Download CEP290 alleles in mice disrupt tissue-specific cilia

Human Molecular Genetics, 2015, Vol. 24, No. 13
3775–3791
doi: 10.1093/hmg/ddv123
Advance Access Publication Date: 9 April 2015
Original Article
ORIGINAL ARTICLE
biogenesis and recapitulate features of syndromic
ciliopathies
Rivka A. Rachel1, Erin A. Yamamoto1, Mrinal K. Dewanjee1, Helen L. May-Simera1,†,
Yuri V. Sergeev1, Alice N. Hackett1, Katherine Pohida1, Jeeva Munasinghe2,
Norimoto Gotoh1, Bill Wickstead3, Robert N. Fariss1, Lijin Dong1, Tiansen Li1 and
Anand Swaroop1,*
1
National Eye Institute, 2National Institute of Neurological Disease and Stroke, National Institutes of Health,
Bethesda, MD 20892, USA and 3School of Life Sciences, University of Nottingham, Nottingham, UK
*To whom correspondence should be addressed at: Neurobiology-Neurodegeneration and Repair Laboratory, National Eye Institute, MSC0610, 6 Center Drive,
Bethesda, MD 20892, USA. Tel: +1 3014355754; Fax: +1 3014809917; Email: [email protected]
Abstract
Distinct mutations in the centrosomal-cilia protein CEP290 lead to diverse clinical findings in syndromic ciliopathies. We show
that CEP290 localizes to the transition zone in ciliated cells, precisely to the region of Y-linkers between central microtubules
and plasma membrane. To create models of CEP290-associated ciliopathy syndromes, we generated Cep290ko/ko and Cep290gt/gt
mice that produce no or a truncated CEP290 protein, respectively. Cep290ko/ko mice exhibit early vision loss and die from
hydrocephalus. Retinal photoreceptors in Cep290ko/ko mice lack connecting cilia, and ciliated ventricular ependyma fails to
mature. The minority of Cep290ko/ko mice that escape hydrocephalus demonstrate progressive kidney pathology. Cep290gt/gt mice
die at mid-gestation, and the occasional Cep290gt/gt mouse that survives shows hydrocephalus and severely cystic kidneys.
Partial loss of CEP290-interacting ciliopathy protein MKKS mitigates lethality and renal pathology in Cep290gt/gt mice. Our
studies demonstrate domain-specific functions of CEP290 and provide novel therapeutic paradigms for ciliopathies.
Introduction
Defects in primary cilia biogenesis or associated functions can
lead to pleiotropic phenotypes in syndromic diseases, collectively
termed ‘ciliopathies’ (1,2). Recent studies have begun to unravel
complex genotype–phenotype relationships in ciliopathies that
are caused by mutations in dozens of different genes (3–5).
Affected tissues include the retina (6), brain (7) and kidney (8), as
well as abnormalities at the organismal level including situs inversus (9) and obesity (10). Unique clusters of symptoms have
acquired clinical diagnoses such as Joubert (11,12), Meckel–Gruber
(13) and Bardet–Biedl syndrome (BBS) and nephronophthisis (14).
Retinal degeneration is a highly penetrant component in most
syndromic ciliopathies; one type of non-syndromic ciliopathy is
Leber congenital amaurosis (LCA) that includes childhood blindness caused by retinal dysfunction (15,16).
Pioneering studies in Chlamydomonas first linked intraflagellar
transport with genes related to sensory ciliopathy phenotypes in
mammals (17). Although the cilia in Chlamydomonas are motile, in
contrast to the sensory cilia of vertebrates, basic genetic principles of microtubule organization and cilia function appear to be
highly conserved (18). The sensory or primary cilium plays an important developmental role (3,19), serving as a signaling center
†
Present address: Cell and Matrix Biology, Institute of Zoology, Johannes-Gutenberg.
Received: November 29, 2014. Revised: March 9, 2015. Accepted: April 7, 2015
Published by Oxford University Press 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.
3775
Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015
CEP290 alleles in mice disrupt tissue-specific cilia
3776
| Human Molecular Genetics, 2015, Vol. 24, No. 13
CEP290-associated ciliopathies, particularly Joubert and Meckel–
Gruber syndromes.
Results
CEP290 localizes to the transition zone in cilia, and
specifically to the Y-linker region of photoreceptor
connecting cilium
Using both immunolocalization and biochemical approaches,
CEP290 had been localized to the basal body (44,51), transition
zone (33,37,52) and pericentriolar satellites (41,53). To clarify
and validate CEP290 localization, we performed immunostaining
in a number of ciliated mouse tissues (Fig. 1). In choroid plexus,
we identified CEP290 at the apical surface, distal to rootletin,
in an array corresponding to the base of the multiple cilia
(Fig. 1A), which in these cells transition from motile to sensory
function in the neonatal period (54,55). CEP290 also localized to
the base of motile cilia in the ventricular ependymal lining and
in trachea between rootletin and acetylated alpha-tubulin, a
marker of the ciliary axoneme (Fig. 1B and C). In the kidney,
CEP290 was detected at the base of the primary cilia (Fig. 1D). In
photoreceptors, CEP290 is in a location consistent with the connecting cilia (Fig. 1E).
We confirmed the localization of CEP290 in the connecting cilium of adult wild-type photoreceptors using immuno-electron
microscopy. In longitudinal sections, CEP290 immunogold particles were present in the transition zone region and not in the
basal body (Fig. 1F). In cross-sections of the cilium, we could
more precisely localize CEP290 to the region of the Y-linkers,
between the central 9+0 ring of microtubules and the plasma
membrane (Fig. 1G and H).
Phenotype of Cep290-ko mice parallels Joubert syndrome
in humans
The Cep290 gene spans 85 kb on mouse Chromosome 10 and includes 54 exons (Fig. 2A). To create a null allele, Cep290 exons 1–4
were replaced in embryonic stem (ES) cells with a β-gal-neoR cassette by homologous recombination. Southern blot analysis of ES
cell clones showed appropriate targeting (Fig. 2B), and PCR genotyping could discriminate the wild-type (295 bp) and knockout alleles (391 bp) (Fig. 2C). No CEP290 protein was detectable in the
knockout retina by immunoblotting (Fig. 2D).
About 80% of the Cep290ko/ko mice died between birth and
weaning (Supplementary Material, Table S1) likely due to lethal
hydrocephalus (clinical ventriculomegaly) that became apparent
at 2–3 weeks of age, as manifested by a domed head (asterisk,
Fig. 3A). Subclinical ventriculomegaly was observed in mutant
pups at P3 (data not shown). The Cep290ko/ko mice that did not develop overt hydrocephalus by 1 month of age survived with normal fertility and lifespan for as long as 2 years. We noticed that a
mixed genetic background of C57BL/6 and 129/SvJ resulted in
higher survival than either pure inbred background, in which
no homozygous knockout mice survived beyond the N2 or N3
backcross generation (data not shown). A higher number of
Cep290ko/+ mice survived on the C57BL/6 background than on
129/SvJ (Supplementary Material, Table S2); indeed, we were unable to propagate the mutation on the 129/SvJ line beyond N3
backcross generation. The Cep290ko/ko mice developed early
signs of retinal pathology, including blood vessel attenuation
and pigmentary changes of the fundus by 2–3 months of age
(data not shown). As predicted from both human CEP290 mutations and the Cep290rd16 mouse, both scotopic and photopic
Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015
(20,21) and mechanosensor (22). In sensory tissues, cilia are
modified to mediate specific functions such as establishment of
the sterocilia bundles, which transmit sound wave frequency and
intensity in the cochlea, transduction of photons by photoreceptors, and ligand–receptor interactions in the olfactory epithelium. Some of the physiological complexity of cilia function
arises from the diversity of signaling pathways active within
the cilium, and the fact that different signaling pathways might
operate in specific tissues. For example, Shh and canonical Wnt
signaling, non-canonical Wnt/planar cell polarity and calcium
signaling/fluid flow are associated with organogenesis and/or
physiological functions in multiple tissues (9,22–30).
A fundamental question is how cilia dysfunction affects such
a broad spectrum of tissues/organs and results in wide range of
pathologies. One explanation is that cilia contribute to disparate
functions in individual organs (31). One ciliopathy protein may
exert distinct impact on specific ciliated cells by virtue of alternate interactors, different signaling pathways or unique and
tissue-specific functions. Among dozens of proteins contributing
to major ciliopathies, a prominent hub is CEP290 (15), which is
shown to localize to the ciliary transition zone and has numerous
interacting partners (32–34). CEP290 has been a target of intense
scrutiny since its discovery as the causal gene for Joubert syndrome in humans (35,36) and congenital blindness in rd16 mice
(37). Mutations in CEP290 are now shown to be a frequent cause
of LCA (38) and diverse syndromic ciliopathies (39).
As CEP290 mutations cause BBS and a range of other syndromic phenotypes (15), CEP290 is expected to exert important
connectivity to the BBSome and many ciliary proteins (40). Indeed, CEP290 interacts with CEP72 and PCM-1 to localize BBS4
to the cilium (41), and is required with PCM-1 for ciliary localization of Rab8a to promote ciliogenesis (42), a function antagonized
by Cp110 (43). CEP290 participates in discrete cilia-associated protein complexes, including a transition zone complex with other
Joubert and Meckel syndrome proteins in NIH-3T3 cells (34) and
a centrosomal complex with NPHP5/IQCB1 in IMCD3 cells (44).
NPHP5/IQCB1 interacts with CEP290 to promote ciliogenesis in
RPE-1 cells (45). In Chlamydomonas, CEP290 is an essential component of the transition zone, where it attaches microtubules to the
membrane and might regulate protein flow into the cilium (32).
In a reported mouse retinal degeneration model Cep290rd16,
the connecting cilium forms (46), though with abnormal crosssectional structure (33) and rudimentary outer segments (37). Unlike syndromic ciliopathies, the phenotype in the rd16 mouse is
restricted to sensory neurons (33,37,47). The Cep290rd16 allele is
not null and produces low levels of a shorter CEP290 protein
(37). The domain deleted in Cep290rd16 interacts with Mkks
(Bbs6), another ciliopathy protein that causes BBS and is part of
the chaperonin complex (48–50). Interestingly, decreasing Mkks
expression in the Cep290rd16 mouse leads to partial rescue of
photoreceptor structure and function (33).
