Download Syntabulin, a motor protein linker, controls dorsal

Development Advance Online Articles. First posted online on 11 February 2010 as 10.1242/dev.046425
ePressatonline
publication date 11 February 2010
AccessDevelopment
the most recent version
http://dev.biologists.org/lookup/doi/10.1242/dev.046425
RESEARCH ARTICLE
1
Development 137, 0000-0000 (2010) doi:10.1242/dev.046425
© 2010. Published by The Company of Biologists Ltd
Syntabulin, a motor protein linker, controls dorsal
determination
Hideaki Nojima1, Sophie Rothhämel2, Takashi Shimizu1, Cheol-Hee Kim3, Shigenobu Yonemura4,
Florence L. Marlow2 and Masahiko Hibi1,5,*
SUMMARY
In amphibian and teleost embryos, the dorsal determinants (DDs) are believed to be initially localized to the vegetal pole and then
transported to the prospective dorsal side of the embryo along a microtubule array. The DDs are known to activate the canonical
Wnt pathway and thereby promote the expression of genes that induce the dorsal organizer. Here, by identifying the locus of the
maternal-effect ventralized mutant tokkaebi, we show that Syntabulin, a linker of the kinesin I motor protein, is essential for dorsal
determination in zebrafish. We found that syntabulin mRNA is transported to the vegetal pole during oogenesis through the Bucky
ball (Buc)-mediated Balbiani body-dependent pathway, which is necessary for establishment of animal-vegetal (AV) oocyte polarity.
We demonstrate that Syntabulin is translocated from the vegetal pole in a microtubule-dependent manner. Our findings suggest
that Syntabulin regulates the microtubule-dependent transport of the DDs, and provide evidence for the link between AV and
dorsoventral axis formation.
INTRODUCTION
During early vertebrate embryogenesis, the dorsal organizer plays
an important role in the formation of the dorsoventral (DV) and
anteroposterior (AP) body axes. The molecular mechanisms that
control the zygotic gene cascades that induce the organizer have
been elucidated (De Robertis, 2006; De Robertis et al., 2000;
Gerhart et al., 1989; Hibi et al., 2002; Schier and Talbot, 2005).
However, the mechanisms that initially specify the dorsal axis and
induce zygotic genes that are required for dorsal organizer formation
are not fully understood. In amphibian and teleost embryos,
specification of the dorsal axis begins soon after fertilization. In
Xenopus, the egg cortex rotates relative to the sperm entry point
during the first cell cycle (cortical rotation). During this process,
small particles and organelles are transported along a microtubule
array that is oriented with the plus ends towards the prospective
dorsal side (Elinson and Rowning, 1988; Houliston and Elinson,
1991). In zebrafish, the sperm enters at the animal pole. A parallel
microtubule array forms at the vegetal pole of the yolk ~20 minutes
post-fertilization (mpf) (Jesuthasan and Stahle, 1997). Disruption of
the microtubule array by treatment with nocodazol, cold or UV
irradiation prior to the 32-cell stage leads to loss of the dorsal
organizer and to the ventralization of embryos (Jesuthasan and
Stahle, 1997). Removal of the vegetal yolk mass at the early 1-cell
stage also results in severely ventralized embryos (Mizuno et al.,
1999; Ober and Schulte-Merker, 1999). These studies established
the hypothesis that the dorsal determinants (DDs) are initially
1
Laboratory for Vertebrate Axis Formation, RIKEN Center for Developmental Biology,
Hyogo 650-0047, Japan. 2Department of Developmental and Molecular Biology,
Albert Einstein College of Medicine, New York, NY 10461, USA. 3Department of
Biological Sciences and GRAST, Chungnam National University, Daejeion 305-764,
Korea. 4Electron Microscope Laboratory, RIKEN Center for Developmental Biology,
Hyogo 650-0047, Japan. 5Bioscience and Biotechnology Center, Nagoya University,
Nagoya 464-8601, Japan.
*Author for correspondence ([email protected])
Accepted 12 January 2010
localized to the vegetal pole and then transported along microtubules
to the prospective dorsal side, where they are incorporated by dorsal
blastomeres and promote dorsal organizer formation (see Fig. S1 in
the supplementary material). However, the molecular identity of the
DDs, and the mechanisms that localize them to the vegetal pole and
mediate their subsequent transport to the prospective dorsal
blastomeres, remain unknown.
Although the molecular nature of the DDs is not clear, they are
known to activate the canonical Wnt pathway, which leads to
nuclear accumulation of b-catenin. Activation of the canonical Wnt
pathway in Xenopus and zebrafish embryos results in ectopic
formation or expansion of the dorsal organizer, whereas its
inhibition impairs dorsal axis formation and reduces dorsal-specific
gene expression (reviewed by Hibi et al., 2002). These data place
canonical Wnt pathway function downstream of the DDs. In
zebrafish, the b-catenin accumulates in the nuclei of dorsal
blastomeres by the 128-cell stage and in the dorsal blastoderm and
dorsal yolk syncytial layer of mid-blastula stage embryos (Dougan
et al., 2003; Schneider et al., 1996). Thus, the DDs activate canonical
Wnt signaling in the dorsal blastomeres by the 128-cell stage. A bcatenin and Tcf/Lef complex is thought to regulate zygotic
expression of dorsal-specific genes, including the homeobox gene
dharma (dha, also known as bozozok) and the nodal-related gene
ndr1 (also known as squint) (Dougan et al., 2003; Leung et al., 2003;
Ryu et al., 2001; Shimizu et al., 2000a), which function in dorsal
organizer formation (Shimizu et al., 2000a; Sirotkin et al., 2000).
