tissues include the retina (6), brain (7) and kidney (8), as well as abnormalities at the organismal level including situs inversus (9) and obesity (10). Unique clusters of symptoms have acquired clinical diagnoses such as Joubert (11,12), Meckel–Gruber (13) and Bardet–Biedl syndrome (BBS) and nephronophthisis (14). Retinal degeneration is a highly penetrant component in most syndromic ciliopathies; one type of non-syndromic ciliopathy is Leber congenital amaurosis (LCA) that includes childhood blindness caused by retinal dysfunction (15,16). Pioneering studies in Chlamydomonas first linked intraflagellar transport with genes related to sensory ciliopathy phenotypes in mammals (17). Although the cilia in Chlamydomonas are motile, in contrast to the sensory cilia of vertebrates, basic genetic principles of microtubule organization and cilia function appear to be highly conserved (18). The sensory or primary cilium plays an important developmental role (3,19), serving as a signaling center † Present address: Cell and Matrix Biology, Institute of Zoology, Johannes-Gutenberg. Received: November 29, 2014. Revised: March 9, 2015. Accepted: April 7, 2015 Published by Oxford University Press 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US. 3775 Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015 CEP290 alleles in mice disrupt tissue-specific cilia 3776 | Human Molecular Genetics, 2015, Vol. 24, No. 13 CEP290-associated ciliopathies, particularly Joubert and Meckel– Gruber syndromes. Results CEP290 localizes to the transition zone in cilia, and specifically to the Y-linker region of photoreceptor connecting cilium Using both immunolocalization and biochemical approaches, CEP290 had been localized to the basal body (44,51), transition zone (33,37,52) and pericentriolar satellites (41,53). To clarify and validate CEP290 localization, we performed immunostaining in a number of ciliated mouse tissues (Fig. 1). In choroid plexus, we identified CEP290 at the apical surface, distal to rootletin, in an array corresponding to the base of the multiple cilia (Fig. 1A), which in these cells transition from motile to sensory function in the neonatal period (54,55). CEP290 also localized to the base of motile cilia in the ventricular ependymal lining and in trachea between rootletin and acetylated alpha-tubulin, a marker of the ciliary axoneme (Fig. 1B and C). In the kidney, CEP290 was detected at the base of the primary cilia (Fig. 1D). In photoreceptors, CEP290 is in a location consistent with the connecting cilia (Fig. 1E). We confirmed the localization of CEP290 in the connecting cilium of adult wild-type photoreceptors using immuno-electron microscopy. In longitudinal sections, CEP290 immunogold particles were present in the transition zone region and not in the basal body (Fig. 1F). In cross-sections of the cilium, we could more precisely localize CEP290 to the region of the Y-linkers, between the central 9+0 ring of microtubules and the plasma membrane (Fig. 1G and H). Phenotype of Cep290-ko mice parallels Joubert syndrome in humans The Cep290 gene spans 85 kb on mouse Chromosome 10 and includes 54 exons (Fig. 2A). To create a null allele, Cep290 exons 1–4 were replaced in embryonic stem (ES) cells with a β-gal-neoR cassette by homologous recombination. Southern blot analysis of ES cell clones showed appropriate targeting (Fig. 2B), and PCR genotyping could discriminate the wild-type (295 bp) and knockout alleles (391 bp) (Fig. 2C). No CEP290 protein was detectable in the knockout retina by immunoblotting (Fig. 2D). About 80% of the Cep290ko/ko mice died between birth and weaning (Supplementary Material, Table S1) likely due to lethal hydrocephalus (clinical ventriculomegaly) that became apparent at 2–3 weeks of age, as manifested by a domed head (asterisk, Fig. 3A). Subclinical ventriculomegaly was observed in mutant pups at P3 (data not shown). The Cep290ko/ko mice that did not develop overt hydrocephalus by 1 month of age survived with normal fertility and lifespan for as long as 2 years. We noticed that a mixed genetic background of C57BL/6 and 129/SvJ resulted in higher survival than either pure inbred background, in which no homozygous knockout mice survived beyond the N2 or N3 backcross generation (data not shown). A higher number of Cep290ko/+ mice survived on the C57BL/6 background than on 129/SvJ (Supplementary Material, Table S2); indeed, we were unable to propagate the mutation on the 129/SvJ line beyond N3 backcross generation. The Cep290ko/ko mice developed early signs of retinal pathology, including blood vessel attenuation and pigmentary changes of the fundus by 2–3 months of age (data not shown). As predicted from both human CEP290 mutations and the Cep290rd16 mouse, both scotopic and photopic Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015 (20,21) and mechanosensor (22). In sensory tissues, cilia are modified to mediate specific functions such as establishment of the sterocilia bundles, which transmit sound wave frequency and intensity in the cochlea, transduction of photons by photoreceptors, and ligand–receptor interactions in the olfactory epithelium. Some of the physiological complexity of cilia function arises from the diversity of signaling pathways active within the cilium, and the fact that different signaling pathways might operate in specific tissues. For example, Shh and canonical Wnt signaling, non-canonical Wnt/planar cell polarity and calcium signaling/fluid flow are associated with organogenesis and/or physiological functions in multiple tissues (9,22–30). A fundamental question is how cilia dysfunction affects such a broad spectrum of tissues/organs and results in wide range of pathologies. One explanation is that cilia contribute to disparate functions in individual organs (31). One ciliopathy protein may exert distinct impact on specific ciliated cells by virtue of alternate interactors, different signaling pathways or unique and tissue-specific functions. Among dozens of proteins contributing to major ciliopathies, a prominent hub is CEP290 (15), which is shown to localize to the ciliary transition zone and has numerous interacting partners (32–34). CEP290 has been a target of intense scrutiny since its discovery as the causal gene for Joubert syndrome in humans (35,36) and congenital blindness in rd16 mice (37). Mutations in CEP290 are now shown to be a frequent cause of LCA (38) and diverse syndromic ciliopathies (39). As CEP290 mutations cause BBS and a range of other syndromic phenotypes (15), CEP290 is expected to exert important connectivity to the BBSome and many ciliary proteins (40). Indeed, CEP290 interacts with CEP72 and PCM-1 to localize BBS4 to the cilium (41), and is required with PCM-1 for ciliary localization of Rab8a to promote ciliogenesis (42), a function antagonized by Cp110 (43). CEP290 participates in discrete cilia-associated protein complexes, including a transition zone complex with other Joubert and Meckel syndrome proteins in NIH-3T3 cells (34) and a centrosomal complex with NPHP5/IQCB1 in IMCD3 cells (44). NPHP5/IQCB1 interacts with CEP290 to promote ciliogenesis in RPE-1 cells (45). In Chlamydomonas, CEP290 is an essential component of the transition zone, where it attaches microtubules to the membrane and might regulate protein flow into the cilium (32). In a reported mouse retinal degeneration model Cep290rd16, the connecting cilium forms (46), though with abnormal crosssectional structure (33) and rudimentary outer segments (37). Unlike syndromic ciliopathies, the phenotype in the rd16 mouse is restricted to sensory neurons (33,37,47). The Cep290rd16 allele is not null and produces low levels of a shorter CEP290 protein (37). The domain deleted in Cep290rd16 interacts with Mkks (Bbs6), another ciliopathy protein that causes BBS and is part of the chaperonin complex (48–50). Interestingly, decreasing Mkks expression in the Cep290rd16 mouse leads to partial rescue of photoreceptor structure and function (33). CEP290 is expected to have diverse functions in mammalian ciliated cells/tissues as suggested by its extensive interaction network and association with numerous clinical phenotypes (15,39). To understand CEP290 function and its role in human syndromic ciliopathies, we generated null (Cep290 ko ) and truncated (Cep290 gt ) alleles of Cep290 in mice. Our findings suggest that CEP290 is critical for formation of the ciliary transition zone in several tissues, including photoreceptors and ventricular ependyma. Dominant effects of a truncated Cep290 gt protein are detected in kidney and in viability, both of which are partially rescued by decreasing Mkks. Our studies further elucidate the complex actions of CEP290 in cilia and provide insights into the mechanism of pathology in human Human Molecular Genetics, 2015, Vol. 24, No. 13 | 3777 brain ventricle at P13 (left panel) and CEP290 (red) with acetylated tubulin (green), rootletin (white) and DAPI nuclear counterstain in brain ventricle sections (right panel). (C) CEP290 (green) and acetylated tubulin (red) expression in adult lung with DAPI nuclear counterstain. (D) Adult kidney expression of CEP290 (green) and rootletin (red) with DAPI nuclear counterstain. (E) In photoreceptors CEP290 localizes distal to the ciliary rootlet with a small gap in between where the basal body lies, indicating that CEP290 is confined to the connecting cilia (transition zone). (F and G) Immuno-electron microscopy images showing CEP290 expression using silverenhanced gold-conjugated secondary antibody (large black dots) in the connecting cilia of wild-type adult photoreceptors in both longitudinal (F) and cross-sections (G). CEP290 localization was visualized