CEP290 is expected to have diverse functions in mammalian
ciliated cells/tissues as suggested by its extensive interaction
network and association with numerous clinical phenotypes
(15,39). To understand CEP290 function and its role in human
syndromic ciliopathies, we generated null (Cep290 ko ) and
truncated (Cep290 gt ) alleles of Cep290 in mice. Our findings
suggest that CEP290 is critical for formation of the ciliary
transition zone in several tissues, including photoreceptors
and ventricular ependyma. Dominant effects of a truncated
Cep290 gt protein are detected in kidney and in viability, both
of which are partially rescued by decreasing Mkks. Our studies
further elucidate the complex actions of CEP290 in cilia and provide insights into the mechanism of pathology in human
Human Molecular Genetics, 2015, Vol. 24, No. 13
| 3777
brain ventricle at P13 (left panel) and CEP290 (red) with acetylated tubulin (green), rootletin (white) and DAPI nuclear counterstain in brain ventricle sections (right
panel). (C) CEP290 (green) and acetylated tubulin (red) expression in adult lung with DAPI nuclear counterstain. (D) Adult kidney expression of CEP290 (green) and
rootletin (red) with DAPI nuclear counterstain. (E) In photoreceptors CEP290 localizes distal to the ciliary rootlet with a small gap in between where the basal body lies,
indicating that CEP290 is confined to the connecting cilia (transition zone). (F and G) Immuno-electron microscopy images showing CEP290 expression using silverenhanced gold-conjugated secondary antibody (large black dots) in the connecting cilia of wild-type adult photoreceptors in both longitudinal (F) and cross-sections
(G). CEP290 localization was visualized by silver enhancing individual colloidal gold particles (black dots). Note localization between the plasma membrane and the
microtubule ring, in the area of the Y-linkers, as illustrated by the line diagram (H). Abbreviations: CV, cerebral ventricle; TZ, transition zone; BB, basal body; R, ciliary
rootlet.
ERGs showed complete lack of response by 3–4 weeks of age
(Fig. 3B). Similar to the Cep290rd16/rd16 mutant (33,46), profound
degenerative changes were evident at Postnatal day (P)14, including a thinner outer nuclear layer (ONL), no outer segments and
severely shortened inner segments; most photoreceptors were
lost by P28 (Fig. 3C). To assess the cerebral pathology and cause
of the domed head, we performed high-resolution MRI imaging
of brains after fixation (Fig. 3D and E). Massive expansion of the
lateral ventricles in Cep290ko/ko mice caused severe hydrocephalus, visible in both frontal/coronal and sagittal axes, with cortical thinning and distortion of the cerebellum and brain stem
(red lines, Fig. 3E). Subclinical ventriculomegaly was also noticeable in an asymptomatic P14 Cep290ko/ko mouse (blue arrows,
Fig. 3E). The kidney phenotype, featured in many Cep290mediated ciliopathies (56,57), was slowly progressive. Kidneys
appeared slightly pale and enlarged in a young adult (Fig. 3F),
and, cysts were observed in Cep290ko/ko mice after 12 months of
age (Fig. 3G). A relatively mild renal phenotype is consistent
with Joubert syndrome (58), in which only 2% of cases exhibit
renal cysts at an average age of 8 years (59).
CEP290 is required for photoreceptor cilium and outer
segment biogenesis
Vision loss prompted us to closely examine the photoreceptors
(Fig. 4). Using antibodies to acetylated tubulin and rootletin,
markers of the ciliary axoneme and ciliary rootlet, respectively,
we observed defects in inner and outer segment formation in
P14 Cep290ko/ko retina (Fig. 4A). While inner segments were rudimentary, no evidence of outer segment formation was detected,
demonstrating a more severe phenotype compared with
Cep290rd16/rd16 retina (37). Electron microscopy studies (Fig. 4B–F)
revealed complete lack of outer segments and connecting cilia in
P14 Cep290ko/ko retina (red circles, Fig. 4B), although basal bodies
were intact (blue circles, Fig. 4B). The 9+0 microtubule ring was
Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015
Figure 1. CEP290 is expressed in the transition zone at the base of the cilia in multiple tissues. (A) CEP290 (red) and rootletin (green) expression in the choroid plexus
sections at P0–1 with DAPI nuclear counterstain (blue). Enlarged single cells are shown to the right. (B) CEP290 (red) and acetylated tubulin (green) in flatmounted
3778
| Human Molecular Genetics, 2015, Vol. 24, No. 13
clones by Southern blot. Genomic DNA was digested with AvrII and probed with a 519 bp Cep290 fragment identifying the 5′ end of the gene, generating a 10 kb wild-type
band and a 13 kb knockout band in targeted clones. PGK-DTA selection element was removed in the stem cells. (C) PCR genotyping distinguishes wild-type allele (295 bp)
from the knockout (ko; 413 bp). (D) Immunoblot of wild-type P13 retina using a C-terminal antibody to CEP290 shows specific protein bands. The lower band corresponds to
the CEP290 monomer, and the higher band is likely a dimer. These bands are absent in the knockout mice.
distinct from the basal body as in wild-type photoreceptors (green
circles; Fig. 4C), but failed to dock at the apical plasma membrane
of the inner segment. By comparison, Cep290rd16/rd16 retina developed both basal bodies and connecting cilia (blue and red circles,
respectively, Fig. 4C), even though photoreceptors degenerated
rapidly thereafter. Instead of the elongated disks of normal outer
segments, the Cep290ko/ko photoreceptors developed small, round
membrane vesicles between the inner segments and the microvilli of the retinal pigment epithelium (Fig. 4D). In contrast,
Cep290rd16/rd16 photoreceptors had rudimentary outer segments
(Fig. 4E). A cross-section view of the connecting cilia region revealed 9+0 microtubule ring in the cytoplasm of the Cep290ko/ko
photoreceptors, whereas photoreceptors in Cep290rd16/rd16 retina
developed a membrane-bound connecting cilium with abnormal
morphology (irregular membrane and microtubule ring structure;
Fig. 4E). Thus, full-length CEP290 protein is essential for connecting cilium development.
To gain further insights, we immunostained P13 Cep290ko/ko
retina with several antibodies against photoreceptor proteins,
including CEP290 and RPGR, a ciliary protein that interacts with
CEP290 (37) and mutations in which are a major cause of inherited retinal degeneration (60). We compared the data with the
same markers in Cep290rd16/rd16 and Rpgrko retina (Supplementary
Material, Fig. S1). CEP290 was normally expressed in the connecting cilium of Rpgr-ko photoreceptors, significantly reduced but
still present in Cep290rd16/rd16, and undetectable in Cep290ko/ko
retina (Supplementary Material, Fig. S1A–C). The photoreceptor
organization as identified by rootletin/CROCC, which marks the
ciliary rootlets in the inner segments, was noticeable in the
Cep290ko/ko retina. RPGR immunostaining was absent in the RPGRko,
partly detected in Cep290rd16, and minimal in the Cep290ko/ko retina
(Supplementary Material, Fig. S1B). RPGRIP1, another cilia protein
that interacts with both CEP290 and RPGR and is associated
with retinal degeneration (15), was present in the RPGRko but absent in Cep290 mutant alleles (Supplementary Material, Fig. S1C).
These results suggest that Cep290 may act downstream (epistatic)
to RPGR and RPGRIP1 and reaffirms its central role in photoreceptor development.
CEP290 is essential for maturation of ventricular
ependymal cilia
In ventricular cells of the Cep290ko/ko brain, primary cilia do form
but show progressive developmental defects (Fig. 5A). At P0, the
primary cilia, as identified by acetylated tubulin, were longer
compared with control (Fig. 5B). Motile cilia emerged later and
were fewer in number, but appeared longer. In addition, the surface area of each cell, outlined by ZO-1, was smaller than in wildtype cells (Fig. 5C). Scanning electron microscopy images of the
ventricular surface showed the transition from single primary
cilia to tufts of multiple motile cilia from P0 to P5 in the wildtype brain; yet, in the Cep290ko/ko, single primary cilia continued
to grow longer with possibly delayed transition into fewer but
longer tufts of cilia (Fig. 5D).
We used transmission electron microscopy to define ciliogenesis defects in ventricular ependyma (Fig. 6). In P0 wild-type lateral ventricles, a single primary cilium is present per epithelial
cell (Fig. 6A), and the deuterosome, a nucleation structure for biogenesis of multiple basal bodies, was occasionally visible (Fig. 6A,
P0 right panel; white arrow). A docked primary ciliary vesicle
surrounding the emerging primary cilium was detected in wildtype ependyma at P0 (Fig. 6A, dotted circle and red arrows). In
Cep290ko/ko ependyma, however, though cilia began to form by
P0, no enclosure around the cilium (the ciliary vesicle) was detected and the plasma membrane constrictors did not generate
a bubble-like structure for eventual cilia emergence (Fig. 6B, red
arrows). By P3, the deuterosome is surrounded by nascent basal
bodies in the wild-type (Fig. 6C, left panel; white arrow) and multiple cilia emerged through the ciliary pocket (Fig. 6C, middle
panel; dotted circle), which surrounded emerging ciliary tufts oriented in a similar direction (Fig. 6C, red arrows). In P3 Cep290ko/ko
ependyma, few nascent basal bodies were seen congregating
around the deuterosome (Fig. 6D, left panel, white arrow), and
Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015
Figure 2. Generation of a Cep290 knockout allele results in lethal hydrocephalus. (A) Cep290 genomic locus and design of the targeting construct. Genomic DNA spanning
Cep290 exons 1, containing the ATG translation initiation site, through 4 (1.887 kb) was replaced with a beta-Gal cassette (5.163 kb). (B) Documentation of targeted ES cell
Human Molecular Genetics, 2015, Vol. 24, No. 13
| 3779
Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015
Figure 3. Inactivation of the Cep290 gene in mice leads to features of Joubert syndrome. (A) Postnatal (P)21 day Cep290ko/ko mouse shows stunted growth and hydrocephalus
(enlarged head, asterisk) compared with normal littermate. (B) Dark-adapted (scotopic) and photopic ERG recordings in Cep290ko/ko mice around 3 weeks of age show
complete lack of response under both conditions. Wild-type littermates show normal responses. (C) H&E images of control and Cep290ko/ko retina at P14 and P28.
Lower panels are enlargements of areas indicated in upper panels. At P14, note lack of outer segment formation. At P28, Cep290ko/ko mice exhibit rapid loss of
photoreceptors with only a single row of photoreceptors (likely cones) remaining, similar to Cep290rd16/rd16 (46). Original magnification 40×. (D and E). Brains of P14 and
P28 wild-type and Cep290ko/ko mice viewed by high-resolution (50 µm), T1 weighted 3D-MRI imaging. Note enlarged cerebral ventricles in the mutant (asterisks in D and E),
resulting in severe thinning of the cerebral cortex. Slightly enlarged lateral ventricles in the normal-appearing P14 Cep290ko/ko pup (blue arrows in E) reveal both that
cortical thinning is secondary to hydrocephalus, and that subclinical ventriculomegaly occurs in asymptomatic knockout mice. Lower row of panels in E, sagittal
views of the cerebellum from same brains shown above. Note secondary distortion of the brainstem from the enlarged ventricles. (F) Whole kidneys from adult wildtype (left) and Cep290ko/ko (right) mice. Note slight pallor and enlargement of the knockout. (G) In each panel, cortex is positioned at the top and medulla at the bottom
of the image. At 18 months of age, Cep290ko/ko kidney shows moderate cystic tubular pathology. Scale bar = 50 µm.