Thus, the DDs induce the expression of these dorsal-specific genes
through activation of the canonical Wnt pathway and thereby
promote dorsal organizer formation.
Genetic studies in zebrafish have revealed maternal factors that
are involved in dorsal determination. The recessive maternal-effect
mutant ichabod shows impaired maternal expression of b-catenin 2
(ctnnb2; one of two b-catenin genes in zebrafish), defective dorsal
organizer formation and severe ventralization (Bellipanni et al.,
2006; Kelly et al., 2000). The maternal-effect mutant brom bones,
which has a nonsense mutation disrupting hnRNP I (ptbp1a –
DEVELOPMENT
KEY WORDS: Dorsal determination, Syntabulin, Kinesin, Microtubules, Balbiani body, Bucky ball, Zebrafish
RESEARCH ARTICLE
Zebrafish Information Network), shows egg activation defects,
disorganized vegetal microtubule array formation, and subsequently
displays ventralization (Mei et al., 2009). Furthermore, a ubiquitin
ligase, tripartite motif-containing 36 (trim36), is localized to the
vegetal cortex of Xenopus oocytes, and when depleted causes
defective vegetal microtubule array formation and ventralization
(Cuykendall and Houston, 2009). Cumulatively, these data support
the hypothesis that microtubule-dependent transport of DDs plays
an essential role in canonical Wnt pathway activation and dorsal axis
determination in teleost and amphibian embryos.
The DDs are present at the vegetal pole of eggs prior to
fertilization and therefore achieve their vegetal pole localization
during oogenesis. In Xenopus and zebrafish oocytes, mRNAs
localize to the oocyte vegetal pole via overlapping transport
pathways. The early pathway involves recruitment of mRNAs,
including germline-specific transcripts to the Balbiani body (Kloc
et al., 2001; Kloc and Etkin, 1995; Kloc et al., 1996; Wilk et al.,
2005), an evolutionarily conserved aggregate of organelles and
molecules that is present in early oocytes (Guraya, 1979; Kloc et al.,
2004). Balbiani body formation is controlled by Bucky ball (Buc).
Oocytes lacking Buc function fail to localize mRNAs to the vegetal
pole in early and late stage oocytes, and show defective animalvegetal (AV) polarity (Bontems et al., 2009; Marlow and Mullins,
2008). However, the relationship between the Balbiani bodydependent RNA transport system and vegetal pole localization of the
DDs has not been fully elucidated.
The zebrafish maternal-effect recessive mutation tokkaebi (tkk)
affects the formation of dorsal structures (Nojima et al., 2004).
Embryos obtained from tkk homozygous females (tkk embryos)
show severely ventralized phenotypes. Accumulation of b-catenin
in the dorsal nuclei at mid-blastula stages is impaired in tkk embryos,
indicating that tkk functions upstream of activation or stabilization
of b-catenin in the maternal Wnt signaling pathway. In this report,
we show that the tkk locus encodes a zebrafish ortholog of
Syntabulin, a linker molecule that attaches cargo to the motor protein
kinesin I in neuronal axons (Cai et al., 2005; Cai et al., 2007; Su et
al., 2004). We demonstrate that syntabulin RNA is transported to the
vegetal pole during oogenesis through the Buc-mediated Balbiani
body-dependent pathway. We further show that Syntabulin protein
translocates from the vegetal pole in a microtubule-dependent
manner during early embryogenesis. Our findings suggest that
Syntabulin is involved in the vegetal pole localization and
microtubule-dependent transport of the DDs, and that Syntabulin
links oocyte AV polarity and embryonic DV polarity.
MATERIALS AND METHODS
Positional cloning
tkkrk4 homozygous fish were crossed with wild-type India fish (Knapik et
al., 1996) to generate F1 families. Homozygous tkkrk4 female fish were
raised from the F1 cross and identified based on the ventralized phenotypes
of their offspring. Since embryos from tkkrk4/rk4 female fish with India
genetic background show relatively mild phenotypes and low penetrance
(Nojima et al., 2004), phenotypic analysis was performed at least twice.
Genomic DNA from mutant females was used to carry out segregation
analyses with SSLP markers. z1543 on chromosome 16 was found to be
close to the tkk locus (one recombination event out of 280 meiosis). Using
the PCR primers for z1543 as a probe, BAC DKEY-97P23 was obtained.
Through BAC end sequencing and rescreening of BAC clones, seven BAC
clones (DKEY-22J10, 42F24, 9G17, 96G15, 71M14, 106H17, 97P23) were
found to cover the tkk locus (see Fig. 2A). Further linkage analyses revealed
that four BAC clones (DKEY-42F24, 9G17, 96G15, 71M14) contained the
tkk locus. The inserts in these BAC clones were sequenced by a shotgun
sequencing procedure and 12 genes were found in this region. The sequence
Development 137 (6)
and gene information in the region were also confirmed by the current
zebrafish genome data (http://www.sanger.ac.uk/Projects/D_rerio/).