by silver enhancing individual colloidal gold particles (black dots). Note localization between the plasma membrane and the microtubule ring, in the area of the Y-linkers, as illustrated by the line diagram (H). Abbreviations: CV, cerebral ventricle; TZ, transition zone; BB, basal body; R, ciliary rootlet. ERGs showed complete lack of response by 3–4 weeks of age (Fig. 3B). Similar to the Cep290rd16/rd16 mutant (33,46), profound degenerative changes were evident at Postnatal day (P)14, including a thinner outer nuclear layer (ONL), no outer segments and severely shortened inner segments; most photoreceptors were lost by P28 (Fig. 3C). To assess the cerebral pathology and cause of the domed head, we performed high-resolution MRI imaging of brains after fixation (Fig. 3D and E). Massive expansion of the lateral ventricles in Cep290ko/ko mice caused severe hydrocephalus, visible in both frontal/coronal and sagittal axes, with cortical thinning and distortion of the cerebellum and brain stem (red lines, Fig. 3E). Subclinical ventriculomegaly was also noticeable in an asymptomatic P14 Cep290ko/ko mouse (blue arrows, Fig. 3E). The kidney phenotype, featured in many Cep290mediated ciliopathies (56,57), was slowly progressive. Kidneys appeared slightly pale and enlarged in a young adult (Fig. 3F), and, cysts were observed in Cep290ko/ko mice after 12 months of age (Fig. 3G). A relatively mild renal phenotype is consistent with Joubert syndrome (58), in which only 2% of cases exhibit renal cysts at an average age of 8 years (59). CEP290 is required for photoreceptor cilium and outer segment biogenesis Vision loss prompted us to closely examine the photoreceptors (Fig. 4). Using antibodies to acetylated tubulin and rootletin, markers of the ciliary axoneme and ciliary rootlet, respectively, we observed defects in inner and outer segment formation in P14 Cep290ko/ko retina (Fig. 4A). While inner segments were rudimentary, no evidence of outer segment formation was detected, demonstrating a more severe phenotype compared with Cep290rd16/rd16 retina (37). Electron microscopy studies (Fig. 4B–F) revealed complete lack of outer segments and connecting cilia in P14 Cep290ko/ko retina (red circles, Fig. 4B), although basal bodies were intact (blue circles, Fig. 4B). The 9+0 microtubule ring was Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015 Figure 1. CEP290 is expressed in the transition zone at the base of the cilia in multiple tissues. (A) CEP290 (red) and rootletin (green) expression in the choroid plexus sections at P0–1 with DAPI nuclear counterstain (blue). Enlarged single cells are shown to the right. (B) CEP290 (red) and acetylated tubulin (green) in flatmounted 3778 | Human Molecular Genetics, 2015, Vol. 24, No. 13 clones by Southern blot. Genomic DNA was digested with AvrII and probed with a 519 bp Cep290 fragment identifying the 5′ end of the gene, generating a 10 kb wild-type band and a 13 kb knockout band in targeted clones. PGK-DTA selection element was removed in the stem cells. (C) PCR genotyping distinguishes wild-type allele (295 bp) from the knockout (ko; 413 bp). (D) Immunoblot of wild-type P13 retina using a C-terminal antibody to CEP290 shows specific protein bands. The lower band corresponds to the CEP290 monomer, and the higher band is likely a dimer. These bands are absent in the knockout mice. distinct from the basal body as in wild-type photoreceptors (green circles; Fig. 4C), but failed to dock at the apical plasma membrane of the inner segment. By comparison, Cep290rd16/rd16 retina developed both basal bodies and connecting cilia (blue and red circles, respectively, Fig. 4C), even though photoreceptors degenerated rapidly thereafter. Instead of the elongated disks of normal outer segments, the Cep290ko/ko photoreceptors developed small, round membrane vesicles between the inner segments and the microvilli of the retinal pigment epithelium (Fig. 4D). In contrast, Cep290rd16/rd16 photoreceptors had rudimentary outer segments (Fig. 4E). A cross-section view of the connecting cilia region revealed 9+0 microtubule ring in the cytoplasm of the Cep290ko/ko photoreceptors, whereas photoreceptors in Cep290rd16/rd16 retina developed a membrane-bound connecting cilium with abnormal morphology (irregular membrane and microtubule ring structure; Fig. 4E). Thus, full-length CEP290 protein is essential for connecting cilium development. To gain further insights, we immunostained P13 Cep290ko/ko retina with several antibodies against photoreceptor proteins, including CEP290 and RPGR, a ciliary protein that interacts with CEP290 (37) and mutations in which are a major cause of inherited retinal degeneration (60). We compared the data with the same markers in Cep290rd16/rd16 and Rpgrko retina (Supplementary Material, Fig. S1). CEP290 was normally expressed in the connecting cilium of Rpgr-ko photoreceptors, significantly reduced but still present in Cep290rd16/rd16, and undetectable in Cep290ko/ko retina (Supplementary Material, Fig. S1A–C). The photoreceptor organization as identified by rootletin/CROCC, which marks the ciliary rootlets in the inner segments, was noticeable in the Cep290ko/ko retina. RPGR immunostaining was absent in the RPGRko, partly detected in Cep290rd16, and minimal in the Cep290ko/ko retina (Supplementary Material, Fig. S1B). RPGRIP1, another cilia protein that interacts with both CEP290 and RPGR and is associated with retinal degeneration (15), was present in the RPGRko but absent in Cep290 mutant alleles (Supplementary Material, Fig. S1C). These results suggest that Cep290 may act downstream (epistatic) to RPGR and RPGRIP1 and reaffirms its central role in photoreceptor development. CEP290 is essential for maturation of ventricular ependymal cilia In ventricular cells of the Cep290ko/ko brain, primary cilia do form but show progressive developmental defects (Fig. 5A). At P0, the primary cilia, as identified by acetylated tubulin, were longer compared with control (Fig. 5B). Motile cilia emerged later and were fewer in number, but appeared longer. In addition, the surface area of each cell, outlined by ZO-1, was smaller than in wildtype cells (Fig. 5C). Scanning electron microscopy images of the ventricular surface showed the transition from single primary cilia to tufts of multiple motile cilia from P0 to P5 in the wildtype brain; yet, in the Cep290ko/ko, single primary cilia continued to grow longer with possibly delayed transition into fewer but longer tufts of cilia (Fig. 5D). We used transmission electron microscopy to define ciliogenesis defects in ventricular ependyma (Fig. 6). In P0 wild-type lateral ventricles, a single primary cilium is present per epithelial cell (Fig. 6A), and the deuterosome, a nucleation structure for biogenesis of multiple basal bodies, was occasionally visible (Fig. 6A, P0 right panel; white arrow). A docked primary ciliary vesicle surrounding the emerging primary cilium was detected in wildtype ependyma at P0 (Fig. 6A, dotted circle and red arrows). In Cep290ko/ko ependyma, however, though cilia began to form by P0, no enclosure around the cilium (the ciliary vesicle) was detected and the plasma membrane constrictors did not generate a bubble-like structure for eventual cilia emergence (Fig. 6B, red arrows). By P3, the deuterosome is surrounded by nascent basal bodies in the wild-type (Fig. 6C, left panel; white arrow) and multiple cilia emerged through the ciliary pocket (Fig. 6C, middle panel; dotted circle), which surrounded emerging ciliary tufts oriented in a similar direction (Fig. 6C, red arrows). In P3 Cep290ko/ko ependyma, few nascent basal bodies were seen congregating around the deuterosome (Fig. 6D, left panel, white arrow), and Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015 Figure 2. Generation of a Cep290 knockout allele results in lethal hydrocephalus. (A) Cep290 genomic locus and design of the targeting construct. Genomic DNA spanning Cep290 exons 1, containing the ATG translation initiation site, through 4 (1.887 kb) was replaced with a beta-Gal cassette (5.163 kb). (B) Documentation of targeted ES cell Human Molecular Genetics, 2015, Vol. 24, No. 13 | 3779 Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015 Figure 3. Inactivation of the Cep290 gene in mice leads to features of Joubert syndrome. (A) Postnatal (P)21 day Cep290ko/ko mouse shows stunted growth and hydrocephalus (enlarged head, asterisk) compared with normal littermate. (B) Dark-adapted (scotopic) and photopic ERG recordings in Cep290ko/ko mice around 3 weeks of age show complete lack of response under both conditions. Wild-type littermates show normal responses. (C) H&E images of control and Cep290ko/ko retina at P14 and P28. Lower panels are enlargements of areas indicated in upper panels. At P14, note lack of outer segment formation. At P28, Cep290ko/ko mice exhibit rapid loss of photoreceptors with only a single row of photoreceptors (likely cones) remaining, similar to Cep290rd16/rd16 (46). Original magnification 40×. (D and E). Brains of P14 and P28 wild-type and Cep290ko/ko mice viewed by high-resolution (50 µm), T1 weighted 3D-MRI imaging. Note enlarged cerebral ventricles in the mutant (asterisks in D and E), resulting in severe thinning of the cerebral cortex. Slightly enlarged lateral ventricles in the normal-appearing P14 Cep290ko/ko pup (blue arrows in E) reveal both that cortical thinning is secondary to hydrocephalus, and that subclinical ventriculomegaly occurs in asymptomatic knockout mice. Lower row of panels in E, sagittal views of the cerebellum from same brains shown above. Note secondary distortion of the brainstem from the enlarged ventricles. (F) Whole kidneys from adult wildtype (left) and Cep290ko/ko (right) mice. Note slight pallor and enlargement of the knockout. (G) In each panel, cortex is positioned at the top and medulla at the bottom of the image. At 18 months of age, Cep290ko/ko kidney shows moderate cystic tubular pathology. Scale bar = 50 µm. 3780 | Human Molecular Genetics, 2015, Vol. 24, No. 13 Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015 Figure 4. Cep290 is required for photoreceptor ciliogenesis and outer segment morphogenesis. (A) P16 wild type and Cep290ko/ko retina labeled with acetylated α-tubulin (red) and rootletin (green, left panels) or RKIP (green, right panels). (B) EM cross-section through connecting cilia region in wild-type and Cep290ko/ko P14 retina showing isolated, membrane-bound cilia among inner and outer segment profiles. Cilia are circled in red; basal bodies in blue. In the Cep290ko/ko retina, although basal bodies form, no distinct cilia are identified. Instead, the circular 9+0 microtubule structures remain within inner segment cytoplasm and fail to extend (green circles). Thus, outer segments are likewise absent. (C) EM cross-sections through P10 Cep290rd16/rd16 photoreceptors showing connecting cilia (red) and basal bodies (blue). (D) EM longitudinal sections at P14 show connecting cilia and OS in wild type; lack of OS in Cep290ko/ko. Instead, vesicular membranes (ves) form between the RPE microvilli (mv) and the inner segments. (E) Comparison of longitudinal EM sections of P14 wild-type and Cep290rd16/rd16 photoreceptors showing rudimentary development of the outer segments in Cep290rd16/rd16 mice, a phenotype intermediate between wild type and Cep290ko/ko. (F) EM cross-sections through the connecting cilium of P14 wild type, Cep290ko/ko and Cep290rd16/rd16 photoreceptors showing a clear, isolated membrane around the connecting cilium in wild type; failure of the microtubule ring to extend from the cytoplasm in Cep290ko/ko, and malformed (oval) connecting cilia in Cep290rd16/rd16. Human Molecular Genetics, 2015, Vol. 24, No. 13 | 3781 tubulin (green). Note extremely long cilia in the knockout (white arrows). Over time, the wild-type cilia transform from a single cilium to clumps of cilia; this transformation is delayed and defective in the mutant. (B) Quantitation of cilia length at P0 from images in A showing much longer cilia in the mutant (n = 236 control, 131 knockout; unpaired two-tailed t-test; P < 0.0001). (C) Quantitation of images in A showing cell surface area at P0; area is significantly smaller in the mutant (n = 456 control, 439 knockout; unpaired two-tailed t-test; P = 0.002). (D) Scanning electron microscopy images of P0, P5 and P19 ventricular ependymal surface. Red arrows indicate very long cilia in the knockout. Note the absence of cilia tufts in the knockout at P19. the cilia that emerged directly from the plasma membrane were misoriented in the absence of the ciliary pocket (Fig. 6D, red arrows). At P5, multiple cilia emerging from each wild-type cell were oriented in the same direction, exiting from the apical surface into the ventricle (Fig. 6A, P5). While each wild-type ven- or no central microtubules and disturbances in the number, order and structure of the outside ring of microtubules (Fig. 6H). These findings suggest a critical role of CEP290 during the emergence of ventricular ependymal cilia. tricular ependymal cell had a large number of cilia at P5 (Fig. 6E), the Cep290ko/ko cells revealed only a few misoriented cilia (Fig. 6F) that seemed to exit individually rather than together through the ciliary pocket (Fig. 6F). We then imaged crosssections of P5 cilia to examine the internal structure of the axoneme. As expected, the normal 9+2 pattern of microtubule doublets was apparent in the wild type (Fig. 6G). In contrast, the Cep290ko/ko cilia had multiple abnormalities, including multiple A truncation allele of Cep290 exhibits a more severe phenotype In humans, distinct CEP290 mutations (missense, nonsense, internal deletion or frame-shift) result in varying ciliopathy phenotypes. Interestingly, the Cep290rd16/rd16 mice have a sensory cilia-restricted phenotype, and while the Cep290ko/ko does manifest as a ciliopathy, the kidney phenotype appears milder than some Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015 Figure 5. Cep290 is required for proper maturation of ventricular ependymal cilia. (A) Flatmount view of P0 and P5 wild-type and Cep290ko/ko ventricular ependyma labeled with antibodies of ZO-1 (green), outlining the cell bodies, and acetylated alpha-tubulin outlining primary cilia (red). P19 labeled with antibody to express acetylated alpha- 3782 | Human Molecular Genetics, 2015, Vol. 24, No. 13 through the ciliary pocket (red circle). (D) In the knockout at P3, deuterosomes are present but basal bodies fail to congregate around them, and cilia emerge single and directly from the cell body rather than from a ciliary pocket. Moreover, when multiple cilia emerge from the same cell, they are not all oriented in the same direction. At lower power (far right), microvilli are seen to protrude but very few cilia. (E,F) Note the difference between numbers of basal bodies and emerging cilia in wild type (E) and Cep290ko/ko (F) ependyma. (G,H) Cross-sections of wild type and knockout cilia showing 9+2 microtubule configuration in wild type (G), and various defects in the knockout (H). human CEP290 syndromes. To expand the phenotypic spectrum, we obtained a Cep290 gene-trap (hereafter referred to as Cep290gt) ES cell line and generated mice which produce a 116 kDa protein including the N-terminal part of CEP290 at Glu1036 (encoded by the first 25 out of 55 Cep290 exons) fused to β-galactosidase (Fig. 7A and B). As shown by X-gal staining, the CEP290 protein is widely expressed (Fig. 7C). A vast majority of Cep290gt/gt embryos die between E12 and E14 (Supplementary Material, Table S3, and data not shown); however, except for pallor, mutant embryos that survive appeared grossly normal even until E17 (Fig. 7D). By Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015 Figure 6. Defects in ventricular ependymal ciliary pocket formation and cilia orientation. (A and B) Cilia formation at P0 in wild type (A) and Cep290ko/ko (B) ventricular ependyma. Note prominent ciliary pocket in the normal cell (red circle and red arrows), and presence of a deuterosome (white arrow). In the Cep290ko/ko, the ciliary pocket either does not form or forms incompletely. (C) At P3 in wild type, basal bodies congregate around the deuterosome (white arrow) and cilia (red arrows) exit Human Molecular Genetics, 2015, Vol. 24, No. 13 | 3783 Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015 Figure 7. Truncation allele of Cep290 has gain of function phenotype with severe kidney disease and mid-gestation lethality. (A) Diagram of mouse Cep290 gene showing insertion site of the pGT0xfT2 gene trap vector in intron 25. (B) Immunoblot using anti-β-galactosidase antibody, showing band of expected size (∼116 kDa) for the CEP290β-galactosidase fusion protein in the gt/+ retina. Renal levels of CEP290 expression are lower and invisible at this level of detection. GAPDH loading control is shown below. (C) Expression of CEP290 revealed by X-gal staining of tissue expressing β-galactosidase from Cep290-lacZ fusion construct. Expression is observed in epithelial tissues, including choroid plexus (enlargement shown below), ventricular ependyma containing tufts of motile cilia, airways (enlargement below), ureter (upper panel), renal tubules (lower panel), cerebellum and mid-gestation embryos. (D) Cep290gt/gt embryos at E13, E17; hepatic pallor is a primary visible feature. (E) P19 kidneys; rare Cep290gt/gt survivor with massive cystic kidney. (F) H&E kidney staining, P19 wild type and P3, P19 Cep290gt/gt pups, showing progressive cystic kidneys eliminating renal parenchyma (upper panels, 10×) resulting in cellular infiltrate (lower panels, 40×). (G) H &E stained P10 and P18–19 retinal sections, wild type and Cep290gt/gt. Note lack of outer limiting membrane (white arrow) and OS; pyknotic nuclei/thinning of the ONL, indicating rapid cell death in Cep290gt/gt. Original magnifications: P10 upper, 40×; P10 lower and P18–19, 60×. (H) TEM images of P14 wildtype and Cep290gt/rd16 compound heterozygous retinas in longitudinal (upper) and cross sections (lower). Cross-sections of connecting cilia, red circles; basal body-cilia transition, blue circles. Abbreviations: OS, outer segments; IS, inner segments; ONL, outer nuclear layer; INL, inner nuclear layer; CC, connecting cilia. 