3780
| Human Molecular Genetics, 2015, Vol. 24, No. 13
Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015
Figure 4. Cep290 is required for photoreceptor ciliogenesis and outer segment morphogenesis. (A) P16 wild type and Cep290ko/ko retina labeled with acetylated α-tubulin
(red) and rootletin (green, left panels) or RKIP (green, right panels). (B) EM cross-section through connecting cilia region in wild-type and Cep290ko/ko P14 retina showing
isolated, membrane-bound cilia among inner and outer segment profiles. Cilia are circled in red; basal bodies in blue. In the Cep290ko/ko retina, although basal bodies form,
no distinct cilia are identified. Instead, the circular 9+0 microtubule structures remain within inner segment cytoplasm and fail to extend (green circles). Thus, outer
segments are likewise absent. (C) EM cross-sections through P10 Cep290rd16/rd16 photoreceptors showing connecting cilia (red) and basal bodies (blue). (D) EM
longitudinal sections at P14 show connecting cilia and OS in wild type; lack of OS in Cep290ko/ko. Instead, vesicular membranes (ves) form between the RPE microvilli
(mv) and the inner segments. (E) Comparison of longitudinal EM sections of P14 wild-type and Cep290rd16/rd16 photoreceptors showing rudimentary development of
the outer segments in Cep290rd16/rd16 mice, a phenotype intermediate between wild type and Cep290ko/ko. (F) EM cross-sections through the connecting cilium of P14
wild type, Cep290ko/ko and Cep290rd16/rd16 photoreceptors showing a clear, isolated membrane around the connecting cilium in wild type; failure of the microtubule ring
to extend from the cytoplasm in Cep290ko/ko, and malformed (oval) connecting cilia in Cep290rd16/rd16.
Human Molecular Genetics, 2015, Vol. 24, No. 13
| 3781
tubulin (green). Note extremely long cilia in the knockout (white arrows). Over time, the wild-type cilia transform from a single cilium to clumps of cilia; this
transformation is delayed and defective in the mutant. (B) Quantitation of cilia length at P0 from images in A showing much longer cilia in the mutant (n = 236
control, 131 knockout; unpaired two-tailed t-test; P < 0.0001). (C) Quantitation of images in A showing cell surface area at P0; area is significantly smaller in the mutant
(n = 456 control, 439 knockout; unpaired two-tailed t-test; P = 0.002). (D) Scanning electron microscopy images of P0, P5 and P19 ventricular ependymal surface. Red arrows
indicate very long cilia in the knockout. Note the absence of cilia tufts in the knockout at P19.
the cilia that emerged directly from the plasma membrane were
misoriented in the absence of the ciliary pocket (Fig. 6D, red arrows). At P5, multiple cilia emerging from each wild-type cell
were oriented in the same direction, exiting from the apical
surface into the ventricle (Fig. 6A, P5). While each wild-type ven-
or no central microtubules and disturbances in the number,
order and structure of the outside ring of microtubules (Fig. 6H).
These findings suggest a critical role of CEP290 during the emergence of ventricular ependymal cilia.
tricular ependymal cell had a large number of cilia at P5
(Fig. 6E), the Cep290ko/ko cells revealed only a few misoriented
cilia (Fig. 6F) that seemed to exit individually rather than together
through the ciliary pocket (Fig. 6F). We then imaged crosssections of P5 cilia to examine the internal structure of the
axoneme. As expected, the normal 9+2 pattern of microtubule
doublets was apparent in the wild type (Fig. 6G). In contrast, the
Cep290ko/ko cilia had multiple abnormalities, including multiple
A truncation allele of Cep290 exhibits a more severe
phenotype
In humans, distinct CEP290 mutations (missense, nonsense,
internal deletion or frame-shift) result in varying ciliopathy
phenotypes. Interestingly, the Cep290rd16/rd16 mice have a sensory
cilia-restricted phenotype, and while the Cep290ko/ko does manifest
as a ciliopathy, the kidney phenotype appears milder than some
Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015
Figure 5. Cep290 is required for proper maturation of ventricular ependymal cilia. (A) Flatmount view of P0 and P5 wild-type and Cep290ko/ko ventricular ependyma labeled
with antibodies of ZO-1 (green), outlining the cell bodies, and acetylated alpha-tubulin outlining primary cilia (red). P19 labeled with antibody to express acetylated alpha-
3782
| Human Molecular Genetics, 2015, Vol. 24, No. 13
through the ciliary pocket (red circle). (D) In the knockout at P3, deuterosomes are present but basal bodies fail to congregate around them, and cilia emerge single
and directly from the cell body rather than from a ciliary pocket. Moreover, when multiple cilia emerge from the same cell, they are not all oriented in the same
direction. At lower power (far right), microvilli are seen to protrude but very few cilia. (E,F) Note the difference between numbers of basal bodies and emerging cilia in
wild type (E) and Cep290ko/ko (F) ependyma. (G,H) Cross-sections of wild type and knockout cilia showing 9+2 microtubule configuration in wild type (G), and various
defects in the knockout (H).
human CEP290 syndromes. To expand the phenotypic spectrum,
we obtained a Cep290 gene-trap (hereafter referred to as Cep290gt)
ES cell line and generated mice which produce a 116 kDa protein
including the N-terminal part of CEP290 at Glu1036 (encoded by
the first 25 out of 55 Cep290 exons) fused to β-galactosidase
(Fig. 7A and B). As shown by X-gal staining, the CEP290 protein is
widely expressed (Fig. 7C). A vast majority of Cep290gt/gt embryos
die between E12 and E14 (Supplementary Material, Table S3, and
data not shown); however, except for pallor, mutant embryos
that survive appeared grossly normal even until E17 (Fig. 7D). By
Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015
Figure 6. Defects in ventricular ependymal ciliary pocket formation and cilia orientation. (A and B) Cilia formation at P0 in wild type (A) and Cep290ko/ko (B) ventricular
ependyma. Note prominent ciliary pocket in the normal cell (red circle and red arrows), and presence of a deuterosome (white arrow). In the Cep290ko/ko, the ciliary
pocket either does not form or forms incompletely. (C) At P3 in wild type, basal bodies congregate around the deuterosome (white arrow) and cilia (red arrows) exit
Human Molecular Genetics, 2015, Vol. 24, No. 13
| 3783
Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015
Figure 7. Truncation allele of Cep290 has gain of function phenotype with severe kidney disease and mid-gestation lethality. (A) Diagram of mouse Cep290 gene showing
insertion site of the pGT0xfT2 gene trap vector in intron 25. (B) Immunoblot using anti-β-galactosidase antibody, showing band of expected size (∼116 kDa) for the CEP290β-galactosidase fusion protein in the gt/+ retina. Renal levels of CEP290 expression are lower and invisible at this level of detection. GAPDH loading control is shown below.
(C) Expression of CEP290 revealed by X-gal staining of tissue expressing β-galactosidase from Cep290-lacZ fusion construct. Expression is observed in epithelial tissues,
including choroid plexus (enlargement shown below), ventricular ependyma containing tufts of motile cilia, airways (enlargement below), ureter (upper panel), renal
tubules (lower panel), cerebellum and mid-gestation embryos. (D) Cep290gt/gt embryos at E13, E17; hepatic pallor is a primary visible feature. (E) P19 kidneys; rare
Cep290gt/gt survivor with massive cystic kidney. (F) H&E kidney staining, P19 wild type and P3, P19 Cep290gt/gt pups, showing progressive cystic kidneys eliminating
renal parenchyma (upper panels, 10×) resulting in cellular infiltrate (lower panels, 40×). (G) H &E stained P10 and P18–19 retinal sections, wild type and Cep290gt/gt.
Note lack of outer limiting membrane (white arrow) and OS; pyknotic nuclei/thinning of the ONL, indicating rapid cell death in Cep290gt/gt. Original magnifications: P10
upper, 40×; P10 lower and P18–19, 60×. (H) TEM images of P14 wildtype and Cep290gt/rd16 compound heterozygous retinas in longitudinal (upper) and cross sections
(lower). Cross-sections of connecting cilia, red circles; basal body-cilia transition, blue circles. Abbreviations: OS, outer segments; IS, inner segments; ONL, outer
nuclear layer; INL, inner nuclear layer; CC, connecting cilia.
3784
| Human Molecular Genetics, 2015, Vol. 24, No. 13
2–3 weeks of age, the rare surviving Cep290gt/gt mice had massively
dilated, pale kidneys (Fig. 7E), characterized by loss of tubules, cellular infiltrate and massive cysts replacing most of the renal cortex
and outer medulla (Fig. 7F). Thus, the truncation allele (gt) causes
a Meckel syndrome like phenotype. The retina of Cep290gt/gt mice
showed clear abnormalities at earlier ages compared with
Cep290ko/ko or Cep290rd16/rd16 (Fig. 7G,H); for example, apparent
over-proliferation of the ONL was observed by P10, along with
loss of the outer limiting membrane (Fig. 7G).
We previously reported mitigation of the Cep290rd16/rd16 phenotype by allelic loss of Mkks (33). Thus, we tested whether removal
of one or both alleles of Mkks would influence the severity of
Cep290ko and Cep290gt alleles. Surprisingly, when combined
with Mkksko alleles, we observed a partial rescue of the Cep290gt/gt
embryonic lethality (Fig. 8A, Supplementary Material, Table S4)
and renal pathology (Fig. 8B). In contrast, Cep290ko/ko; Mkksko/ko
embryos died before E11, as no double homozygotes were recovered at or after this stage (Supplementary Material, Tables S4 and
S5). The Cep290ko/ko; Mkksko/+ mice survived for 2–3 weeks and exhibited severe hydrocephalus and faster retinal degeneration
than Cep290ko/ko mice (Fig. 8C).
Modeling of a CEP290 oligomeric structure
in the connecting cilia
Based on the requirement of CEP290 in photoreceptor and ventricular ependyma ciliogenesis, we sought to predict CEP290 tertiary structure to gain further insight into its possible mechanism
of action at the transition zone (Supplementary Material, Fig. S2).