Expression of the 12 candidate genes in ovary or in 1-cell stage embryos was
analyzed by RT-PCR (see Table S1 in the supplementary material). The
cDNAs of syntabulin and nine other maternally expressed candidates were
isolated from wild-type and tkk 1-cell stage embryos by RT-PCR and cloned
into pBluescript II SK+ (Stratagene). A 3⬘ terminal fragment of the insertion
in the syntabulin promoter was isolated by inverse PCR with primers 5⬘AGTATTTAATTCTGAACAAACAGAAC-3⬘ and 5⬘-GTGTGTTATGTAATATGCATTTTTAC-3⬘, as described (Kawakami et al., 2004). The
insertion was detected by PCR with primer1, 5⬘-GATCCATTCCCAACTTTATTTTCTCG-3⬘ and primer2, 5⬘-AGTATTTAATTCTGAACAAACAGAAC-3⬘ (see Fig. 2G). The cDNA, genomic and insert sequences of
zebrafish syntabulin were deposited in the DDBJ databank under the
accession numbers AB517946, AB517947 and AB517948, respectively. For
phenotypic analysis, tkk embryos were obtained from crosses of young
(3 month old) homozygous male and female fish in the TL genetic
background (Nojima et al., 2004). For time course analysis, in vitro
fertilization was performed (Westerfield, 1995). For studies of bucky ball
mutants, bucp106re (Dosch et al., 2004; Marlow and Mullins, 2008) and
bucp43bmtb (Bontems et al., 2009) alleles were used.
RT-PCR
Quantitative (q) RT-PCR analysis was conducted to examine the expression
of syntabulin, the other candidate genes and Wnt genes in wild-type and tkk
embryos, using an ABI Prism 7000 (Applied Biosystems) or LightCycler
480 (Roche) with Power SYBR Green PCR Master Mix (Applied
Biosystems) or SYBR Green I Master (Roche), respectively. Primers
used were: syntabulin, 5⬘-ATGGAGTTGGCGCAAAATG-3⬘ and 5⬘TCTTCGCCTCGGTAGAACTTTC-3⬘; zdhhc3, 5⬘-ATGAGCGTCAGAACAGCATGTG-3⬘ and 5⬘-AAGACGAGAAACCAGGTGATGATC-3⬘;
e(y)2, 5⬘-GTTGCTGGAGTTACTCCCAAAGG-3⬘ and 5⬘-GCGAGAAAGGCTCTTATTCTCTGA-3⬘; gapdh, 5⬘-GGATCTGACAGTCCGTCTTGAGA-3⬘ and 5⬘-TGCAGCCTTGACGACTTTCTT-3⬘; for primer
information for the other candidate genes, see Table S2 in the supplementary
material. All PCR assays were performed in triplicate. The relative mRNA
level of the averaged CT (cycle threshold, ABI Prism 7000) or CP (crossing
point, LightCycler 480) was quantified and normalized to gapdh. For
detection of syntabulin in wild-type and buc mutant oocytes (see Fig. 6),
ovaries were dissected from AB, bucp106re and bucp43bmtb mutant female fish.
Fifty stage I/II or III oocytes were manually sorted for RNA isolation and
cDNA preparation. qRT-PCR was carried out using the Realplex2 System
(Eppendorf) with Power SYBR Green PCR Master Mix. Primers used were:
syntabulin, 5⬘-CACACTGATGCTGTGCTGAA-3⬘ and 5⬘-TCCTGCGAGTGAATGAGAGA-3⬘; ef1a, 5⬘- AGCCTGGTATGGTTGTGACCTTCG3⬘ and 5⬘-CCAAGTTGTTTTCCTTTCCTGCG-3⬘. The relative mRNA
level of the averaged CT was quantified and normalized to ef1a.
In situ hybridization
Whole-mount in situ hybridization was performed as described previously
(Thisse and Thisse, 1998) except that hybridization was at 65°C. BM purple
AP substrate (Roche) was used as the substrate for alkaline phosphatase.
dharma (bozozok) (Yamanaka et al., 1998) and dusp6 (mkp3) detection was
as described previously (Tsang et al., 2004). For the syntabulin probe, the
3⬘UTR of syntabulin was amplified by PCR using the primers 5¢GCTCTAGATAGCGGCCCTCACCTACTTCTACAAC-3¢ and 5¢-ACGCGTCGACTTTTCCATGCTTTAATAATAAATATA-3¢. The BM purple
signals were acquired using an AxioPlan2 or AxioSkop2 microscope
equipped with an AxioCam CCD camera (Zeiss), or using an Olympus SZ16
fluorescence dissecting microscope with a Microfire digital camera
(Olympus). Images were processed in Photoshop (Adobe), Illustrator
(Adobe) and Canvas (ACD systems). In situ hybridization on slides was
essentially as described previously (Marlow and Mullins, 2008). To obtain
eggs, wild-type and mutant females were anesthetized in Tricaine as
described (Westerfield, 1995). Eggs were activated by adding embryo
medium, and then fixed with 4% paraformaldehyde (PFA) in phosphatebuffered saline (PBS) 2 or 5 minutes after activation.