3784 | Human Molecular Genetics, 2015, Vol. 24, No. 13 2–3 weeks of age, the rare surviving Cep290gt/gt mice had massively dilated, pale kidneys (Fig. 7E), characterized by loss of tubules, cellular infiltrate and massive cysts replacing most of the renal cortex and outer medulla (Fig. 7F). Thus, the truncation allele (gt) causes a Meckel syndrome like phenotype. The retina of Cep290gt/gt mice showed clear abnormalities at earlier ages compared with Cep290ko/ko or Cep290rd16/rd16 (Fig. 7G,H); for example, apparent over-proliferation of the ONL was observed by P10, along with loss of the outer limiting membrane (Fig. 7G). We previously reported mitigation of the Cep290rd16/rd16 phenotype by allelic loss of Mkks (33). Thus, we tested whether removal of one or both alleles of Mkks would influence the severity of Cep290ko and Cep290gt alleles. Surprisingly, when combined with Mkksko alleles, we observed a partial rescue of the Cep290gt/gt embryonic lethality (Fig. 8A, Supplementary Material, Table S4) and renal pathology (Fig. 8B). In contrast, Cep290ko/ko; Mkksko/ko embryos died before E11, as no double homozygotes were recovered at or after this stage (Supplementary Material, Tables S4 and S5). The Cep290ko/ko; Mkksko/+ mice survived for 2–3 weeks and exhibited severe hydrocephalus and faster retinal degeneration than Cep290ko/ko mice (Fig. 8C). Modeling of a CEP290 oligomeric structure in the connecting cilia Based on the requirement of CEP290 in photoreceptor and ventricular ependyma ciliogenesis, we sought to predict CEP290 tertiary structure to gain further insight into its possible mechanism of action at the transition zone (Supplementary Material, Fig. S2). Domain prediction of both mouse and human CEP290 identified extensive coiled-coils throughout the protein, almost to the exclusion of other domains (Supplementary Material, Fig. S2A). Only a few other cilia proteins share such a domain structure. To explore the tertiary structure of CEP290, we used GlobProt 2 (version 2.3, http://globplot.embl.de) and identified six coiledcoil domains covering the full length of the protein, interspersed with five small peptide regions exhibiting structural disorder (Supplementary Material, Fig. S2B; Table S6), which indicate five nodes that might maintain molecular flexibility of an otherwise rigid, rod-like molecule (Supplementary Material, Fig. S2C). The Multicoil 2 program (http://groups.csail.mit.edu/cb/multicoil/ cgi-bin/multicoil.cgi) predicted the location of coiled-coil regions and suggested that CEP290 has the propensity to form oligomeric structures; the possible dimer, trimer and tetramer models of the DSD showed predicted coiled-coil diameters of 2.3, 2.7 and 2.9 nm, respectively (Supplementary Material, Fig. S2F and G). A monomer would have a predicted diameter of ∼1.4 nm. The entire protein is predicted to have a maximum theoretical length of ∼348 nm, thus forming a long, thin rod-like molecule. In contrast, the truncated CEP290 protein of 116 kDa had a relatively high propensity to form a dimeric coiled-coil structure compared with that of the full-length trimeric protein (Supplementary Material, Fig. S2F). The structures of full-length and truncated CEP290 are interrupted by the coiled-coil vimentinlike structure (residues 696–752), which showed 29% identity to vimentin protein sequence as demonstrated by Phyre2 and SMART. The rest of the truncated CEP290 protein revealed 13% sequence identity to tropomyosin with 12 coiled-coil heptad motifs (HxxHCxC) confirming the coiled-coil conformation. The 116 kDa protein is shortened by 58% and predicted to have a maximum length of 145 nm. Figure 8. Loss of Mkks rescues Cep290gt/gt defects but accentuates the Cep290ko/ko phenotype. (A). Adult (2.5 months) mice carrying mutant alleles of both Cep290 and Mkks, with genotypes as indicated; top view (left) and side view (right) show the same littermates. Note domed head in the Cep290gt/gt; Mkksko/+ mouse (white asterisk and black arrow), but otherwise normal appearance. (B) Histological sections of kidney from adult wild type and P17–18 pups of the genotypes indicated. Left panels (10×) are oriented with the renal cortex to the right and medulla to the left. Right panels (40×) show renal tubules. The Cep290gt/gt; Mkksko/ko genotype has mild cystic changes (asterisks); compare with Cep290gt/gt images in Figure 7F. (C) Histological sections of P16 retina from control, Cep290ko/ko and Cep290ko/ko; Mkksko/+, showing more rapid ONL loss in the triple allele mutant. Discussion Loss of CEP290 results in widespread ciliary defects in multiple tissues and accompanying disease phenotypes consistent with Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015 Loss of Mkks rescues the Cep290gt/gt phenotype but accentuates the Cep290ko/ko phenotype Human Molecular Genetics, 2015, Vol. 24, No. 13 RPGRIP1 mutations. Recent evidence shows that RPGR and RPGRIP1 have reciprocal requirements for proper ciliary localization and function (67,68). Multiple mutations in human CEP290-based disease lead to a variety of conditions and symptoms (39), suggesting complex genetic regulation and tissue- and domain-specific functions of this large protein. Both N and C termini contain dimerization domains, and binding sites for numerous interactors are spread throughout the protein (15,39,43,69). We have now studied three alleles of Cep290: Cep290rd16 (hypomorph), Cep290ko (null) and Cep290gt (dominant). Tissue-specific requirements for CEP290 are evident by varying effects of its loss in different organs. Photoreceptors are highly sensitive to the absence of CEP290 (70), resulting in complete absence of cilia formation and rapid death of the cells in all three alleles ( present results and (37)). In Cep290rd16, only sensory organs are affected (33,37,47), whereas the Cep290ko exhibits more severe systemic manifestations. To our initial surprise, the Cep290 null allele generated by removing exons 1–4 in mouse does not result in overt or serious kidney dysfunction; however, the fact that the Cep290gt mouse does exhibit severe cystic renal disease validates a role for CEP290 in kidney function. Pronephros morphogenesis utilizes Wnt signaling (71), and loss of canonical Wnt signaling is associated with development of nephronophthisis in adult mice (23). A disruption of this pathway occurs in renal cysts but not retina of a ciliopathy mouse model (72). These results, in combination with our findings, suggest that loss of Cep290 function does not directly disrupt Wnt signaling, but that a dominant or novel function of the Cep290gt N-terminal fragment may do so. While our manuscript was in preparation, another report described investigations on Cep290gt mice, generated independently by using the ES clone we also employed (73). This report further supports the concept that Wnt signaling is not directly disrupted in Cep290-related pathology and finds that Hedgehog (Hh) signaling may be the pathway through which kidney development is disrupted in the Cep290gt mice; however, a direct relationship between Hh and CEP290 remains to be shown. The newly discovered BBS-Shh negative regulator LZTFL1/BBS17 may provide a link (9,74). Based on the negative regulation of BBSome ciliary trafficking and Shh signaling by LZTFL1 (9,74), the rescue we observe with Cep290gt in combination with reduced Mkks could be mediated by a similar mechanism. The fact that both truncation alleles Cep290rd16 and Cep290gt show rescue, lends support to this hypothesis and provides insights into diversity of phenotypes observed in human CEP290 mutations. Human mutations in CEP290 result in a broad spectrum of ciliopathies, from non-syndromic congenital vision loss (LCA) to nephronophthisis, Joubert syndrome and embryonic lethal Meckel–Gruber syndrome (39). A review of CEP290base mutations (http://medgen.ugent.be/cep290base/overview.php) shows that LCA can be caused by mutations throughout the protein, whereas Joubert syndrome results from nonsense mutations in the C-terminal half of the protein, and many Meckel–Gruber mutations are nonsense mutations within the first half of the protein. A mutation causing nephronophthisis, in contrast, results from a single residue deletion in the last exon (exon 54). With the exception of LCA, a rough correlation exists between severity of disease phenotype and mutation position within Cep290. Similar findings occur with mouse Cep290ko and Cep290rd16 alleles; our findings with the Cep290gt suggest that some mutations leading to severe phenotypes in human, such as Meckel–Gruber syndrome, may in fact be gain-of-function alleles. However, a construct similar to the truncated protein in Cep290gt mice was found to rescue vision Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015 human ciliopathies. Interestingly, the CEP290 defects manifest as excessively longer primary cilia in the ventricular lining and other cell types rather than the absence of cilia as in many other ciliary gene mutants. Motile cilia in the ventricular lining are delayed in emergence and fewer in numbers but are also longer in the adult mutants than in the controls. In the photoreceptors, however, outer segment morphogenesis fails completely, and the connecting cilia are often not docked at the apical inner segment membrane. Given that the outer segment is a modified sensory cilium and the connecting cilia is analogous to the transition zone of primary cilia, we show that ciliogenesis in photoreceptors is dramatically compromised in the Cep290 null mutant. We hypothesize that either photoreceptors are particularly sensitive to loss of CEP290, or that CEP290 has additional specialized functions in this cell type, probably due to the exceptionally large amount of biomolecules trafficked through the connecting cilia. In concordance, CEP290 expression is far greater in photoreceptors compared with any other cell type. A formal possibility, yet to be excluded, is that ciliogenesis does occur at one point, but rapid failure of outer segment morphogenesis is so damaging to the cell that we are observing a late outcome. We also note that the excessively long primary and motile cilia are unlikely to function normally. These intriguing possibilities require further exploration in future studies. The pleiotropic human disease phenotypes caused by CEP290 mutations and a large number of its interacting proteins suggest multiple functions for this large, coiled-coil domain protein. Previous studies have suggested a role for CEP290 as a ciliary gatekeeper (32,61) and identified both microtubule binding and auto-inhibitory domains (62). The dramatically longer cilia that we have observed here could be the result of unchecked entry of biomolecules into the cilia, consistent with the putative gating role for CEP290 at the transition zone. Alternately, the longer cilia could