Domain prediction of both mouse and human CEP290 identified
extensive coiled-coils throughout the protein, almost to the
exclusion of other domains (Supplementary Material, Fig. S2A).
Only a few other cilia proteins share such a domain structure.
To explore the tertiary structure of CEP290, we used GlobProt 2
(version 2.3, http://globplot.embl.de) and identified six coiledcoil domains covering the full length of the protein, interspersed
with five small peptide regions exhibiting structural disorder
(Supplementary Material, Fig. S2B; Table S6), which indicate five
nodes that might maintain molecular flexibility of an otherwise
rigid, rod-like molecule (Supplementary Material, Fig. S2C). The
Multicoil 2 program (http://groups.csail.mit.edu/cb/multicoil/
cgi-bin/multicoil.cgi) predicted the location of coiled-coil regions
and suggested that CEP290 has the propensity to form oligomeric
structures; the possible dimer, trimer and tetramer models of the
DSD showed predicted coiled-coil diameters of 2.3, 2.7 and
2.9 nm, respectively (Supplementary Material, Fig. S2F and G).
A monomer would have a predicted diameter of ∼1.4 nm. The
entire protein is predicted to have a maximum theoretical length
of ∼348 nm, thus forming a long, thin rod-like molecule.
In contrast, the truncated CEP290 protein of 116 kDa had a
relatively high propensity to form a dimeric coiled-coil structure
compared with that of the full-length trimeric protein (Supplementary Material, Fig. S2F). The structures of full-length and
truncated CEP290 are interrupted by the coiled-coil vimentinlike structure (residues 696–752), which showed 29% identity to
vimentin protein sequence as demonstrated by Phyre2 and
SMART. The rest of the truncated CEP290 protein revealed 13% sequence identity to tropomyosin with 12 coiled-coil heptad motifs
(HxxHCxC) confirming the coiled-coil conformation. The 116 kDa
protein is shortened by 58% and predicted to have a maximum
length of 145 nm.
Figure 8. Loss of Mkks rescues Cep290gt/gt defects but accentuates the Cep290ko/ko
phenotype. (A). Adult (2.5 months) mice carrying mutant alleles of both Cep290
and Mkks, with genotypes as indicated; top view (left) and side view (right)
show the same littermates. Note domed head in the Cep290gt/gt; Mkksko/+ mouse
(white asterisk and black arrow), but otherwise normal appearance. (B)
Histological sections of kidney from adult wild type and P17–18 pups of the
genotypes indicated. Left panels (10×) are oriented with the renal cortex to the
right and medulla to the left. Right panels (40×) show renal tubules. The
Cep290gt/gt; Mkksko/ko genotype has mild cystic changes (asterisks); compare with
Cep290gt/gt images in Figure 7F. (C) Histological sections of P16 retina from
control, Cep290ko/ko and Cep290ko/ko; Mkksko/+, showing more rapid ONL loss in
the triple allele mutant.
Discussion
Loss of CEP290 results in widespread ciliary defects in multiple
tissues and accompanying disease phenotypes consistent with
Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015
Loss of Mkks rescues the Cep290gt/gt phenotype but
accentuates the Cep290ko/ko phenotype
Human Molecular Genetics, 2015, Vol. 24, No. 13
RPGRIP1 mutations. Recent evidence shows that RPGR and
RPGRIP1 have reciprocal requirements for proper ciliary localization and function (67,68).
Multiple mutations in human CEP290-based disease lead to
a variety of conditions and symptoms (39), suggesting complex
genetic regulation and tissue- and domain-specific functions of
this large protein. Both N and C termini contain dimerization
domains, and binding sites for numerous interactors are spread
throughout the protein (15,39,43,69). We have now studied
three alleles of Cep290: Cep290rd16 (hypomorph), Cep290ko (null)
and Cep290gt (dominant). Tissue-specific requirements for
CEP290 are evident by varying effects of its loss in different
organs. Photoreceptors are highly sensitive to the absence of
CEP290 (70), resulting in complete absence of cilia formation
and rapid death of the cells in all three alleles ( present results
and (37)). In Cep290rd16, only sensory organs are affected
(33,37,47), whereas the Cep290ko exhibits more severe systemic
manifestations. To our initial surprise, the Cep290 null allele generated by removing exons 1–4 in mouse does not result in overt or
serious kidney dysfunction; however, the fact that the Cep290gt
mouse does exhibit severe cystic renal disease validates a role
for CEP290 in kidney function. Pronephros morphogenesis
utilizes Wnt signaling (71), and loss of canonical Wnt signaling
is associated with development of nephronophthisis in adult
mice (23). A disruption of this pathway occurs in renal cysts but
not retina of a ciliopathy mouse model (72). These results, in
combination with our findings, suggest that loss of Cep290
function does not directly disrupt Wnt signaling, but that a
dominant or novel function of the Cep290gt N-terminal fragment
may do so.
While our manuscript was in preparation, another report described investigations on Cep290gt mice, generated independently by using the ES clone we also employed (73). This report further
supports the concept that Wnt signaling is not directly disrupted
in Cep290-related pathology and finds that Hedgehog (Hh) signaling may be the pathway through which kidney development is
disrupted in the Cep290gt mice; however, a direct relationship
between Hh and CEP290 remains to be shown. The newly discovered BBS-Shh negative regulator LZTFL1/BBS17 may provide a
link (9,74). Based on the negative regulation of BBSome ciliary
trafficking and Shh signaling by LZTFL1 (9,74), the rescue we observe with Cep290gt in combination with reduced Mkks could be
mediated by a similar mechanism. The fact that both truncation
alleles Cep290rd16 and Cep290gt show rescue, lends support to this
hypothesis and provides insights into diversity of phenotypes
observed in human CEP290 mutations.
Human mutations in CEP290 result in a broad spectrum of
ciliopathies, from non-syndromic congenital vision loss (LCA)
to nephronophthisis, Joubert syndrome and embryonic lethal
Meckel–Gruber syndrome (39). A review of CEP290base mutations
(http://medgen.ugent.be/cep290base/overview.php) shows that
LCA can be caused by mutations throughout the protein, whereas
Joubert syndrome results from nonsense mutations in the
C-terminal half of the protein, and many Meckel–Gruber mutations are nonsense mutations within the first half of the protein.
A mutation causing nephronophthisis, in contrast, results from a
single residue deletion in the last exon (exon 54). With the exception of LCA, a rough correlation exists between severity of disease
phenotype and mutation position within Cep290. Similar findings
occur with mouse Cep290ko and Cep290rd16 alleles; our findings
with the Cep290gt suggest that some mutations leading to severe
phenotypes in human, such as Meckel–Gruber syndrome, may in
fact be gain-of-function alleles. However, a construct similar to
the truncated protein in Cep290gt mice was found to rescue vision
Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015
human ciliopathies. Interestingly, the CEP290 defects manifest as
excessively longer primary cilia in the ventricular lining and
other cell types rather than the absence of cilia as in many
other ciliary gene mutants. Motile cilia in the ventricular lining
are delayed in emergence and fewer in numbers but are also longer in the adult mutants than in the controls. In the photoreceptors, however, outer segment morphogenesis fails completely,
and the connecting cilia are often not docked at the apical
inner segment membrane. Given that the outer segment is a
modified sensory cilium and the connecting cilia is analogous
to the transition zone of primary cilia, we show that ciliogenesis
in photoreceptors is dramatically compromised in the Cep290
null mutant. We hypothesize that either photoreceptors are particularly sensitive to loss of CEP290, or that CEP290 has additional
specialized functions in this cell type, probably due to the exceptionally large amount of biomolecules trafficked through the connecting cilia. In concordance, CEP290 expression is far greater in
photoreceptors compared with any other cell type. A formal possibility, yet to be excluded, is that ciliogenesis does occur at one
point, but rapid failure of outer segment morphogenesis is so
damaging to the cell that we are observing a late outcome. We
also note that the excessively long primary and motile cilia are
unlikely to function normally. These intriguing possibilities require further exploration in future studies.
The pleiotropic human disease phenotypes caused by CEP290
mutations and a large number of its interacting proteins suggest
multiple functions for this large, coiled-coil domain protein. Previous studies have suggested a role for CEP290 as a ciliary gatekeeper
(32,61) and identified both microtubule binding and auto-inhibitory domains (62). The dramatically longer cilia that we have
observed here could be the result of unchecked entry of biomolecules into the cilia, consistent with the putative gating role for
CEP290 at the transition zone. Alternately, the longer cilia could indicate that CEP290 is a sensor for regulating cilia length via a feedback mechanism from the tip. Signaling processes through the
primary cilia are dependent on a segregated ciliary compartment
that maintains a distinct pattern of biomolecule distribution from
the remainder of the cell. Additional points from our study shed
further light on the function of CEP290 in mammalian ciliogenesis
and its role in ciliopathies, helping us define the role of CEP290 in
space and time: time, in terms of ciliogenesis, developmental stage
and aging; space, in terms of tissue-specificity, region of the cilium
and protein domains responsible for various functions. Moreover,
our findings assist in correlating the range of phenotypic manifestations of human CEP290 mutations.
At what point in the process of ciliogenesis does CEP290 act?
In the unicellular flagellate Chlamydomonas, CEP290 has been
shown to tether transition zone microtubules to the membrane
(32). We now show that transition zone formation essentially depends on CEP290, as the absence of this protein in photoreceptors
results in failure of the connecting cilium to extend from the
plasma membrane, although basal bodies and distal appendages
are present. Docking of ciliary vesicles with the mother centriole
(basal body) at its anchor point to the plasma membrane involves
CEP164 (63) and CCDC41 (64). The mother centriole connects to
the plasma membrane via distal appendages, structures whose
formation is dependent on CEP123, ODF1 (65) and CC2D2A (66).