DEVELOPMENT
2
Dorsal termination by a motor protein linker
Immunostaining
For b-catenin and Syntabulin staining, embryos were fixed with 4% PFA in
PBS for 24 hours at 4°C. For microtubule staining, embryos were fixed with
a microtubule-stabilizing buffer: 80 mM potassium Pipes pH 6.8, 5 mM
EGTA, 1 mM MgCl2, 3.7% formaldehyde, 0.25% glutaraldehyde, 0.2%
Triton X-100 (Schroeder and Gard, 1992). The dechorionated embryos were
washed with PBS containing 0.1% Triton X-100 (PBS-T) and blocked with
1% bovine serum albumin (BSA) in PBS-T for 1 hour. Detection of bcatenin was as described previously (Nojima et al., 2004), and the immune
complexes were visualized with diaminobenzidine (DAB, Sigma). For
detection of Syntabulin, the samples were incubated with anti-Syntabulin
antibody solution (anti-Syn1, 1/50 dilution of hybridoma supernatant; antiSyn2, 1/500 of hybridoma supernatant; anti-SynP, 1/500 of affinity-purified
antibody) at 4°C overnight. For detection of microtubules, the samples were
incubated with mouse monoclonal anti-b-tubulin antibody solution (1/1000,
Chemicon KMX-1). After four washes with PBS-T, the samples were
incubated with secondary antibodies [1/500, Alexa Fluor 555 goat antimouse or goat anti-rabbit IgG (H+L), Molecular Probes]. The DAB signals
(b-catenin) and fluorescent images (Syntabulin) were obtained by
AxioPlan2 imaging. Microtubule images were taken with an LSM5 Pascal
laser-scanning inverted microscope (Carl Zeiss) and constructed from
z-stack sections by a 3D projection program associated with the microscope.
RESEARCH ARTICLE
3
HRP-conjugated rabbit anti-rat IgG (H+L) (Zymed) or HRP-conjugated
anti-mouse IgG (Mouse TrueBlot, eBioscience) antibody, using a
chemiluminescence system (Western Lightning, Perkin Elmer Life Science).
For detection of Syntabulin in embryos, 200 embryos were lysed in 700 ml
of lysis buffer by grinding on ice. The lysates were cleared by centrifugation
and immunoprecipitated with anti-Syntabulin antibodies (1 ml of ascites of
monoclonal antibodies).
Treatment with microtubule inhibitors
Stock solutions of nocodazole (Sigma; 2 mg/ml in DMSO) and colchicine
(Sigma; 100 mg/ml in ethanol) were diluted to 1 mg/ml or 0.4 mg/ml,
respectively, in embryo medium (Westerfield, 1995). Embryos were placed
in inhibitor solutions with their chorion intact, just after in vitro fertilization,
for the times indicated.
Electron microscopy
Electron microscopy (see Fig. S2 in the supplementary material) was carried
out essentially as described previously (Shimizu et al., 2005; Yonemura et
al., 2002).
Statistics
Statistical analyses were performed by two-tailed Student’s t-test using
GraphPad Prism 5. P<0.01 was considered significant.
The Tol2 rescue plasmids were constructed using Gateway technology
(Invitrogen) in pT2KDest-RfaF, which is derived from pT2KXIG
(Kawakami et al., 2004). Further information about the plasmids is available
on request. The promoter of zona pellucida protein C (zpc), which is derived
from zp0.5GFP, was described previously (Onichtchouk et al., 2003). The
polyadenylation signal (pAS) is derived from pCS2+. GFP refers to
mmGFP5 derived from zp0.5GFP. Venus is a modified YFP and is derived
from pCS2+venus (Nagai et al., 2002). The 2A peptide sequence is derived
from porcine teschovirus-1 (PTV1) (Provost et al., 2007) and the DNA
fragment is generated with a synthesized oligonucleotide: 5⬘GTCGACGGATCAGGCGCTACGAATTTCTCGCTACTGAAGCAGGCTGGAGATGTAGAGGAAAACCCGGGACCGGCCATGG-3⬘(linkers are
underlined), which corresponds to GSGATNFSLLKQAGDVEENPGP. To
connect syntabulin and Venus with the 2A peptide sequence, the stop codon
of syntabulin was mutated to introduce a SalI site. The 2A peptide sequence
and Venus were linked at an NcoI site. To make transgenic fish, 25 pg of Tol2
transgene plasmid DNA and 25 pg of transposase RNA were injected into
1-cell stage embryos obtained from crosses of wild-type or relatively old tkk
pairs. Expression plasmids for 6⫻Myc-tagged Syntabulin and 3⫻HAtagged Kif5b were constructed in pCS2+.
Antibodies
To raise monoclonal and polyclonal antibodies against Syntabulin,
glutathione S-transferase (GST) fusion proteins containing amino acids 1498 (Syn1 antigen) or amino acids 102-271 (Syn2 antigen) of Syntabulin, or
a His-tagged protein containing amino acids 1-120 of Syntabulin were
generated in E. coli. The GST fusion and His-tagged proteins were purified
and used for immunization. For generating monoclonal antibodies, BALB/c
mice were immunized four or five times with ~50 mg of the proteins. Spleen
cells of the immunized mice were fused with the mouse myeloma line
Ag8.563, and hybridomas were obtained by conventional HAT selection.
Supernatants of growth-positive cells were subjected to enzyme-liked
immunosorbent assays (ELISAs) to identify hybridomas producing specific
antibodies. A polyclonal antibody (anti-SynP) was generated by immunizing
rabbits with the His-tagged protein six times. The antibody was purified
using an affinity column that was covalently conjugated to the antigen.