indicate that CEP290 is a sensor for regulating cilia length via a feedback mechanism from the tip. Signaling processes through the primary cilia are dependent on a segregated ciliary compartment that maintains a distinct pattern of biomolecule distribution from the remainder of the cell. Additional points from our study shed further light on the function of CEP290 in mammalian ciliogenesis and its role in ciliopathies, helping us define the role of CEP290 in space and time: time, in terms of ciliogenesis, developmental stage and aging; space, in terms of tissue-specificity, region of the cilium and protein domains responsible for various functions. Moreover, our findings assist in correlating the range of phenotypic manifestations of human CEP290 mutations. At what point in the process of ciliogenesis does CEP290 act? In the unicellular flagellate Chlamydomonas, CEP290 has been shown to tether transition zone microtubules to the membrane (32). We now show that transition zone formation essentially depends on CEP290, as the absence of this protein in photoreceptors results in failure of the connecting cilium to extend from the plasma membrane, although basal bodies and distal appendages are present. Docking of ciliary vesicles with the mother centriole (basal body) at its anchor point to the plasma membrane involves CEP164 (63) and CCDC41 (64). The mother centriole connects to the plasma membrane via distal appendages, structures whose formation is dependent on CEP123, ODF1 (65) and CC2D2A (66). Both Rab8a (63) and PCM1 have been implicated in these processes, and both interact with CEP290 (42), as do CEP123 (65) and CC2D2A (51). This suggests that CEP290 is required closely downstream of CEP164, CCDC41, Cep123, ODF1 and CC2D2A, but likely upstream of RPGR and RPGRIP1, as our results indicate; epistasis could thus explain why in general CEP290-mediated retinal degeneration is more severe than that caused by RPGR or | 3785 3786 | Human Molecular Genetics, 2015, Vol. 24, No. 13 partial explanation, differential rescue of the three Cep290 mutants by Mkks loss is intriguing. Truncated forms of CEP290 are expressed in Cep290rd16 and in Cep290gt, both of which show ciliary rescue with loss of MKKS ( present results and (33)). In contrast, no protein is detected in the Cep290ko, which exhibits a more severe phenotype in combination with Mkksko. MKKS is part of a complex with BBS10 and BBS12 involved in BBSome assembly (50). Yeast two-hybrid studies suggest an interaction of CEP290 with several components of the BBSome (Helen L. MaySimera, unpublished data), required for transporting membrane proteins to the cilium (89,90). In addition to its interaction with MKKS (33), CEP290 interacts with BBS4, likewise required for BBSome assembly (40,41). The BBSome is intact in BBS4ko/ko mice (91) but disrupted in Mkksko/ko mice (50). Compared with Cep290rd16/rd16 mice, Cep290rd16/rd16; Bbs4ko/ko mice exhibit a more severe phenotype (40), whereas Cep290rd16/rd16; Mkksko/ko mice show rescue (33). Thus, similar to LZTFL1/BBS17, a cytoplasmic negative regulator of BBSome ciliary trafficking mentioned above (74), our present findings suggest that CEP290 may be a negative regulator of BBSome function at the transition zone. Our studies have implications for designing therapies to treat ciliopathies, in that inhibiting BBSome function may, at least in some CEP290mediated ciliopathies, result in mitigation of phenotypic severity. Materials and Methods Generation of Cep290 knockout (Cep290ko) mice Murine centrosomal protein 290 (Cep290) gene, as currently annotated, spans 85.37 kb on chr10 with a total of 53 exons. The genomic organization of the locus is highly conserved between mouse and human. To inactivate the Cep290 gene creating a null allele in mouse, exons 1–4 of the gene were replaced in ES cells with a β-gal-neoR cassette by homologous recombination (92) as shown in Figure 2. Briefly, a gene targeting vector of replacement type was constructed from a BAC clone isogenic to the SV129 mouse genome and carrying the Cep290 locus through ET recombination or recombineering (93). The bacteria Diphtheria toxin A (DTA) coding sequence was included in the targeting vector driven by PGK promoter as negative selection (94). Linearized targeting vector was electroporated into the R1 ES cells (95). Homologous recombination events were identified by genomic Southern, after digest with AvrII, using a 519 bp probe upstream of exon 1 and outside the left targeting arm, generating bands of 10 and 13 kb for wild type and mutant, respectively. Correctly recombined ES clones were microinjected into blastocysts of C57BL/6J to make chimeras, and germline transmitted F1 mice from clones A2 and B1 were obtained by crossing high percentage male chimeras with wild-type C57BL/6J mice (92). The presence of the targeted allele was confirmed by long genomic PCR. The null or knockout allele will be referred to as the ko allele in this paper. Genotyping primers are common forward, CATTATCGTA TAGCCTGTGTCAGGGGAACT; wild type reverse, ATCTGCTAACTC TTCTTGCCGTGGCAGGTC; knockout reverse, TGTGCTGCAAGG CGATTAAGTTGGGTAACG. Generation of Cep290 genetrap (Cep290gt) mice Cep290gt/gt mice were generated from an ES gene trap cell line, CC0582 (SIGTR), made by the Sanger Center. Sequencing identified the chromosome 10 breakpoint in Cep290 intron 25, 3.2 kb downstream of exon 25. The breakpoint sequenced as follows: intron 25: AATGTGGAAGGCAGATGGGAAACTGGAAAATGTGA TAGGT- pGT0lxfT2 beta-geo vector sequence:GTTCAGGTTTGAG Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015 in a zebrafish model of cep290 vision loss (75), indicating differences among species. The specific cilia defects observed in photoreceptors and ventricular ependymal cilia provide deeper understanding of various spatial and temporal components of the cilium, including the ciliary pockets, diffusion barrier and transition zone formation. The striking absence of the ciliary pocket in Cep290ko/ko ependyma raises the question of the normal significance of this structure. The ciliary pocket has been suggested to orient primary cilia for directional sensing (76), as we see with the highly misoriented cilia in the absence of the ciliary pocket in the Cep290ko/ko. That CEP290 is required for development of the ciliary pocket provides another potential link between ciliogenesis and planar cell polarity (77), as has been demonstrated in airway epithelia (78). The transition from a single primary to motile cilia has likewise been demonstrated in airway epithelia (79). Our data show that CEP290 is essential for integrity of the transition zone, and that it localizes to the region of the Y-linkers, which connect the microtubule ring with the plasma membrane (80). While not known to constitute a component of the Y-connectors, CEP290 has been demonstrated to connect the plasma membrane and the ciliary microtubules (62), although evidence conflicts as to whether CEP290 binds microtubules directly or through an interaction protein such as CEP162, a critical component of transition zone assembly (81). Recent evidence supports the existence of a ciliary pore complex, analogous to the nuclear pore complex, acting as a diffusion barrier at the transition zone (82,83). CEP290, perhaps in connection with the Y-linkers, could form part of this barrier. The precise relationship between CEP290 and the Y-linkers remains to be determined. Plausible limits for the structural and functional position of CEP290 within the transition zone can be reached by combining these results with the immunoEM results (see Fig. 1F and G) and previously determined dimensions, also confirmed here, of individual microtubules (25 nm), ciliary microtubule rings (∼150 nm diameter) and the photoreceptor connecting cilium (250 nm width by 1500 nm length) (Fig. 9). These numerical constraints suggest that CEP290 (either singly or as an oligomer) may be located vertically along the length of the transition zone in the region of the Y-linkers, between the plasma membrane and the microtubule ring. This is the region of intraflagellar transport, through which proteins traversing the length of the cilium must pass (84). In line with our modeling predictions, the defects in connecting cilium formation in the Cep290 mutants begin to make sense. In the absence of CEP290, formation of the photoreceptor transition zone/connecting cilium is prevented, suggesting that CEP290 may act to facilitate ciliary vesicle docking with the plasma membrane, thus initiating transition zone formation. CEP290-ΔDSD, the truncated protein found in the Cep290rd16 mutant, is able to mediate vesicle docking and transition zone formation; however, the connecting cilium/transition zone is of aberrant shape, suggesting incomplete or defective function of CEP290 in providing structural support and/or trafficking of essential interacting proteins into appropriate orientation. Thus, at least two related functions for CEP290 can be deduced from these data: initiation of transition zone formation and structural integrity of the transition zone at the ciliary base. Modifier genes have been shown to alter the phenotypic severity of various ciliopathy-causing mutations (39,85–88). A third and more specific molecular role for CEP290 as a regulator of BBSome function can be postulated from previous studies and from the different interactions of Cep290 alleles with Mkks. Ciliogenesis is impaired in mice with each of the three Cep290 mutant alleles. While background difference may provide a Human Molecular Genetics, 2015, Vol. 24, No. 13 | 3787 between the plasma membrane and the microtubule ring. CAGGCCAGGCCTCTCCCGTGGTCTCGCCCT. These ES cells were injected