Both Rab8a (63) and PCM1 have been implicated in these processes, and both interact with CEP290 (42), as do CEP123 (65)
and CC2D2A (51). This suggests that CEP290 is required closely
downstream of CEP164, CCDC41, Cep123, ODF1 and CC2D2A,
but likely upstream of RPGR and RPGRIP1, as our results indicate;
epistasis could thus explain why in general CEP290-mediated retinal degeneration is more severe than that caused by RPGR or
| 3785
3786
| Human Molecular Genetics, 2015, Vol. 24, No. 13
partial explanation, differential rescue of the three Cep290 mutants by Mkks loss is intriguing. Truncated forms of CEP290 are
expressed in Cep290rd16 and in Cep290gt, both of which show ciliary rescue with loss of MKKS ( present results and (33)). In contrast, no protein is detected in the Cep290ko, which exhibits a
more severe phenotype in combination with Mkksko. MKKS is
part of a complex with BBS10 and BBS12 involved in BBSome assembly (50). Yeast two-hybrid studies suggest an interaction of
CEP290 with several components of the BBSome (Helen L. MaySimera, unpublished data), required for transporting membrane
proteins to the cilium (89,90). In addition to its interaction with
MKKS (33), CEP290 interacts with BBS4, likewise required for
BBSome assembly (40,41). The BBSome is intact in BBS4ko/ko mice
(91) but disrupted in Mkksko/ko mice (50). Compared with
Cep290rd16/rd16 mice, Cep290rd16/rd16; Bbs4ko/ko mice exhibit a more
severe phenotype (40), whereas Cep290rd16/rd16; Mkksko/ko mice
show rescue (33). Thus, similar to LZTFL1/BBS17, a cytoplasmic
negative regulator of BBSome ciliary trafficking mentioned above
(74), our present findings suggest that CEP290 may be a negative
regulator of BBSome function at the transition zone. Our studies
have implications for designing therapies to treat ciliopathies, in
that inhibiting BBSome function may, at least in some CEP290mediated ciliopathies, result in mitigation of phenotypic severity.
Materials and Methods
Generation of Cep290 knockout (Cep290ko) mice
Murine centrosomal protein 290 (Cep290) gene, as currently annotated, spans 85.37 kb on chr10 with a total of 53 exons. The genomic organization of the locus is highly conserved between
mouse and human. To inactivate the Cep290 gene creating a
null allele in mouse, exons 1–4 of the gene were replaced in ES
cells with a β-gal-neoR cassette by homologous recombination
(92) as shown in Figure 2. Briefly, a gene targeting vector of replacement type was constructed from a BAC clone isogenic to
the SV129 mouse genome and carrying the Cep290 locus through
ET recombination or recombineering (93). The bacteria Diphtheria toxin A (DTA) coding sequence was included in the targeting vector driven by PGK promoter as negative selection (94).
Linearized targeting vector was electroporated into the R1 ES
cells (95). Homologous recombination events were identified by
genomic Southern, after digest with AvrII, using a 519 bp probe
upstream of exon 1 and outside the left targeting arm, generating
bands of 10 and 13 kb for wild type and mutant, respectively. Correctly recombined ES clones were microinjected into blastocysts
of C57BL/6J to make chimeras, and germline transmitted F1 mice
from clones A2 and B1 were obtained by crossing high percentage
male chimeras with wild-type C57BL/6J mice (92). The presence
of the targeted allele was confirmed by long genomic PCR. The
null or knockout allele will be referred to as the ko allele in this
paper. Genotyping primers are common forward, CATTATCGTA
TAGCCTGTGTCAGGGGAACT; wild type reverse, ATCTGCTAACTC
TTCTTGCCGTGGCAGGTC; knockout reverse, TGTGCTGCAAGG
CGATTAAGTTGGGTAACG.
Generation of Cep290 genetrap (Cep290gt) mice
Cep290gt/gt mice were generated from an ES gene trap cell line,
CC0582 (SIGTR), made by the Sanger Center. Sequencing identified the chromosome 10 breakpoint in Cep290 intron 25, 3.2 kb
downstream of exon 25. The breakpoint sequenced as follows:
intron 25: AATGTGGAAGGCAGATGGGAAACTGGAAAATGTGA
TAGGT- pGT0lxfT2 beta-geo vector sequence:GTTCAGGTTTGAG
Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015
in a zebrafish model of cep290 vision loss (75), indicating differences among species.
The specific cilia defects observed in photoreceptors and ventricular ependymal cilia provide deeper understanding of various
spatial and temporal components of the cilium, including the ciliary pockets, diffusion barrier and transition zone formation. The
striking absence of the ciliary pocket in Cep290ko/ko ependyma
raises the question of the normal significance of this structure.
The ciliary pocket has been suggested to orient primary cilia for
directional sensing (76), as we see with the highly misoriented
cilia in the absence of the ciliary pocket in the Cep290ko/ko. That
CEP290 is required for development of the ciliary pocket provides
another potential link between ciliogenesis and planar cell polarity (77), as has been demonstrated in airway epithelia (78). The
transition from a single primary to motile cilia has likewise
been demonstrated in airway epithelia (79).
Our data show that CEP290 is essential for integrity of the
transition zone, and that it localizes to the region of the Y-linkers,
which connect the microtubule ring with the plasma membrane
(80). While not known to constitute a component of the
Y-connectors, CEP290 has been demonstrated to connect the
plasma membrane and the ciliary microtubules (62), although
evidence conflicts as to whether CEP290 binds microtubules directly or through an interaction protein such as CEP162, a critical
component of transition zone assembly (81). Recent evidence
supports the existence of a ciliary pore complex, analogous to
the nuclear pore complex, acting as a diffusion barrier at the transition zone (82,83). CEP290, perhaps in connection with the
Y-linkers, could form part of this barrier. The precise relationship
between CEP290 and the Y-linkers remains to be determined.
Plausible limits for the structural and functional position of
CEP290 within the transition zone can be reached by combining
these results with the immunoEM results (see Fig. 1F and G)
and previously determined dimensions, also confirmed here, of
individual microtubules (25 nm), ciliary microtubule rings
(∼150 nm diameter) and the photoreceptor connecting cilium
(250 nm width by 1500 nm length) (Fig. 9). These numerical constraints suggest that CEP290 (either singly or as an oligomer) may
be located vertically along the length of the transition zone in the
region of the Y-linkers, between the plasma membrane and the
microtubule ring. This is the region of intraflagellar transport,
through which proteins traversing the length of the cilium
must pass (84). In line with our modeling predictions, the defects
in connecting cilium formation in the Cep290 mutants begin to
make sense. In the absence of CEP290, formation of the photoreceptor transition zone/connecting cilium is prevented, suggesting that CEP290 may act to facilitate ciliary vesicle docking
with the plasma membrane, thus initiating transition zone formation. CEP290-ΔDSD, the truncated protein found in the
Cep290rd16 mutant, is able to mediate vesicle docking and transition zone formation; however, the connecting cilium/transition
zone is of aberrant shape, suggesting incomplete or defective
function of CEP290 in providing structural support and/or trafficking of essential interacting proteins into appropriate orientation. Thus, at least two related functions for CEP290 can be
deduced from these data: initiation of transition zone formation
and structural integrity of the transition zone at the ciliary base.
Modifier genes have been shown to alter the phenotypic severity of various ciliopathy-causing mutations (39,85–88). A
third and more specific molecular role for CEP290 as a regulator
of BBSome function can be postulated from previous studies
and from the different interactions of Cep290 alleles with Mkks.
Ciliogenesis is impaired in mice with each of the three Cep290
mutant alleles. While background difference may provide a
Human Molecular Genetics, 2015, Vol. 24, No. 13
| 3787
between the plasma membrane and the microtubule ring.
CAGGCCAGGCCTCTCCCGTGGTCTCGCCCT. These ES cells were
injected into C57BL/6 blastocysts to generate Cep290Gt(CC0582)Wtsi
mice (here referred to as Cep290gt mice). Mice were backcrossed
onto both C57BL/6J and 129/SvJ lines without significant differences
in observed phenotype. Note that this is the same allele as described in ref. (80), although they calculate it as integrating into intron 23; according to the publically available sequence of the
murine Cep290 gene, the forward primer site used for integration
site mapping (F4 in reference 80) currently maps to intron 25.
Mouse breeding and maintenance
All experiments conform to an animal study protocol reviewed
and approved by the NEI Animal Care and Use Committee. Animals were housed under standard light/dark conditions and
given regular chow ad libitum. For Cep290 ko, agouti founder
males carrying the ko allele were backcrossed to wild-type
C57BL/6J or 129/SvJ mice for up to six generations to obtain mice
>98% pure on each background. Both F1 and N4–6 backcross heterozygous knockout mice were intercrossed to generate homozygotes on either a mixed C57BL/6J-129/SvJ or pure strain. Viable F2
and F3 homozygotes were used to maintain a homozygous colony,
while N4F1 (for 129/SvJ) or N6F1 (for C57BL/6J) crosses were used to
generate homozygotes on either individual strain.
For Cep290 gt, the same mating strategy was used to generate
heterozygous animals. With rare exceptions, Cep290gt/gt animals
did not survive on either genetic background (compare with findings in ref.(80), which likewise found embryonic lethality for the
same allele on C57BL/6 background).
ERG and fundoscopy
Mice were examined by fundus photography and by electroretinogram according to standard procedures (33).
Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015
Figure 9. A model of photoreceptor connecting cilium (drawn to scale). Schematic showing microtubules, ciliary pocket and other measurements, as determined by
electron microscopy. The drawing clarifies possible positions for rod-like coiled-coil domain proteins such as Cep290, which localize to the region of the Y-linkers
3788
| Human Molecular Genetics, 2015, Vol. 24, No. 13
Histology, immunolocalization and confocal microscopy
Primary antibodies: rabbit and rat anti-CEP290 (33); mouse antiacetylated alpha-tubulin, Sigma; chicken anti-rootletin, T. Li;
anti-RKIP, gift of H. Khanna (69); anti-RPGR, T. Li; adenylate
cyclase, T. Li; rabbit anti-ZO1, Invitrogen/Zymed; rabbit antiRNA polymerase II, Abcam; mouse anti-GT335, Sigma secondary
antibodies used were Alexa Fluor 488, Alexa Fluor 568, Alexa
Fluor 647 and gold-conjugated anti-rabbit. Imaging: Olympus
FV1000 laser scanning confocal microscope, 63× oil immersion
objective.
and molecular modeling of dimeric, trimeric and tetrameric
structures of DSD domains were performed using the protein
homology/analogy recognition Phyre2 engine v. 2.0 (http://www.
sbg.bio.ic.ac.uk/phyre2/). Information on similar protein atomic
structures from the RCSB Protein Data Bank (http://www.rcsb.
org/pdb) was used to model possible oligomeric structures of
DSD domain.
Supplementary Material
Transmission and scanning electron microscopy
For TEM, whole eyes were prepared, sectioned and imaged using
standard fixation, embedding and scanning procedures. For SEM,
samples were fixed for 2 h at room temperature in EM fix (2.5%
glutaraldehyde, 4% paraformaldehyde, 10 m CaCl2 in 0.1 M
HEPES). They were then coated with 1% tannic acid and 1% osmium tetroxide, after which they were dehydrated through an
ethanol series and critical point dried. Images were taken using
an S-4800 field emission scanning electron microscope and
morphometric analyses were carried out.