Transfection, immunoprecipitation and immunoblotting
HEK293T cells in a 6-cm dish were transfected using HilyMax (DOJINDO
Laboratories). The cells were lysed at 24 hours post-transfection in 1 ml of
lysis buffer: 10 mM HEPES-HCl pH 7.4, 150 mM NaCl, 1% NP40, 1 mM
EDTA, protease inhibitor cocktail (Nacalai). The lysates were precipitated
with anti-HA antibody (3F10, Roche), resolved by 5-20% SDS-PAGE
(SuperSep, Wako, Japan), and blotted with either anti-HA (3F10, Roche) or
anti-Myc (9E10, SantaCruz) antibodies. The proteins were detected with an
RESULTS
Positional cloning of the tokkaebi gene reveals a
novel role for Syntabulin in dorsal axis formation
tokkaebi (tkk) is a maternal-effect recessive mutation that disrupts a
gene required for dorsal axis formation in zebrafish. The progeny of
tkk homozygous females (tkk embryos) display severely ventralized
phenotypes, which are more severe in the TL genetic background
(Nojima et al., 2004). We reassessed the expression of the earliest
known zygotic dorsal-specific genes and nuclear accumulation of bcatenin in tkk embryos obtained after backcrossing with TL fish.
Approximately 80% of tkk embryos from young females showed
complete ventralization at the pharyngula stage [24 hours postfertilization (hpf); class C1, Fig. 1A]. In tkk embryos, expression of
the earliest known dorsal-specific genes dharma (dha) and dualspecificity phosphatase 6 [dusp6, also known as mitogen-activated
protein kinase phosphatase 3 (mkp3)], two direct targets of the
canonical Wnt pathway (Ryu et al., 2001; Tsang et al., 2004;
Yamanaka et al., 1998), was absent or strongly reduced at mid-tolate blastula stage (4 hpf, Fig. 1H-K). Dorsal accumulation of bcatenin at the 256-cell stage was observed in wild-type, but not in
tkk, embryos (Fig. 1F,G). A parallel microtubule array that is thought
to play an important role in dorsal determination (Jesuthasan and
Stahle, 1997) was present at the vegetal pole at 20 mpf in wild-type
(Fig. 1L) and in tkk (Fig. 1M) embryos. Electron microscopy
revealed a similar composition of organelles, including ribosomes
at the vegetal pole, of wild-type and tkk embryos at 20 mpf (see Fig.
S2 in the supplementary material), indicating that the vegetal yolk
is not significantly affected in tkk embryos. Together, these data
suggest that the tkk gene product is dispensable for vegetal pole
microtubule formation, but functions in early embryogenesis or
oogenesis to promote nuclear accumulation of b-catenin and
expression of zygotic genes required for dorsal organizer formation,
including dha.
To reveal how the tkk gene product contributes to dorsal
determination, we carried out positional cloning. We mapped the tkk
locus to a 600 kb region of chromosome 16 that contains 12 potential
open reading frames (Fig. 2A). Although ten of the 12 genes were
maternally expressed, none had a nonsense or missense mutation in
their coding region (see Table S1 in the supplementary material for
sequence information; data not shown). However, using qRT-PCR
DEVELOPMENT
Plasmid construction and transgenesis
4
RESEARCH ARTICLE
Development 137 (6)
genome (Fig. 2G and see Fig. S5 in the supplementary material).
The 3⬘ sequence of the insertion shows similarities to various
genome regions and to the pol-like protein of snail and Drosophila
retrotransposons (accession numbers ABN58714, AAA70222) at
the amino acid level, implying that the insertion is a transposable
element. Our expression data suggest that this insertion in the
promoter region strongly suppresses transcription of the syntabulin
gene.
analysis, we found that the maternal expression of one candidate
gene was strongly reduced in tkk embryos (Fig. 2B and see Table S1
in the supplementary material). The gene encodes the zebrafish
ortholog of Syntabulin (Su et al., 2004), based on strong sequence
similarity to human syntabulin (see Fig. S3 in the supplementary
material) and on synteny between the tkk chromosomal region in
zebrafish and the human syntabulin chromosomal region
(chromosome 8, data not shown).
Expression of zebrafish syntabulin remained strongly reduced at
24 hpf in tkk as compared with wild-type embryos (see Fig. S4 in the
supplementary material). Whole-mount in situ hybridization
revealed vegetal pole localization of syntabulin mRNA in wild-type
eggs and embryos through the 16-cell stage (Fig. 2C-E see Fig. S4
in the supplementary material), and its absence in tkk eggs and
embryos (Fig. 2F). By genomic PCR and Southern blot analyses, we
found an insertion in the syntabulin promoter region (232 bp
upstream of the transcription initiation site) in the tkk mutant
Exon-intron structure of syntabulin is required for
vegetal pole localization and proper dorsal
determination
The 3⬘ UTR of germline-specific mRNAs, such as vasa, nanos and
dazl, is necessary and sufficient for their vegetal pole localization
(Kosaka et al., 2007). In tkk embryos rescued by maternal
expression of syntabulin mRNA containing the first intron and 3⬘
UTR, the mRNA was not vegetally restricted, but was instead
distributed throughout the embryos (Fig. 3E,F). Furthermore,
EGFP-3⬘ UTR RNA was not localized to the vegetal pole in
transgenic wild-type or tkk zygote-stage embryos (Fig. 4A-E).