into C57BL/6 blastocysts to generate Cep290Gt(CC0582)Wtsi mice (here referred to as Cep290gt mice). Mice were backcrossed onto both C57BL/6J and 129/SvJ lines without significant differences in observed phenotype. Note that this is the same allele as described in ref. (80), although they calculate it as integrating into intron 23; according to the publically available sequence of the murine Cep290 gene, the forward primer site used for integration site mapping (F4 in reference 80) currently maps to intron 25. Mouse breeding and maintenance All experiments conform to an animal study protocol reviewed and approved by the NEI Animal Care and Use Committee. Animals were housed under standard light/dark conditions and given regular chow ad libitum. For Cep290 ko, agouti founder males carrying the ko allele were backcrossed to wild-type C57BL/6J or 129/SvJ mice for up to six generations to obtain mice >98% pure on each background. Both F1 and N4–6 backcross heterozygous knockout mice were intercrossed to generate homozygotes on either a mixed C57BL/6J-129/SvJ or pure strain. Viable F2 and F3 homozygotes were used to maintain a homozygous colony, while N4F1 (for 129/SvJ) or N6F1 (for C57BL/6J) crosses were used to generate homozygotes on either individual strain. For Cep290 gt, the same mating strategy was used to generate heterozygous animals. With rare exceptions, Cep290gt/gt animals did not survive on either genetic background (compare with findings in ref.(80), which likewise found embryonic lethality for the same allele on C57BL/6 background). ERG and fundoscopy Mice were examined by fundus photography and by electroretinogram according to standard procedures (33). Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015 Figure 9. A model of photoreceptor connecting cilium (drawn to scale). Schematic showing microtubules, ciliary pocket and other measurements, as determined by electron microscopy. The drawing clarifies possible positions for rod-like coiled-coil domain proteins such as Cep290, which localize to the region of the Y-linkers 3788 | Human Molecular Genetics, 2015, Vol. 24, No. 13 Histology, immunolocalization and confocal microscopy Primary antibodies: rabbit and rat anti-CEP290 (33); mouse antiacetylated alpha-tubulin, Sigma; chicken anti-rootletin, T. Li; anti-RKIP, gift of H. Khanna (69); anti-RPGR, T. Li; adenylate cyclase, T. Li; rabbit anti-ZO1, Invitrogen/Zymed; rabbit antiRNA polymerase II, Abcam; mouse anti-GT335, Sigma secondary antibodies used were Alexa Fluor 488, Alexa Fluor 568, Alexa Fluor 647 and gold-conjugated anti-rabbit. Imaging: Olympus FV1000 laser scanning confocal microscope, 63× oil immersion objective. and molecular modeling of dimeric, trimeric and tetrameric structures of DSD domains were performed using the protein homology/analogy recognition Phyre2 engine v. 2.0 (http://www. sbg.bio.ic.ac.uk/phyre2/). Information on similar protein atomic structures from the RCSB Protein Data Bank (http://www.rcsb. org/pdb) was used to model possible oligomeric structures of DSD domain. Supplementary Material Transmission and scanning electron microscopy For TEM, whole eyes were prepared, sectioned and imaged using standard fixation, embedding and scanning procedures. For SEM, samples were fixed for 2 h at room temperature in EM fix (2.5% glutaraldehyde, 4% paraformaldehyde, 10 m CaCl2 in 0.1 M HEPES). They were then coated with 1% tannic acid and 1% osmium tetroxide, after which they were dehydrated through an ethanol series and critical point dried. Images were taken using an S-4800 field emission scanning electron microscope and morphometric analyses were carried out. High-resolution MRI imaging of mouse brain Wild type and Cep290 ko mice on both mixed and pure genetic backgrounds were deeply anesthetized with ketamine/xylazine IP and perfused with cold PBS followed by 4% paraformaldehyde containing 1:500 Magnevist MRI contrast agent. Following postfix in the same solution, the head was placed in a 15 mm NMR tube (Wilmad Lab Glass, Buena, NJ) and submerged in Fomblin (Ausimont, NJ, USA), a fluorinated non-hydrogenated liquid, to minimize magnetic susceptibility difference which may result in image artifacts between the tissue and surrounding (air) and to eliminate intense water signal which would otherwise affect tissue contrast. The head sample was then centered in a 15 mm radio frequency antenna. The brain MRI experiments were performed, as described (96,97), on a vertical bore 14 T scanner operating on a Bruker Avance platform (Bruker Biospin Inc., Billerica, MA). Three mutually perpendicular scout images of the excised brain were acquired [repetition time (TR)/echo time (TE) = 100/ 6 ms, magnetization 30°, in-plane resolution = 200 µm, slice thickness = 1 mm). These images were used to obtain the optimum volumetric field of view that encompasses the whole brain for the subsequent 3-D scan. A T1 weighted gradient echo image sequence (TR/TE = 100/6.4 ms, number of averages = 8, field of view = 25.6 × 25.6 × 16 mm) was used to achieve an isotropic resolution of 50 µm in a total scan time of ∼23 h (Supplementary Material, Table S3). Bioinformatic analysis Protein sequence information on centrosomal protein of 290 kDa (CEP290) from human and mice (acc.# O15078 and Q6A078, respectively) was obtained from the UniProt database (http ://www.uniprot.org/). Structurally disordered regions were determined for protein sequences using the intrinsic protein disorder, domain and globularity prediction program GlobProt 2, version 2.3 (http://globplot.embl.de/). In addition, protein sequence fragments in coiled-coil conformation were predicted using simple modular research architecture tool, SMART (http://smart.emblheidelberg.de/). Propensities to form coiled-coil dimers and trimers were evaluated using the Multicoil program (http:// groups.csail.mit.edu/cb/multicoil/cgi-bin/multicoil.cgi). Finally, the identification of coiled-coil structures in structural domains Authors’ contributions R.R., T.L. and A.S. conceived the study, designed the experiments, analyzed the data and wrote the manuscript. R.A.R., E.A.Y., H.L. M-S., A.N.H., K.P. and N.G. performed the experiments and analyzed the corresponding data. Y.V.S. and B.W. did structural analysis. M.D. and J.M. performed MRI imaging and analyzed the data. L.D. generated the knockout mice. R.A.R., E.A.Y. and R.N.F. performed confocal or electron microscopy and analyzed the data. Acknowledgements We are grateful to Kunio Nagashima (NCI Electron Microscopy Facility), Mones Abu-Asab and Alex Ogilvy (NEI Electron Microscopy Facility) and members of the NEI Histology Core for excellent technical assistance with EM and histology. We thank Jacob Nellissery for technical assistance, Yide Mi for expert assistance with mouse care, Luis Menesez (NIDDK) for assistance with kidney pathology and Nissan Levron for helpful comments and suggestions. Conflict of Interest statement. None declared. Funding This research was supported by Intramural Research Program of the National Eye Institute. References 1. Badano, J.L., Mitsuma, N., Beales, P.L. and Katsanis, N. (2006) The ciliopathies: an emerging class of human genetic disorders. Annu. Rev. Genomics Hum. Genet., 7, 125–148. 2. Hildebrandt, F., Benzing, T. and Katsanis, N. (2011) Ciliopathies. N. Engl. J. Med., 364, 1533–1543. 3. Lee, J.E. and Gleeson, J.G. (2011) Cilia in the nervous system: linking cilia function and neurodevelopmental disorders. Curr. Opin. Neurol., 24, 98–105. 4. Bettencourt-Dias, M., Hildebrandt, F., Pellman, D., Woods, G. and Godinho, S.A. (2011) Centrosomes and cilia in human disease. Trends Genet., 27, 307–315. 5. Sharma, N., Berbari, N.F. and Yoder, B.K. (2008) Ciliary dysfunction in developmental abnormalities and diseases. Curr. Top. Dev. Biol., 85, 371–427. 6. Adams, N.A., Awadein, A. and Toma, H.S. (2007) The retinal ciliopathies. Ophthalmic. Genet., 28, 113–125. 7. Green, J.A. and Mykytyn, K. (2010) Neuronal ciliary signaling in homeostasis and disease. Cell Mol. Life Sci., 67, 3287–3297. 8. Gascue, C., Katsanis, N. and Badano, J.L. (2011) Cystic diseases of the kidney: ciliary dysfunction and cystogenic mechanisms. Pediatr. Nephrol., 26, 1181–1195. Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015 Supplementary Material is available at HMG online. Human Molecular Genetics, 2015, Vol. 24, No. 13 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. R.G. et al. (2012) Mutations in mouse Ift144 model the craniofacial, limb and rib defects in skeletal ciliopathies. Hum. Mol. Genet., 21, 1808–1823. Ocbina, P.J., Eggenschwiler, J.T., Moskowitz, I. and Anderson, K.V. (2011) Complex interactions between genes controlling trafficking in primary cilia. Nat. Genet., 43, 547–553. Clement, C.A., Kristensen, S.G., Mollgard, K., Pazour, G.J., Yoder, B.K., Larsen, L.A. and Christensen, S.T. (2009) The primary cilium coordinates early cardiogenesis and hedgehog signaling in cardiomyocyte differentiation. J. Cell Sci., 122, 3070–3082. Dalagiorgou, G., Basdra, E.K. and Papavassiliou, A.G. (2010) Polycystin-1: function as a mechanosensor. Int. J. Biochem. Cell Biol., 42, 1610–1613. Yoder, B.K. (2007) Role of primary cilia in the pathogenesis of polycystic kidney disease. J. Am. Soc. Nephrol., 18, 1381–1388. Reiter, J.F. (2008) A cilium is not a cilium is not a cilium: signaling contributes to ciliary morphological diversity. Dev. Cell, 14, 635–636. Craige, B., Tsao, C.C., Diener, D.R., Hou, Y., Lechtreck, K.F., Rosenbaum, J.L. and Witman, G.B. (2010) CEP290 tethers flagellar transition zone microtubules to the membrane and regulates flagellar protein content. J. Cell. Biol., 190, 