High-resolution MRI imaging of mouse brain
Wild type and Cep290 ko mice on both mixed and pure genetic
backgrounds were deeply anesthetized with ketamine/xylazine
IP and perfused with cold PBS followed by 4% paraformaldehyde
containing 1:500 Magnevist MRI contrast agent. Following postfix
in the same solution, the head was placed in a 15 mm NMR tube
(Wilmad Lab Glass, Buena, NJ) and submerged in Fomblin (Ausimont, NJ, USA), a fluorinated non-hydrogenated liquid, to minimize magnetic susceptibility difference which may result in
image artifacts between the tissue and surrounding (air) and to
eliminate intense water signal which would otherwise affect tissue contrast. The head sample was then centered in a 15 mm
radio frequency antenna. The brain MRI experiments were performed, as described (96,97), on a vertical bore 14 T scanner operating on a Bruker Avance platform (Bruker Biospin Inc., Billerica,
MA). Three mutually perpendicular scout images of the excised
brain were acquired [repetition time (TR)/echo time (TE) = 100/
6 ms, magnetization 30°, in-plane resolution = 200 µm, slice
thickness = 1 mm). These images were used to obtain the optimum volumetric field of view that encompasses the whole
brain for the subsequent 3-D scan. A T1 weighted gradient echo
image sequence (TR/TE = 100/6.4 ms, number of averages = 8,
field of view = 25.6 × 25.6 × 16 mm) was used to achieve an isotropic resolution of 50 µm in a total scan time of ∼23 h (Supplementary Material, Table S3).
Bioinformatic analysis
Protein sequence information on centrosomal protein of 290 kDa
(CEP290) from human and mice (acc.# O15078 and Q6A078, respectively) was obtained from the UniProt database (http
://www.uniprot.org/). Structurally disordered regions were determined for protein sequences using the intrinsic protein disorder,
domain and globularity prediction program GlobProt 2, version
2.3 (http://globplot.embl.de/). In addition, protein sequence fragments in coiled-coil conformation were predicted using simple
modular research architecture tool, SMART (http://smart.emblheidelberg.de/). Propensities to form coiled-coil dimers and
trimers were evaluated using the Multicoil program (http://
groups.csail.mit.edu/cb/multicoil/cgi-bin/multicoil.cgi). Finally,
the identification of coiled-coil structures in structural domains
Authors’ contributions
R.R., T.L. and A.S. conceived the study, designed the experiments,
analyzed the data and wrote the manuscript. R.A.R., E.A.Y., H.L.
M-S., A.N.H., K.P. and N.G. performed the experiments and
analyzed the corresponding data. Y.V.S. and B.W. did structural
analysis. M.D. and J.M. performed MRI imaging and analyzed
the data. L.D. generated the knockout mice. R.A.R., E.A.Y. and
R.N.F. performed confocal or electron microscopy and analyzed
the data.
Acknowledgements
We are grateful to Kunio Nagashima (NCI Electron Microscopy
Facility), Mones Abu-Asab and Alex Ogilvy (NEI Electron Microscopy Facility) and members of the NEI Histology Core for excellent
technical assistance with EM and histology. We thank Jacob
Nellissery for technical assistance, Yide Mi for expert assistance
with mouse care, Luis Menesez (NIDDK) for assistance with kidney pathology and Nissan Levron for helpful comments and
suggestions.
Conflict of Interest statement. None declared.
Funding
This research was supported by Intramural Research Program of
the National Eye Institute.
References
1. Badano, J.L., Mitsuma, N., Beales, P.L. and Katsanis, N. (2006)
The ciliopathies: an emerging class of human genetic disorders. Annu. Rev. Genomics Hum. Genet., 7, 125–148.
2. Hildebrandt, F., Benzing, T. and Katsanis, N. (2011) Ciliopathies. N. Engl. J. Med., 364, 1533–1543.
3. Lee, J.E. and Gleeson, J.G. (2011) Cilia in the nervous system:
linking cilia function and neurodevelopmental disorders.
Curr. Opin. Neurol., 24, 98–105.
4. Bettencourt-Dias, M., Hildebrandt, F., Pellman, D., Woods, G.
and Godinho, S.A. (2011) Centrosomes and cilia in human disease. Trends Genet., 27, 307–315.
5. Sharma, N., Berbari, N.F. and Yoder, B.K. (2008) Ciliary dysfunction in developmental abnormalities and diseases.
Curr. Top. Dev. Biol., 85, 371–427.
6. Adams, N.A., Awadein, A. and Toma, H.S. (2007) The retinal
ciliopathies. Ophthalmic. Genet., 28, 113–125.
7. Green, J.A. and Mykytyn, K. (2010) Neuronal ciliary signaling
in homeostasis and disease. Cell Mol. Life Sci., 67, 3287–3297.
8. Gascue, C., Katsanis, N. and Badano, J.L. (2011) Cystic diseases
of the kidney: ciliary dysfunction and cystogenic mechanisms. Pediatr. Nephrol., 26, 1181–1195.
Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015
Supplementary Material is available at HMG online.
Human Molecular Genetics, 2015, Vol. 24, No. 13
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
R.G. et al. (2012) Mutations in mouse Ift144 model the craniofacial, limb and rib defects in skeletal ciliopathies. Hum. Mol.
Genet., 21, 1808–1823.
Ocbina, P.J., Eggenschwiler, J.T., Moskowitz, I. and Anderson,
K.V. (2011) Complex interactions between genes controlling
trafficking in primary cilia. Nat. Genet., 43, 547–553.
Clement, C.A., Kristensen, S.G., Mollgard, K., Pazour, G.J.,
Yoder, B.K., Larsen, L.A. and Christensen, S.T. (2009) The primary cilium coordinates early cardiogenesis and hedgehog
signaling in cardiomyocyte differentiation. J. Cell Sci., 122,
3070–3082.
Dalagiorgou, G., Basdra, E.K. and Papavassiliou, A.G. (2010)
Polycystin-1: function as a mechanosensor. Int. J. Biochem.
Cell Biol., 42, 1610–1613.
Yoder, B.K. (2007) Role of primary cilia in the pathogenesis of
polycystic kidney disease. J. Am. Soc. Nephrol., 18, 1381–1388.
Reiter, J.F. (2008) A cilium is not a cilium is not a cilium: signaling contributes to ciliary morphological diversity. Dev. Cell,
14, 635–636.
Craige, B., Tsao, C.C., Diener, D.R., Hou, Y., Lechtreck, K.F.,
Rosenbaum, J.L. and Witman, G.B. (2010) CEP290 tethers
flagellar transition zone microtubules to the membrane
and regulates flagellar protein content. J. Cell. Biol., 190,
927–940.
Rachel, R.A., May-Simera, H.L., Veleri, S., Gotoh, N., Choi, B.Y.,
Murga-Zamalloa, C., McIntyre, J.C., Marek, J., Lopez, I.,
Hackett, A.N. et al. (2012) Combining Cep290 and Mkks
ciliopathy alleles in mice rescues sensory defects and
restores ciliogenesis. J. Clin. Invest., 122, 1233–1245.
Garcia-Gonzalo, F.R., Corbit, K.C., Sirerol-Piquer, M.S.,
Ramaswami, G., Otto, E.A., Noriega, T.R., Seol, A.D., Robinson,
J.F., Bennett, C.L., Josifova, D.J. et al. (2011) A transition zone
complex regulates mammalian ciliogenesis and ciliary
membrane composition. Nat. Genet., 43, 776–784.
Sayer, J.A., Otto, E.A., O’Toole, J.F., Nurnberg, G., Kennedy, M.A.,
Becker, C., Hennies, H.C., Helou, J., Attanasio, M., Fausett, B.V.
et al. (2006) The centrosomal protein nephrocystin-6 is mutated in Joubert syndrome and activates transcription factor
ATF4. Nat. Genet., 38, 674–681.
Valente, E.M., Silhavy, J.L., Brancati, F., Barrano, G., Krishnaswami, S.R., Castori, M., Lancaster, M.A., Boltshauser, E.,
Boccone, L., Al-Gazali, L. et al. (2006) Mutations in CEP290,
which encodes a centrosomal protein, cause pleiotropic
forms of Joubert syndrome. Nat. Genet., 38, 623–625.
Chang, B., Khanna, H., Hawes, N., Jimeno, D., He, S., Lillo, C.,
Parapuram, S.K., Cheng, H., Scott, A., Hurd, R.E. et al. (2006) Inframe deletion in a novel centrosomal/ciliary protein CEP290/
NPHP6 perturbs its interaction with RPGR and results in
early-onset retinal degeneration in the rd16 mouse. Hum.
Mol. Genet., 15, 1847–1857.
den Hollander, A.I., Roepman, R., Koenekoop, R.K. and
Cremers, F.P. (2008) Leber congenital amaurosis: genes, proteins and disease mechanisms. Prog Retin Eye Res, 27, 391–419.
Coppieters, F., Lefever, S., Leroy, B.P. and De Baere, E. (2010)
CEP290, a gene with many faces: mutation overview and
presentation of CEP290base. Hum. Mut., 31, 1097–1108.
Zhang, Y., Seo, S., Bhattarai, S., Bugge, K., Searby, C.C., Zhang,
Q., Drack, A.V., Stone, E.M. and Sheffield, V.C. (2014) BBS mutations modify phenotypic expression of CEP290-related ciliopathies. Hum. Mol. Genet., 23, 40–51.
Stowe, T.R., Wilkinson, C.J., Iqbal, A. and Stearns, T. (2012) The
centriolar satellite proteins Cep72 and Cep290 interact and
are required for recruitment of BBS proteins to the cilium.
Mol. Biol. Cell, 23, 3322–3335.
Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015
9. Marion, V., Stutzmann, F., Gerard, M., De Melo, C., Schaefer, E.,
Claussmann, A., Helle, S., Delague, V., Souied, E., Barrey, C.
et al. (2012) Exome sequencing identifies mutations in
LZTFL1, a BBSome and smoothened trafficking regulator, in
a family with Bardet–Biedl syndrome with situs inversus
and insertional polydactyly. J. Med. Genet., 49, 317–321.
10. Mykytyn, K., Braun, T., Carmi, R., Haider, N.B., Searby, C.C.,
Shastri, M., Beck, G., Wright, A.F., Iannaccone, A., Elbedour,
K. et al. (2001) Identification of the gene that, when mutated,
causes the human obesity syndrome BBS4. Nat. Genet., 28,
188–191.
11. Doherty, D. (2009) Joubert syndrome: insights into brain
development, cilium biology, and complex disease. Semin.
Pediatr. Neurol., 16, 143–154.