These data suggest that the 3⬘ UTR of syntabulin is not sufficient
for its vegetal pole localization. In Drosophila oocytes, oskar
mRNA localization at the posterior pole, which is required for
oogenesis, is controlled in part by splicing (Hachet and Ephrussi,
2004). Therefore, we examined whether the exon-intron structure
of the syntabulin gene is required for the vegetal localization of
DEVELOPMENT
Fig. 1. Maternal-effect tokkaebi (tkk) mutant zebrafish embryos
show defects in dorsal determination. (A-E) Phenotypes of tkk
embryos (A-D) versus wild type (WT; E) at 24 hpf. Lateral views with
dorsal to the right (A-D) or to the top (E). Embryos were classified into
four classes (C1-4) based on their ventralized phenotypes. C1 embryos
displayed a completely ventralized phenotype. C2 embryos were similar
to C1 embryos but had somites in the trunk region. C3 embryos had
somites and spinal cord in the trunk. C4 embryos had somites, spinal
cord and hindbrain, but lacked notochord or neuroectoderm anterior to
the midbrain. The percentage of tkk embryos from typical young
females that showed each phenotype is indicated.
(F,G) Immunostaining of b-catenin at the 256-cell stage in wild-type
(F; 88%, n=26) and tkk (G; 11%, n=35) embryos. Dorsal views. Arrows
indicate nuclear accumulation of b-catenin in dorsal blastomeres.
(H,I) Expression of dha at sphere stage (4 hpf) in wild-type (H; 100%,
n=36) and tkk (I; 8%, n=40) embryos. (J,K) Expression of dusp6 at
sphere stage in wild-type (J; 100%, n=29) and tkk (K; 6%, n=36)
embryos. Animal pole views. (L,M) Immunostaining with anti-b-tubulin
antibody. Wild-type (L; 86%, n=14) and tkk (M; 81%, n=16) embryos
at 20 mpf. Vegetal pole views. Scale bars: 200 mm in A-E,H-K; 140 mm
in F,G; 20 mm in L,M.
Maternal Syntabulin is sufficient to rescue
ventralization of tkk mutant progeny
To address whether the strong reduction of syntabulin expression
causes the ventralization of tkk embryos, we attempted to rescue
the mutant phenotype by injecting syntabulin mRNA into 1-cell
stage embryos. Supplying syntabulin after egg activation was not
sufficient to rescue ventralization in tkk mutant progeny (data not
shown). The failure of these rescue attempts, and the localization
of syntabulin transcripts at the vegetal pole of early embryos (Fig.
2C-E), suggest that Syntabulin functions in the zygote during
early cleavage stages or earlier during oogenesis. With this in
mind, we generated transgenic fish that express syntabulin in tkk
oocytes (Fig. 3). We constructed the rescue plasmid in the Tol2
vector (Kawakami et al., 2004) to contain the syntabulin cDNA,
the first intron and 3⬘ UTR, GFP, and the zona pellucida protein
C (zpc; zpcx) promoter, which drives maternal expression
(Onichtchouk et al., 2003) (Fig. 3A). The rescue plasmid and
transposase RNA were injected into embryos obtained from
crosses of relatively old tkk homozygotes, the offspring of which
show only mild, or no, ventralized phenotypes (Nojima et al.,
2004). These fish were raised to adulthood (see Fig. S6 in the
supplementary material). Maternal expression of the transgene
was observed in a subset of progeny from these tkk mutant
females based on GFP visualization at the 1-cell stage, prior to
activation of zygotic gene expression. In total, from three crosses
80.7% of GFP-negative (non-transgenic) tkk embryos were
completely ventralized, and only 9.3% showed morphologically
normal DV patterning (Fig. 3B) at 24 hpf. By contrast, in the
GFP-positive (transgenic) class, only 43.7% of the embryos were
completely ventralized, whereas 40.3% displayed normal DV
patterning (Fig. 3B). dha expression was also restored in
transgenic tkk embryos (Fig. 3C,D). These data indicate that
maternal syntabulin rescues the tkk axis defects, and provide
evidence that reduced syntabulin expression in oocytes causes
ventralization of tkk progeny.
Dorsal termination by a motor protein linker
RESEARCH ARTICLE
5
syntabulin mRNA in zebrafish. The syntabulin gene is composed
of five exons and four introns (Fig. 4F). We constructed a rescue
plasmid that contains all the exons and introns, and inserted the 2A
peptide sequence of porcine teschovirus-1 (PTV1) and Venus (a
YFP variant) cDNA between the coding region and the 3⬘ UTR
(Fig. 4G). Transgenic embryos were generated by co-injection
with transposase RNA (see Fig. S6 in the supplementary material).
Of Venus-negative (non-transgenic) tkk embryos, 78.3% showed
complete ventralization and 13% showed normal DV patterning,
whereas only 30.1% of Venus-positive (transgenic) tkk embryos
displayed complete ventralization and 59.4% displayed normal
DV patterning (Fig. 4H). This result indicates that this exon/introncontaining plasmid rescued the tkk phenotypes more efficiently
than the plasmid containing the cDNA, first intron and 3⬘ UTR.
This rescue was also more efficient than that by a plasmid
containing the cDNA and 3⬘ UTR (data not shown). dha expression
was also more efficiently restored by this plasmid, compared with
the cDNA plus first intron and 3⬘ UTR construct (Fig. 4I,J).
Furthermore, more syntabulin mRNA was localized to the vegetal
pole in tkk embryos rescued by this plasmid (asterisk in Fig. 4K
versus 4L as a control). These findings indicate that the exonintron structure is required for vegetal pole localization and proper
function of syntabulin.