927–940. Rachel, R.A., May-Simera, H.L., Veleri, S., Gotoh, N., Choi, B.Y., Murga-Zamalloa, C., McIntyre, J.C., Marek, J., Lopez, I., Hackett, A.N. et al. (2012) Combining Cep290 and Mkks ciliopathy alleles in mice rescues sensory defects and restores ciliogenesis. J. Clin. Invest., 122, 1233–1245. Garcia-Gonzalo, F.R., Corbit, K.C., Sirerol-Piquer, M.S., Ramaswami, G., Otto, E.A., Noriega, T.R., Seol, A.D., Robinson, J.F., Bennett, C.L., Josifova, D.J. et al. (2011) A transition zone complex regulates mammalian ciliogenesis and ciliary membrane composition. Nat. Genet., 43, 776–784. Sayer, J.A., Otto, E.A., O’Toole, J.F., Nurnberg, G., Kennedy, M.A., Becker, C., Hennies, H.C., Helou, J., Attanasio, M., Fausett, B.V. et al. (2006) The centrosomal protein nephrocystin-6 is mutated in Joubert syndrome and activates transcription factor ATF4. Nat. Genet., 38, 674–681. Valente, E.M., Silhavy, J.L., Brancati, F., Barrano, G., Krishnaswami, S.R., Castori, M., Lancaster, M.A., Boltshauser, E., Boccone, L., Al-Gazali, L. et al. (2006) Mutations in CEP290, which encodes a centrosomal protein, cause pleiotropic forms of Joubert syndrome. Nat. Genet., 38, 623–625. Chang, B., Khanna, H., Hawes, N., Jimeno, D., He, S., Lillo, C., Parapuram, S.K., Cheng, H., Scott, A., Hurd, R.E. et al. (2006) Inframe deletion in a novel centrosomal/ciliary protein CEP290/ NPHP6 perturbs its interaction with RPGR and results in early-onset retinal degeneration in the rd16 mouse. Hum. Mol. Genet., 15, 1847–1857. den Hollander, A.I., Roepman, R., Koenekoop, R.K. and Cremers, F.P. (2008) Leber congenital amaurosis: genes, proteins and disease mechanisms. Prog Retin Eye Res, 27, 391–419. Coppieters, F., Lefever, S., Leroy, B.P. and De Baere, E. (2010) CEP290, a gene with many faces: mutation overview and presentation of CEP290base. Hum. Mut., 31, 1097–1108. Zhang, Y., Seo, S., Bhattarai, S., Bugge, K., Searby, C.C., Zhang, Q., Drack, A.V., Stone, E.M. and Sheffield, V.C. (2014) BBS mutations modify phenotypic expression of CEP290-related ciliopathies. Hum. Mol. Genet., 23, 40–51. Stowe, T.R., Wilkinson, C.J., Iqbal, A. and Stearns, T. (2012) The centriolar satellite proteins Cep72 and Cep290 interact and are required for recruitment of BBS proteins to the cilium. Mol. Biol. Cell, 23, 3322–3335. Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015 9. Marion, V., Stutzmann, F., Gerard, M., De Melo, C., Schaefer, E., Claussmann, A., Helle, S., Delague, V., Souied, E., Barrey, C. et al. (2012) Exome sequencing identifies mutations in LZTFL1, a BBSome and smoothened trafficking regulator, in a family with Bardet–Biedl syndrome with situs inversus and insertional polydactyly. J. Med. Genet., 49, 317–321. 10. Mykytyn, K., Braun, T., Carmi, R., Haider, N.B., Searby, C.C., Shastri, M., Beck, G., Wright, A.F., Iannaccone, A., Elbedour, K. et al. (2001) Identification of the gene that, when mutated, causes the human obesity syndrome BBS4. Nat. Genet., 28, 188–191. 11. Doherty, D. (2009) Joubert syndrome: insights into brain development, cilium biology, and complex disease. Semin. Pediatr. Neurol., 16, 143–154. 12. Juric-Sekhar, G., Adkins, J., Doherty, D. and Hevner, R.F. (2012) Joubert syndrome: brain and spinal cord malformations in genotyped cases and implications for neurodevelopmental functions of primary cilia. Acta Neuropathol., 123, 695–709. 13. Dawe, H.R., Smith, U.M., Cullinane, A.R., Gerrelli, D., Cox, P., Badano, J.L., Blair-Reid, S., Sriram, N., Katsanis, N., AttieBitach, T. et al. (2007) The Meckel–Gruber Syndrome proteins MKS1 and meckelin interact and are required for primary cilium formation. Hum. Mol. Genet., 16, 173–186. 14. Hildebrandt, F., Attanasio, M. and Otto, E. (2009) Nephronophthisis: disease mechanisms of a ciliopathy. J. Am. Soc. Nephrol., 20, 23–35. 15. Rachel, R.A., Li, T. and Swaroop, A. (2012) Photoreceptor sensory cilia and ciliopathies: focus on CEP290, RPGR and their interacting proteins. Cilia, 1, 22. 16. Estrada-Cuzcano, A., Roepman, R., Cremers, F.P., den Hollander, A.I. and Mans, D.A. (2012) Non-syndromic retinal ciliopathies: translating gene discovery into therapy. Hum. Mol. Genet., 21, R111–R124. 17. Pazour, G.J. and Rosenbaum, J.L. (2002) Intraflagellar transport and cilia-dependent diseases. Trends Cell. Biol., 12, 551–555. 18. Winyard, P. and Jenkins, D. (2011) Putative roles of cilia in polycystic kidney disease. Biochim. Biophys. Acta, 1812, 1256–1262. 19. Barker, A.R., Thomas, R. and Dawe, H.R. (2014) Meckel–Gruber syndrome and the role of primary cilia in kidney, skeleton, and central nervous system development. Organogenesis, 10, 96–107. 20. Goetz, S.C. and Anderson, K.V. (2010) The primary cilium: a signalling centre during vertebrate development. Nat. Rev. Genet., 11, 331–344. 21. Waters, A.M. and Beales, P.L. (2011) Ciliopathies: an expanding disease spectrum. Pediatr. Nephrol., 26, 1039–1056. 22. Yokoyama, T. (2004) Motor or sensor: a new aspect of primary cilia function. Anat. Sci. Int., 79, 47–54. 23. Lancaster, M.A., Louie, C.M., Silhavy, J.L., Sintasath, L., Decambre, M., Nigam, S.K., Willert, K. and Gleeson, J.G. (2009) Impaired Wnt-beta-catenin signaling disrupts adult renal homeostasis and leads to cystic kidney ciliopathy. Nat. Med., 15, 1046–1054. 24. Bimonte, S., De Angelis, A., Quagliata, L., Giusti, F., Tammaro, R., Dallai, R., Ascenzi, M.G., Diez-Roux, G. and Franco, B. (2011) Ofd1 is required in limb bud patterning and endochondral bone development. Dev. Biol., 349, 179–191. 25. Goetz, S.C., Liem, K.F. Jr and Anderson, K.V. (2012) The spinocerebellar ataxia-associated gene Tau tubulin kinase 2 controls the initiation of ciliogenesis. Cell, 151, 847–858. 26. Ashe, A., Butterfield, N.C., Town, L., Courtney, A.D., Cooper, A.N., Ferguson, C., Barry, R., Olsson, F., Liem, K.F. Jr, Parton, | 3789 3790 | Human Molecular Genetics, 2015, Vol. 24, No. 13 55. Narita, K., Kozuka-Hata, H., Nonami, Y., Ao-Kondo, H., Suzuki, T., Nakamura, H., Yamakawa, K., Oyama, M., Inoue, T. and Takeda, S. (2012) Proteomic analysis of multiple primary cilia reveals a novel mode of ciliary development in mammals. Biol. Open, 1, 815–825. 56. Brancati, F., Barrano, G., Silhavy, J.L., Marsh, S.E., Travaglini, L., Bielas, S.L., Amorini, M., Zablocka, D., Kayserili, H., Al-Gazali, L. et al. (2007) CEP290 mutations are frequently identified in the oculo-renal form of Joubert syndrome-related disorders. Am. J. Hum. Genet., 81, 104–113. 57. Tory, K., Lacoste, T., Burglen, L., Moriniere, V., Boddaert, N., Macher, M.A., Llanas, B., Nivet, H., Bensman, A., Niaudet, P. et al. (2007) High NPHP1 and NPHP6 mutation rate in patients with Joubert syndrome and nephronophthisis: potential epistatic effect of NPHP6 and AHI1 mutations in patients with NPHP1 mutations. J. Am. Soc. Nephrol., 18, 1566–1575. 58. Sattar, S. and Gleeson, J.G. (2011) The ciliopathies in neuronal development: a clinical approach to investigation of Joubert syndrome and Joubert syndrome-related disorders. Dev. Med. Child Neurol., 53, 793–798. 59. Pellegrino, J.E., Lensch, M.W., Muenke, M. and Chance, P.F. (1997) Clinical and molecular analysis in Joubert syndrome. Am. J. Med. Genet., 72, 59–62. 60. Swaroop, A. (2013) What’s in a name? RPGR Mutations Redefine the Genetic and Phenotypic Landscape in Retinal Degenerative Diseases. Invest. Ophthalmol. Vis. Sci., 54, 1417. 61. Betleja, E. and Cole, D.G. (2010) Ciliary trafficking: CEP290 guards a gated community. Curr. Biol., 20, R928–R931. 62. Drivas, T.G., Holzbaur, E.L. and Bennett, J. (2013) Disruption of CEP290 microtubule/membrane-binding domains causes retinal degeneration. J. Clin. Invest., 123, 4525–4539. 63. Schmidt, K.N., Kuhns, S., Neuner, A., Hub, B., Zentgraf, H. and Pereira, G. (2012) Cep164 mediates vesicular docking to the mother centriole during early steps of ciliogenesis. J. Cell Biol., 199, 1083–1101. 64. Joo, K., Kim, C.G., Lee, M.S., Moon, H.Y., Lee, S.H., Kim, M.J., Kweon, H.S., Park, W.Y., Kim, C.H., Gleeson, J.G. et al. (2013) CCDC41 is required for ciliary vesicle docking to the mother centriole. Proc. Natl. Acad. Sci. U. S. A., 110, 5987–5992. 65. Sillibourne, J.E., Hurbain, I., Grand-Perret, T., Goud, B., Tran, P. and Bornens, M. (2013) Primary ciliogenesis requires the distal appendage component Cep123. Biol. Open, 2, 535–545. 66. Veleri, S., Manjunath, S.H., Fariss, R.N., May-Simera, H., Brooks, M., Foskett, T.A., Gao, C., Longo, T.A., Liu, P., Nagashima, K. et al. (2014) Ciliopathy-associated gene Cc2d2a promotes assembly of subdistal appendages on the mother centriole during cilia biogenesis. Nat. Commun., 5, 4207. 67. Patil, H., Guruju, M.R., Cho, K.I., Yi, H., Orry, A., Kim, H. and Ferreira, P.A. (2012) Structural and functional plasticity of subcellular tethering, targeting and processing of RPGRIP1 by RPGR isoforms. Biol. Open, 1, 140–160. 68. Patil, H., Tserentsoodol, N., Saha, A., Hao, Y., Webb, M. and Ferreira, P.A. (2012) Selective loss of RPGRIP1-dependent ciliary targeting of NPHP4, RPGR and SDCCAG8 underlies the degeneration of photoreceptor neurons. Cell Death Dis., 3, e355. 69. Murga-Zamalloa, C.A., Ghosh, A.K., Patil, S.B., Reed, N.A., Chan, L.S., Davuluri, S., Peranen, J., Hurd, T.W., Rachel, R.A. and Khanna, H. (2011) Accumulation of the Raf-1 kinase inhibitory protein (Rkip) is associated with Cep290-mediated photoreceptor degeneration in ciliopathies. J. Biol. Chem., 286, 28276–28286. 70. den Hollander, A.I., Koenekoop, R.K., Yzer, S., Lopez, I., Arends, M.L., Voesenek, K.E., Zonneveld, M.N., Strom, T.M., Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015 42. Kim, J., Krishnaswami, S.R. and Gleeson, J.G. (2008) CEP290 interacts with the centriolar satellite component PCM-1 and is required for Rab8 localization to the primary cilium. Hum. Mol. Genet., 17, 3796–3805. 