12. Juric-Sekhar, G., Adkins, J., Doherty, D. and Hevner, R.F. (2012)
Joubert syndrome: brain and spinal cord malformations in
genotyped cases and implications for neurodevelopmental
functions of primary cilia. Acta Neuropathol., 123, 695–709.
13. Dawe, H.R., Smith, U.M., Cullinane, A.R., Gerrelli, D., Cox, P.,
Badano, J.L., Blair-Reid, S., Sriram, N., Katsanis, N., AttieBitach, T. et al. (2007) The Meckel–Gruber Syndrome proteins
MKS1 and meckelin interact and are required for primary
cilium formation. Hum. Mol. Genet., 16, 173–186.
14. Hildebrandt, F., Attanasio, M. and Otto, E. (2009) Nephronophthisis: disease mechanisms of a ciliopathy. J. Am. Soc.
Nephrol., 20, 23–35.
15. Rachel, R.A., Li, T. and Swaroop, A. (2012) Photoreceptor
sensory cilia and ciliopathies: focus on CEP290, RPGR and
their interacting proteins. Cilia, 1, 22.
16. Estrada-Cuzcano, A., Roepman, R., Cremers, F.P., den
Hollander, A.I. and Mans, D.A. (2012) Non-syndromic retinal
ciliopathies: translating gene discovery into therapy. Hum.
Mol. Genet., 21, R111–R124.
17. Pazour, G.J. and Rosenbaum, J.L. (2002) Intraflagellar
transport and cilia-dependent diseases. Trends Cell. Biol., 12,
551–555.
18. Winyard, P. and Jenkins, D. (2011) Putative roles of cilia
in polycystic kidney disease. Biochim. Biophys. Acta, 1812,
1256–1262.
19. Barker, A.R., Thomas, R. and Dawe, H.R. (2014) Meckel–Gruber
syndrome and the role of primary cilia in kidney, skeleton,
and central nervous system development. Organogenesis, 10,
96–107.
20. Goetz, S.C. and Anderson, K.V. (2010) The primary cilium: a
signalling centre during vertebrate development. Nat. Rev.
Genet., 11, 331–344.
21. Waters, A.M. and Beales, P.L. (2011) Ciliopathies: an expanding disease spectrum. Pediatr. Nephrol., 26, 1039–1056.
22. Yokoyama, T. (2004) Motor or sensor: a new aspect of primary
cilia function. Anat. Sci. Int., 79, 47–54.
23. Lancaster, M.A., Louie, C.M., Silhavy, J.L., Sintasath, L.,
Decambre, M., Nigam, S.K., Willert, K. and Gleeson, J.G.
(2009) Impaired Wnt-beta-catenin signaling disrupts adult
renal homeostasis and leads to cystic kidney ciliopathy.
Nat. Med., 15, 1046–1054.
24. Bimonte, S., De Angelis, A., Quagliata, L., Giusti, F., Tammaro,
R., Dallai, R., Ascenzi, M.G., Diez-Roux, G. and Franco, B. (2011)
Ofd1 is required in limb bud patterning and endochondral
bone development. Dev. Biol., 349, 179–191.
25. Goetz, S.C., Liem, K.F. Jr and Anderson, K.V. (2012) The spinocerebellar ataxia-associated gene Tau tubulin kinase 2 controls the initiation of ciliogenesis. Cell, 151, 847–858.
26. Ashe, A., Butterfield, N.C., Town, L., Courtney, A.D., Cooper,
A.N., Ferguson, C., Barry, R., Olsson, F., Liem, K.F. Jr, Parton,
| 3789
3790
| Human Molecular Genetics, 2015, Vol. 24, No. 13
55. Narita, K., Kozuka-Hata, H., Nonami, Y., Ao-Kondo, H., Suzuki, T., Nakamura, H., Yamakawa, K., Oyama, M., Inoue, T.
and Takeda, S. (2012) Proteomic analysis of multiple primary
cilia reveals a novel mode of ciliary development in mammals. Biol. Open, 1, 815–825.
56. Brancati, F., Barrano, G., Silhavy, J.L., Marsh, S.E., Travaglini,
L., Bielas, S.L., Amorini, M., Zablocka, D., Kayserili, H., Al-Gazali, L. et al. (2007) CEP290 mutations are frequently identified
in the oculo-renal form of Joubert syndrome-related disorders. Am. J. Hum. Genet., 81, 104–113.
57. Tory, K., Lacoste, T., Burglen, L., Moriniere, V., Boddaert, N.,
Macher, M.A., Llanas, B., Nivet, H., Bensman, A., Niaudet, P.
et al. (2007) High NPHP1 and NPHP6 mutation rate in patients
with Joubert syndrome and nephronophthisis: potential epistatic effect of NPHP6 and AHI1 mutations in patients with
NPHP1 mutations. J. Am. Soc. Nephrol., 18, 1566–1575.
58. Sattar, S. and Gleeson, J.G. (2011) The ciliopathies in neuronal
development: a clinical approach to investigation of Joubert
syndrome and Joubert syndrome-related disorders. Dev.
Med. Child Neurol., 53, 793–798.
59. Pellegrino, J.E., Lensch, M.W., Muenke, M. and Chance, P.F.
(1997) Clinical and molecular analysis in Joubert syndrome.
Am. J. Med. Genet., 72, 59–62.
60. Swaroop, A. (2013) What’s in a name? RPGR Mutations
Redefine the Genetic and Phenotypic Landscape in Retinal
Degenerative Diseases. Invest. Ophthalmol. Vis. Sci., 54, 1417.
61. Betleja, E. and Cole, D.G. (2010) Ciliary trafficking: CEP290
guards a gated community. Curr. Biol., 20, R928–R931.
62. Drivas, T.G., Holzbaur, E.L. and Bennett, J. (2013) Disruption of
CEP290 microtubule/membrane-binding domains causes retinal degeneration. J. Clin. Invest., 123, 4525–4539.
63. Schmidt, K.N., Kuhns, S., Neuner, A., Hub, B., Zentgraf, H. and
Pereira, G. (2012) Cep164 mediates vesicular docking to the
mother centriole during early steps of ciliogenesis. J. Cell
Biol., 199, 1083–1101.
64. Joo, K., Kim, C.G., Lee, M.S., Moon, H.Y., Lee, S.H., Kim, M.J.,
Kweon, H.S., Park, W.Y., Kim, C.H., Gleeson, J.G. et al. (2013)
CCDC41 is required for ciliary vesicle docking to the mother
centriole. Proc. Natl. Acad. Sci. U. S. A., 110, 5987–5992.
65. Sillibourne, J.E., Hurbain, I., Grand-Perret, T., Goud, B., Tran, P.
and Bornens, M. (2013) Primary ciliogenesis requires the distal appendage component Cep123. Biol. Open, 2, 535–545.
66. Veleri, S., Manjunath, S.H., Fariss, R.N., May-Simera, H.,
Brooks, M., Foskett, T.A., Gao, C., Longo, T.A., Liu, P., Nagashima, K. et al. (2014) Ciliopathy-associated gene Cc2d2a promotes assembly of subdistal appendages on the mother
centriole during cilia biogenesis. Nat. Commun., 5, 4207.
67. Patil, H., Guruju, M.R., Cho, K.I., Yi, H., Orry, A., Kim, H. and
Ferreira, P.A. (2012) Structural and functional plasticity of
subcellular tethering, targeting and processing of RPGRIP1
by RPGR isoforms. Biol. Open, 1, 140–160.
68. Patil, H., Tserentsoodol, N., Saha, A., Hao, Y., Webb, M. and
Ferreira, P.A. (2012) Selective loss of RPGRIP1-dependent
ciliary targeting of NPHP4, RPGR and SDCCAG8 underlies
the degeneration of photoreceptor neurons. Cell Death Dis.,
3, e355.
69. Murga-Zamalloa, C.A., Ghosh, A.K., Patil, S.B., Reed, N.A.,
Chan, L.S., Davuluri, S., Peranen, J., Hurd, T.W., Rachel, R.A.
and Khanna, H. (2011) Accumulation of the Raf-1 kinase inhibitory protein (Rkip) is associated with Cep290-mediated
photoreceptor degeneration in ciliopathies. J. Biol. Chem.,
286, 28276–28286.
70. den Hollander, A.I., Koenekoop, R.K., Yzer, S., Lopez, I.,
Arends, M.L., Voesenek, K.E., Zonneveld, M.N., Strom, T.M.,
Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015
42. Kim, J., Krishnaswami, S.R. and Gleeson, J.G. (2008) CEP290 interacts with the centriolar satellite component PCM-1 and is
required for Rab8 localization to the primary cilium. Hum.
Mol. Genet., 17, 3796–3805.
43. Tsang, W.Y., Bossard, C., Khanna, H., Peranen, J., Swaroop, A.,
Malhotra, V. and Dynlacht, B.D. (2008) CP110 suppresses
primary cilia formation through its interaction with CEP290,
a protein deficient in human ciliary disease. Dev. Cell, 15,
187–197.
44. Sang, L., Miller, J.J., Corbit, K.C., Giles, R.H., Brauer, M.J., Otto,
E.A., Baye, L.M., Wen, X., Scales, S.J., Kwong, M. et al. (2011)
Mapping the NPHP-JBTS-MKS protein network reveals ciliopathy disease genes and pathways. Cell, 145, 513–528.
45. Barbelanne, M., Song, J., Ahmadzai, M. and Tsang, W.Y. (2013)
Pathogenic NPHP5 mutations impair protein interaction with
Cep290, a prerequisite for ciliogenesis. Hum. Mol. Genet., 22,
2482–2494.
46. Cideciyan, A.V., Rachel, R.A., Aleman, T.S., Swider, M.,
Schwartz, S.B., Sumaroka, A., Roman, A.J., Stone, E.M., Jacobson, S.G. and Swaroop, A. (2011) Cone photoreceptors are the
main targets for gene therapy of NPHP5 (IQCB1) or NPHP6
(CEP290) blindness: generation of an all-cone Nphp6 hypomorph mouse that mimics the human retinal ciliopathy.
Hum. Mol. Genet., 20, 1411–1423.
47. McEwen, D.P., Koenekoop, R.K., Khanna, H., Jenkins, P.M.,
Lopez, I., Swaroop, A. and Martens, J.R. (2007) Hypomorphic
CEP290/NPHP6 mutations result in anosmia caused by the
selective loss of G proteins in cilia of olfactory sensory
neurons. Proc. Natl. Acad. Sci. U. S. A., 104, 15917–15922.
48. Beales, P.L., Katsanis, N., Lewis, R.A., Ansley, S.J., Elcioglu, N.,
Raza, J., Woods, M.O., Green, J.S., Parfrey, P.S., Davidson, W.S.
et al. (2001) Genetic and mutational analyses of a large multiethnic Bardet–Biedl cohort reveal a minor involvement of
BBS6 and delineate the critical intervals of other loci. Am. J.