Microtubule-dependent transport of Syntabulin
Syntabulin is a linker protein that attaches cargo to kinesin I, and in
neurons Syntabulin functions in cargo transport to the synaptic
terminal along microtubules (Cai et al., 2005; Cai et al., 2007; Su et
al., 2004) (see Fig. S3 in the supplementary material). We found that
kif5b, which encodes the heavy chain of kinesin I, is expressed in
zebrafish oocytes (see Fig. S7 in the supplementary material). When
HA-tagged Kif5b and Myc-tagged Syntabulin were co-expressed in
human embryonic kidney (HEK) 293T cells, Syntabulin coimmunoprecipitated with Kif5b (Fig. 5A). These data indicate that
zebrafish Syntabulin can interact with the motor protein kinesin I
that functions to transport cargo along microtubules.
We next examined the localization of Syntabulin protein. We
raised one polyclonal and two monoclonal antibodies against
Syntabulin (see Fig. S8 in the supplementary material). All the
antibodies detected Syntabulin at the vegetal pole in the wild type
but not in tkk embryos from just after fertilization through 20 mpf
(Fig. 5B-G and see Fig. S8C,D in the supplementary material). After
20 mpf, when microtubule array formation occurs at the vegetal pole
(Jesuthasan and Stahle, 1997), Syntabulin redistributed to one side
of the vegetal pole (Fig. 5H-J). This biased localization of
Syntabulin was detected through 50 mpf (the 2-cell stage, Fig. 5J).
Furthermore, Syntabulin remained at the vegetal pole in embryos
DEVELOPMENT
Fig. 2. syntabulin is responsible for the tkk mutant phenotype. (A) Linkage mapping. The zebrafish tkk locus was initially mapped near the
SSLP marker z1543. Seven BAC clones were used to construct a physical map. Linkage analysis (numbers indicate recombinants per meiosis),
sequence analysis of BAC clones and database searches revealed that there were 12 candidate genes in the chromosomal region. (B) Quantification
of syntabulin (gene 6 in A) expression in wild-type and tkk embryos (expression in wild type taken as 100; *, P<0.01; the average ±s.d. is shown).
zdhhc3 (zinc-finger, DHHC-type containing 3, gene 3) and e(y)2 (enhancer of yellow gene, gene 8) are located in the same chromosomal region as
syntabulin and were used as controls. The expression of other genes in this chromosomal region is shown in Table S1 in the supplementary material.
(C-F) Expression and localization of syntabulin RNA in an unfertilized wild-type egg (5 minutes after activation, C), in a 1-cell stage wild-type embryo
(20 mpf, D), an 8-cell stage wild-type embryo (E), and in a 1-cell stage tkk embryo (F). Lateral views; A, animal pole; Vg, vegetal pole. (G) Molecular
nature of the syntabulintkk4 allele. PCR detection of the insertion in wild-type and tkk embryos (n=3 each). Scale bars: 200 mm.
6
RESEARCH ARTICLE
Development 137 (6)
Fig. 3. Maternal expression of syntabulin rescues tkk mutants.
(A) Structure of the rescue plasmid. Tol2, inverted repeats of Tol2
transposon; zpc, promoter of zone pellucida protein C; 3⬘ UTR, 3⬘
untranslated region; pAS, polyadenylation signal. (B) Rescue by
syntabulin cDNA transgene. The numbers of transgenic (green) and
non-transgenic (orange) zebrafish embryos showing each phenotype
are tabulated, and the percentages are shown in the bar chart.
(C,D) Expression of dha in tkk (D; 8%, n=25) and transgene-rescued
(C, GFP+; 48%, n=33) embryos at the late blastula stage.
(E,F) Localization of syntabulin at the 1-cell stage in a transgenerescued (E; 67%, n=27) versus control (F; 100%, n=23) embryo. Scale
bars: 200 mm.
syntabulin RNA is transported to the vegetal pole
through the Buc-mediated Balbiani bodydependent pathway
Some vegetal RNAs, including germline-specific gene products, are
transported to the vegetal pole through the Balbiani body (Kloc et
al., 2001; Kloc and Etkin, 1995; Kloc et al., 1996; Wilk et al., 2005),
which requires maternal Buc function for its formation (Bontems et
al., 2009; Marlow and Mullins, 2008). As syntabulin mRNA
localizes to the vegetal pole of eggs and early embryos, we
investigated when syntabulin achieves its vegetal pole localization
and whether this involves the Buc-mediated Balbiani bodydependent pathway in oocytes. During oogenesis, syntabulin mRNA
was detected in the Balbiani body of wild-type stage Ib oocytes
(compare Fig. 6A with 6B,E), but was not localized in buc mutant
oocytes (Fig. 6C,D,F). This was not due to reduced expression or
degradation of syntabulin mRNA, as similar levels were detected by
qRT-PCR in wild-type and buc mutant stage I-III oocytes (Fig. 6G).