43. Tsang, W.Y., Bossard, C., Khanna, H., Peranen, J., Swaroop, A., Malhotra, V. and Dynlacht, B.D. (2008) CP110 suppresses primary cilia formation through its interaction with CEP290, a protein deficient in human ciliary disease. Dev. Cell, 15, 187–197. 44. Sang, L., Miller, J.J., Corbit, K.C., Giles, R.H., Brauer, M.J., Otto, E.A., Baye, L.M., Wen, X., Scales, S.J., Kwong, M. et al. (2011) Mapping the NPHP-JBTS-MKS protein network reveals ciliopathy disease genes and pathways. Cell, 145, 513–528. 45. Barbelanne, M., Song, J., Ahmadzai, M. and Tsang, W.Y. (2013) Pathogenic NPHP5 mutations impair protein interaction with Cep290, a prerequisite for ciliogenesis. Hum. Mol. Genet., 22, 2482–2494. 46. Cideciyan, A.V., Rachel, R.A., Aleman, T.S., Swider, M., Schwartz, S.B., Sumaroka, A., Roman, A.J., Stone, E.M., Jacobson, S.G. and Swaroop, A. (2011) Cone photoreceptors are the main targets for gene therapy of NPHP5 (IQCB1) or NPHP6 (CEP290) blindness: generation of an all-cone Nphp6 hypomorph mouse that mimics the human retinal ciliopathy. Hum. Mol. Genet., 20, 1411–1423. 47. McEwen, D.P., Koenekoop, R.K., Khanna, H., Jenkins, P.M., Lopez, I., Swaroop, A. and Martens, J.R. (2007) Hypomorphic CEP290/NPHP6 mutations result in anosmia caused by the selective loss of G proteins in cilia of olfactory sensory neurons. Proc. Natl. Acad. Sci. U. S. A., 104, 15917–15922. 48. Beales, P.L., Katsanis, N., Lewis, R.A., Ansley, S.J., Elcioglu, N., Raza, J., Woods, M.O., Green, J.S., Parfrey, P.S., Davidson, W.S. et al. (2001) Genetic and mutational analyses of a large multiethnic Bardet–Biedl cohort reveal a minor involvement of BBS6 and delineate the critical intervals of other loci. Am. J. Hum. Genet., 68, 606–616. 49. Kim, J.C., Ou, Y.Y., Badano, J.L., Esmail, M.A., Leitch, C.C., Fiedrich, E., Beales, P.L., Archibald, J.M., Katsanis, N., Rattner, J.B. et al. (2005) MKKS/BBS6, a divergent chaperonin-like protein linked to the obesity disorder Bardet–Biedl syndrome, is a novel centrosomal component required for cytokinesis. J. Cell Sci., 118, 1007–1020. 50. Seo, S., Baye, L.M., Schulz, N.P., Beck, J.S., Zhang, Q., Slusarski, D.C. and Sheffield, V.C. (2010) BBS6, BBS10, and BBS12 form a complex with CCT/TRiC family chaperonins and mediate BBSome assembly. Proc. Natl. Acad. Sci. U. S. A., 107, 1488–1493. 51. Gorden, N.T., Arts, H.H., Parisi, M.A., Coene, K.L., Letteboer, S.J., van Beersum, S.E., Mans, D.A., Hikida, A., Eckert, M., Knutzen, D. et al. (2008) CC2D2A is mutated in Joubert syndrome and interacts with the ciliopathy-associated basal body protein CEP290. Am. J. Hum. Genet., 83, 559–571. 52. Garcia-Garcia, M.J., Eggenschwiler, J.T., Caspary, T., Alcorn, H.L., Wyler, M.R., Huangfu, D., Rakeman, A.S., Lee, J.D., Feinberg, E.H., Timmer, J.R. et al. (2005) Analysis of mouse embryonic patterning and morphogenesis by forward genetics. Proc. Natl. Acad. Sci. U. S A., 102, 5913–5919. 53. Lopes, C.A., Prosser, S.L., Romio, L., Hirst, R.A., O’Callaghan, C., Woolf, A.S. and Fry, A.M. (2011) Centriolar satellites are assembly points for proteins implicated in human ciliopathies, including oral-facial-digital syndrome 1. J. Cell Sci., 124, 600– 612. 54. Nonami, Y., Narita, K., Nakamura, H., Inoue, T. and Takeda, S. (2013) Developmental changes in ciliary motility on choroid plexus epithelial cells during the perinatal period. Cytoskeleton (Hoboken), 70, 797–803. Human Molecular Genetics, 2015, Vol. 24, No. 13 71. 72. 74. 75. 76. 77. 78. 79. 80. 81. 82. 83. 84. Ounjai, P., Kim, K.D., Liu, H., Dong, M., Tauscher, A.N., Witkowska, H.E. and Downing, K.H. (2013) Architectural insights into a ciliary partition. Curr. Biol., 23, 339–344. 85. Khanna, H., Davis, E.E., Murga-Zamalloa, C.A., EstradaCuzcano, A., Lopez, I., den Hollander, A.I., Zonneveld, M.N., Othman, M.I., Waseem, N., Chakarova, C.F. et al. (2009) A common allele in RPGRIP1L is a modifier of retinal degeneration in ciliopathies. Nat. Genet., 41, 739–745. 86. Louie, C.M., Caridi, G., Lopes, V.S., Brancati, F., Kispert, A., Lancaster, M.A., Schlossman, A.M., Otto, E.A., Leitges, M., Grone, H.J. et al. (2010) AHI1 is required for photoreceptor outer segment development and is a modifier for retinal degeneration in nephronophthisis. Nat. Genet., 42, 175–180. 87. Davis, E.E., Zhang, Q., Liu, Q., Diplas, B.H., Davey, L.M., Hartley, J., Stoetzel, C., Szymanska, K., Ramaswami, G., Logan, C.V. et al. (2011) TTC21B contributes both causal and modifying alleles across the ciliopathy spectrum. Nat. Genet., 43, 189–196. 88. Abdelhamed, Z.A., Wheway, G., Szymanska, K., Natarajan, S., Toomes, C., Inglehearn, C. and Johnson, C.A. (2013) Variable expressivity of ciliopathy neurological phenotypes that encompass Meckel–Gruber syndrome and Joubert syndrome is caused by complex de-regulated ciliogenesis, Shh and Wnt signalling defects. Hum. Mol. Genet., 22, 1358–1372. 89. Wei, Q., Zhang, Y., Li, Y., Zhang, Q., Ling, K. and Hu, J. (2012) The BBSome controls IFT assembly and turnaround in cilia. Nat. Cell Biol., 14, 950–957. 90. Wang, J. and Deretic, D. (2014) Molecular complexes that direct rhodopsin transport to primary cilia. Prog. Retin Eye Res., 38, 1–19. 91. Zhang, Q., Yu, D., Seo, S., Stone, E.M. and Sheffield, V.C. (2012) Intrinsic protein-protein interaction-mediated and chaperonin-assisted sequential assembly of stable Bardet–Biedl syndrome protein complex, the BBSome. J. Biol. Chem., 287, 20625–20635. 92. Thomas, K.R. and Capecchi, M.R. (1987) Site-directed mutagenesis by gene targeting in mouse embryo-derived stem cells. Cell, 51, 503–512. 93. Muyrers, J.P., Zhang, Y., Benes, V., Testa, G., Rientjes, J.M. and Stewart, A.F. (2004) ET recombination: DNA engineering using homologous recombination in E. coli. Methods Mol. Biol., 256, 107–121. 94. Yagi, T., Ikawa, Y., Yoshida, K., Shigetani, Y., Takeda, N., Mabuchi, I., Yamamoto, T. and Aizawa, S. (1990) Homologous recombination at c-fyn locus of mouse embryonic stem cells with use of diphtheria toxin A-fragment gene in negative selection. Proc. Natl. Acad. Sci. U. S. A., 87, 9918–9922. 95. Nagy, A., Rossant, J., Nagy, R., Abramow-Newerly, W. and Roder, J.C. (1993) Derivation of completely cell culturederived mice from early-passage embryonic stem cells. Proc. Natl. Acad. Sci. U. S. A., 90, 8424–8428. 96. Frahm, J., Haase, A. and Matthaei, D. (1986) Rapid three-dimensional MR imaging using the FLASH technique. J. Comput. Assist. Tomogr., 10, 363–368. 97. Keller, S.S. and Roberts, N. (2009) Measurement of brain volume using MRI: software, techniques, choices and prerequisites. J. Anthropol. Sci., 87, 127–151. Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015 73. Meitinger, T., Brunner, H.G. et al. (2006) Mutations in the CEP290 (NPHP6) gene are a frequent cause of Leber congenital amaurosis. Am. J. Hum. Genet., 79, 556–561. Burckle, C., Gaude, H.M., Vesque, C., Silbermann, F., Salomon, R., Jeanpierre, C., Antignac, C., Saunier, S. and SchneiderMaunoury, S. (2011) Control of the Wnt pathways by nephrocystin-4 is required for morphogenesis of the zebrafish pronephros. Hum. Mol. Genet., 20, 2611–2627. Leightner, A.C., Hommerding, C.J., Peng, Y., Salisbury, J.L., Gainullin, V.G., Czarnecki, P.G., Sussman, C.R. and Harris, P.C. (2013) The Meckel syndrome protein meckelin (TMEM67) is a key regulator of cilia function but is not required for tissue planar polarity. Hum. Mol. Genet., 22, 2024–2040. Hynes, A.M., Giles, R.H., Srivastava, S., Eley, L., Whitehead, J., Danilenko, M., Raman, S., Slaats, G.G., Colville, J.G., Ajzenberg, H. et al. (2014) Murine Joubert syndrome reveals Hedgehog signaling defects as a potential therapeutic target for nephronophthisis. Proc. Natl. Acad. Sci. U. S. A., 111, 9893–9898. Seo, S., Zhang, Q., Bugge, K., Breslow, D.K., Searby, C.C., Nachury, M.V. and Sheffield, V.C. (2011) A novel protein LZTFL1 regulates ciliary trafficking of the BBSome and Smoothened. PLoS Genet., 7, e1002358. Baye, L.M., Patrinostro, X., Swaminathan, S., Beck, J.S., Zhang, Y., Stone, E.M., Sheffield, V.C. and Slusarski, D.C. (2011) The N-terminal region of centrosomal protein 290 (CEP290) restores vision in a zebrafish model of human blindness. Hum. Mol. Genet., 20, 1467–1477. Benmerah, A. (2013) The ciliary pocket. Curr. Opin. Cell Biol., 25, 78–84. Wallingford, J.B. and Mitchell, B. (2011) Strange as it may seem: the many links between Wnt signaling, planar cell polarity, and cilia. Genes Dev., 25, 201–213. Vladar, E.K., Bayly, R.D., Sangoram, A.M., Scott, M.P. and Axelrod, J.D. (2012) Microtubules enable the planar cell polarity of airway cilia. Curr. Biol., 22, 2203–2212. Jain, R., Pan, J., Driscoll, J.A., Wisner, J.W., Huang, T., Gunsten, S.P., You, Y. and Brody, S.L. (2010) Temporal relationship between primary and motile ciliogenesis in airway epithelial cells. Am. J. Respiratory Cell Mol. Biol., 43, 731–739. Reiter, J.F., Blacque, O.E. and Leroux, M.R. (2012) The base of the cilium: roles for transition fibres and the transition zone in ciliary formation, maintenance and compartmentalization. EMBO Rep., 13, 608–618. Wang, W.J., Tay, H.G., Soni, R., Perumal, G.S., Goll, M.G., Macaluso, F.P., Asara, J.M., Amack, J.D. and Tsou, M.F. (2013) CEP162 is an axoneme-recognition protein promoting ciliary transition zone assembly at the cilia base. Nat. Cell Biol., 15, 591–601. Kee, H.L., Dishinger, J.F., Lynne Blasius, T., Liu, C.J., Margolis, B. and Verhey, K.J. (2012) A size-exclusion permeability barrier and nucleoporins characterize a ciliary pore complex that regulates transport into cilia. Nat. Cell Biol., 14, 431–437. Nachury, M.V., Seeley, E.S. and Jin, H. (2010) Trafficking to the ciliary membrane: how to get across the periciliary diffusion barrier? Annu. Rev. Cell Dev. Biol., 26, 59–87. | 3791