Hum. Genet., 68, 606–616.
49. Kim, J.C., Ou, Y.Y., Badano, J.L., Esmail, M.A., Leitch, C.C., Fiedrich, E., Beales, P.L., Archibald, J.M., Katsanis, N., Rattner, J.B.
et al. (2005) MKKS/BBS6, a divergent chaperonin-like protein
linked to the obesity disorder Bardet–Biedl syndrome, is a
novel centrosomal component required for cytokinesis.
J. Cell Sci., 118, 1007–1020.
50. Seo, S., Baye, L.M., Schulz, N.P., Beck, J.S., Zhang, Q., Slusarski,
D.C. and Sheffield, V.C. (2010) BBS6, BBS10, and BBS12 form a
complex with CCT/TRiC family chaperonins and mediate
BBSome assembly. Proc. Natl. Acad. Sci. U. S. A., 107, 1488–1493.
51. Gorden, N.T., Arts, H.H., Parisi, M.A., Coene, K.L., Letteboer,
S.J., van Beersum, S.E., Mans, D.A., Hikida, A., Eckert, M.,
Knutzen, D. et al. (2008) CC2D2A is mutated in Joubert syndrome and interacts with the ciliopathy-associated basal
body protein CEP290. Am. J. Hum. Genet., 83, 559–571.
52. Garcia-Garcia, M.J., Eggenschwiler, J.T., Caspary, T., Alcorn,
H.L., Wyler, M.R., Huangfu, D., Rakeman, A.S., Lee, J.D.,
Feinberg, E.H., Timmer, J.R. et al. (2005) Analysis of mouse
embryonic patterning and morphogenesis by forward genetics. Proc. Natl. Acad. Sci. U. S A., 102, 5913–5919.
53. Lopes, C.A., Prosser, S.L., Romio, L., Hirst, R.A., O’Callaghan,
C., Woolf, A.S. and Fry, A.M. (2011) Centriolar satellites are assembly points for proteins implicated in human ciliopathies,
including oral-facial-digital syndrome 1. J. Cell Sci., 124, 600–
612.
54. Nonami, Y., Narita, K., Nakamura, H., Inoue, T. and Takeda, S.
(2013) Developmental changes in ciliary motility on choroid
plexus epithelial cells during the perinatal period. Cytoskeleton (Hoboken), 70, 797–803.
Human Molecular Genetics, 2015, Vol. 24, No. 13
71.
72.
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
84. Ounjai, P., Kim, K.D., Liu, H., Dong, M., Tauscher, A.N., Witkowska, H.E. and Downing, K.H. (2013) Architectural insights
into a ciliary partition. Curr. Biol., 23, 339–344.
85. Khanna, H., Davis, E.E., Murga-Zamalloa, C.A., EstradaCuzcano, A., Lopez, I., den Hollander, A.I., Zonneveld, M.N.,
Othman, M.I., Waseem, N., Chakarova, C.F. et al. (2009) A common allele in RPGRIP1L is a modifier of retinal degeneration
in ciliopathies. Nat. Genet., 41, 739–745.
86. Louie, C.M., Caridi, G., Lopes, V.S., Brancati, F., Kispert, A.,
Lancaster, M.A., Schlossman, A.M., Otto, E.A., Leitges, M.,
Grone, H.J. et al. (2010) AHI1 is required for photoreceptor
outer segment development and is a modifier for retinal
degeneration in nephronophthisis. Nat. Genet., 42, 175–180.
87. Davis, E.E., Zhang, Q., Liu, Q., Diplas, B.H., Davey, L.M., Hartley,
J., Stoetzel, C., Szymanska, K., Ramaswami, G., Logan, C.V. et al.
(2011) TTC21B contributes both causal and modifying alleles
across the ciliopathy spectrum. Nat. Genet., 43, 189–196.
88. Abdelhamed, Z.A., Wheway, G., Szymanska, K., Natarajan, S.,
Toomes, C., Inglehearn, C. and Johnson, C.A. (2013) Variable
expressivity of ciliopathy neurological phenotypes that encompass Meckel–Gruber syndrome and Joubert syndrome is
caused by complex de-regulated ciliogenesis, Shh and Wnt
signalling defects. Hum. Mol. Genet., 22, 1358–1372.
89. Wei, Q., Zhang, Y., Li, Y., Zhang, Q., Ling, K. and Hu, J. (2012)
The BBSome controls IFT assembly and turnaround in cilia.
Nat. Cell Biol., 14, 950–957.
90. Wang, J. and Deretic, D. (2014) Molecular complexes that direct rhodopsin transport to primary cilia. Prog. Retin Eye Res.,
38, 1–19.
91. Zhang, Q., Yu, D., Seo, S., Stone, E.M. and Sheffield, V.C. (2012)
Intrinsic protein-protein interaction-mediated and chaperonin-assisted sequential assembly of stable Bardet–Biedl
syndrome protein complex, the BBSome. J. Biol. Chem., 287,
20625–20635.
92. Thomas, K.R. and Capecchi, M.R. (1987) Site-directed mutagenesis by gene targeting in mouse embryo-derived stem
cells. Cell, 51, 503–512.
93. Muyrers, J.P., Zhang, Y., Benes, V., Testa, G., Rientjes, J.M. and
Stewart, A.F. (2004) ET recombination: DNA engineering using
homologous recombination in E. coli. Methods Mol. Biol., 256,
107–121.
94. Yagi, T., Ikawa, Y., Yoshida, K., Shigetani, Y., Takeda, N.,
Mabuchi, I., Yamamoto, T. and Aizawa, S. (1990) Homologous
recombination at c-fyn locus of mouse embryonic stem cells
with use of diphtheria toxin A-fragment gene in negative
selection. Proc. Natl. Acad. Sci. U. S. A., 87, 9918–9922.
95. Nagy, A., Rossant, J., Nagy, R., Abramow-Newerly, W. and
Roder, J.C. (1993) Derivation of completely cell culturederived mice from early-passage embryonic stem cells. Proc.
Natl. Acad. Sci. U. S. A., 90, 8424–8428.
96. Frahm, J., Haase, A. and Matthaei, D. (1986) Rapid three-dimensional MR imaging using the FLASH technique. J. Comput.
Assist. Tomogr., 10, 363–368.
97. Keller, S.S. and Roberts, N. (2009) Measurement of brain volume using MRI: software, techniques, choices and prerequisites. J. Anthropol. Sci., 87, 127–151.
Downloaded from http://hmg.oxfordjournals.org/ at Periodicals Department , Hallward Library, University of Nottingham on July 6, 2015
73.
Meitinger, T., Brunner, H.G. et al. (2006) Mutations in the
CEP290 (NPHP6) gene are a frequent cause of Leber congenital
amaurosis. Am. J. Hum. Genet., 79, 556–561.
Burckle, C., Gaude, H.M., Vesque, C., Silbermann, F., Salomon,
R., Jeanpierre, C., Antignac, C., Saunier, S. and SchneiderMaunoury, S. (2011) Control of the Wnt pathways by
nephrocystin-4 is required for morphogenesis of the zebrafish pronephros. Hum. Mol. Genet., 20, 2611–2627.
Leightner, A.C., Hommerding, C.J., Peng, Y., Salisbury, J.L.,
Gainullin, V.G., Czarnecki, P.G., Sussman, C.R. and Harris, P.C.
(2013) The Meckel syndrome protein meckelin (TMEM67) is
a key regulator of cilia function but is not required for tissue
planar polarity. Hum. Mol. Genet., 22, 2024–2040.
Hynes, A.M., Giles, R.H., Srivastava, S., Eley, L., Whitehead, J.,
Danilenko, M., Raman, S., Slaats, G.G., Colville, J.G., Ajzenberg,
H. et al. (2014) Murine Joubert syndrome reveals Hedgehog
signaling defects as a potential therapeutic target for nephronophthisis. Proc. Natl. Acad. Sci. U. S. A., 111, 9893–9898.
Seo, S., Zhang, Q., Bugge, K., Breslow, D.K., Searby, C.C., Nachury, M.V. and Sheffield, V.C. (2011) A novel protein LZTFL1
regulates ciliary trafficking of the BBSome and Smoothened.
PLoS Genet., 7, e1002358.
Baye, L.M., Patrinostro, X., Swaminathan, S., Beck, J.S., Zhang,
Y., Stone, E.M., Sheffield, V.C. and Slusarski, D.C. (2011) The
N-terminal region of centrosomal protein 290 (CEP290)
restores vision in a zebrafish model of human blindness.
Hum. Mol. Genet., 20, 1467–1477.
Benmerah, A. (2013) The ciliary pocket. Curr. Opin. Cell Biol., 25,
78–84.
Wallingford, J.B. and Mitchell, B. (2011) Strange as it may
seem: the many links between Wnt signaling, planar cell
polarity, and cilia. Genes Dev., 25, 201–213.
Vladar, E.K., Bayly, R.D., Sangoram, A.M., Scott, M.P. and Axelrod, J.D. (2012) Microtubules enable the planar cell polarity of
airway cilia. Curr. Biol., 22, 2203–2212.
Jain, R., Pan, J., Driscoll, J.A., Wisner, J.W., Huang, T., Gunsten,
S.P., You, Y. and Brody, S.L. (2010) Temporal relationship between primary and motile ciliogenesis in airway epithelial
cells. Am. J. Respiratory Cell Mol. Biol., 43, 731–739.
Reiter, J.F., Blacque, O.E. and Leroux, M.R. (2012) The base of
the cilium: roles for transition fibres and the transition zone
in ciliary formation, maintenance and compartmentalization. EMBO Rep., 13, 608–618.
Wang, W.J., Tay, H.G., Soni, R., Perumal, G.S., Goll, M.G.,
Macaluso, F.P., Asara, J.M., Amack, J.D. and Tsou, M.F. (2013)
CEP162 is an axoneme-recognition protein promoting ciliary
transition zone assembly at the cilia base. Nat. Cell Biol., 15,
591–601.
Kee, H.L., Dishinger, J.F., Lynne Blasius, T., Liu, C.J., Margolis,
B. and Verhey, K.J. (2012) A size-exclusion permeability
barrier and nucleoporins characterize a ciliary pore
complex that regulates transport into cilia. Nat. Cell Biol., 14,
431–437.
Nachury, M.V., Seeley, E.S. and Jin, H. (2010) Trafficking to the
ciliary membrane: how to get across the periciliary diffusion
barrier? Annu. Rev. Cell Dev. Biol., 26, 59–87.
| 3791