In unfertilized buc mutant eggs, syntabulin mRNA showed
circumferential localization, indicating that the later localization of
Fig. 4. Exon-intron structure of syntabulin is required for vegetal
localization and proper dorsal determination. (A-E) The 3⬘ UTR is
not sufficient for vegetal localization of syntabulin. (A) Structure of the
transgene plasmid. (B-E) Localization of GFP mRNA in transgenic (B,D)
or non-transgenic (C,E) tkk (D,E) or wild-type (B,C) zebrafish embryos at
the 1-cell stage (20 mpf). (F,G) Genomic structure of syntabulin (F) and
the rescue plasmid that contains the exon-intron structure of
syntabulin. 2A-peptide, 2A peptide of PTV1. (H) Rescue by genomic
DNA. The numbers (tabulated) and percentages (bar chart) of
transgenic (green) and non-transgenic (orange) embryos showing each
phenotype. (I,J) Expression of dha in tkk (J; 9%, n=32) and rescued (I;
66%, n=33) embryos at the late blastula stage. (K,L) Localization of
syntabulin at the 1-cell stage in a rescued (K; 86%, n=35) versus control
(L; 100%, n=31) embryo. Shown are animal pole views (I,J) and lateral
views (A-E,K,L). Vegetal pole localization is marked by an asterisk (K).
Scale bars: 200 mm.
syntabulin to the vegetal pole depends on its proper localization in
the Balbiani body of early oocytes (Fig. 6H-J). These data suggest
that vegetal pole localization of syntabulin mRNA is mediated
through the Buc-mediated Balbiani body-dependent pathway, which
is essential for AV polarity in oocytes.
DISCUSSION
Buc-mediated Balbiani body-dependent transport
of syntabulin RNA
syntabulin mRNA localization to the vegetal pole of unfertilized
eggs and early stage embryos is established during oogenesis (Fig.
2C-E and Fig. 6). In early stage wild-type oocytes, syntabulin
transcripts localize to the Balbiani body (Fig. 6B,E). Balbiani body
localization of syntabulin mRNA was disrupted in buc mutant
oocytes (Fig. 6I,J), which lack the Balbiani body and show aberrant
localization of vegetal RNAs during establishment of oocyte AV
polarity (Bontems et al., 2009; Dosch et al., 2004; Marlow and
Mullins, 2008). These data indicate that, after syntabulin RNA is
transcribed, it is transported to the vegetal pole through the Balbiani
DEVELOPMENT
treated with nocodazole or colchicine, which are inhibitors of
microtubule formation (Fig. 5M-Q), indicating that Syntabulin
translocation is microtubule dependent. After 60 mpf, Syntabulin
was not detected by whole-mount immunohistochemistry (Fig. 5K),
nor in whole embryonic lysates by immunoprecipitation and
immunoblotting (Fig. 5L), although syntabulin mRNA persisted at
the vegetal pole through the 16-cell stage (90 mpf, Fig. 2E and see
Fig. S4A in the supplementary material). These data indicate that the
inability to detect Syntabulin after 60 mpf was most likely due to its
degradation, rather than to protein diffusion or a decline in
syntabulin mRNA abundance. Together, our findings reveal that the
localization and stability of Syntabulin are tightly controlled after
fertilization until the protein is no longer detected around the 2-cell
stage.
Fig. 5. Microtubule-dependent transportation of Syntabulin.
(A) Interaction between Syntabulin and Kif5b. HEK293T cells were
transfected with expression vectors of Myc-tagged Syntabulin and HAtagged Kif5b. IP, immunoprecipitation; IB, immunoblotting.
(B-E) Detection of Syntabulin with anti-Syntabulin monoclonal
antibodies (anti-Syn1, anti-Syn2) in wild-type and tkk zebrafish embryos
at early zygote stage (10 mpf). Expression of Syntabulin at the animal
pole (asterisks in D,E) is non-specific as it is detected in tkk embryos,
which lack significant amounts of Syntabulin (see Fig. S8C in the
supplementary material). (F-K) Time course of Syntabulin localization in
the wild type. Immunostaining with anti-Syn1. (L) Immunoblotting of
anti-Syntabulin (anti-Syn2) immunoprecipitates. (M-O) Localization of
Syntabulin at 45 mpf in wild-type embryos treated with 1 mg/ml
nocodazole (N) or 0.4 mg/ml colchicine (O) just after fertilization, versus
untreated control (M). (P,Q) Quantification of Syntabulin localization at
45 mpf showing lopsided or vegetal pole localization, or undetectable
expression in embryos treated with nocodazole (P) or colchicine (Q),
versus control (P,Q). Shown are lateral views with animal pole to the
top. Scale bars: 200 mm.
body pathway during oogenesis (Fig. 7). The Balbiani bodydependent RNA transport system is shared by germline-specific
RNAs (Kloc et al., 2001; Kloc and Etkin, 1995; Kloc et al., 1996;
Kosaka et al., 2007; Wilk et al., 2005). Despite their common
localization in early oocytes, important differences exist between
syntabulin and germline-specific mRNA localization in late stage
oocytes and in embryos. First, after the initial localization of
germline-specific mRNAs to the Balbiani body during oogenesis,
some of these transcripts, such as dazl (Maegawa et al., 1999;
Kosaka et al., 2007), remain at the vegetal pole, whereas others, such
RESEARCH ARTICLE
7
Fig. 6. Balbiani body-mediated localization of syntabulin at the
vegetal pole. (A-D) Localization of syntabulin RNA in wild-type and
bucky ball mutant (bucp106 and bucp43) stage Ib (STI/Ib) zebrafish
oocytes. Staining by whole-mount in situ hybridization with sense (A,
control) or antisense (B-D) riboprobes. In wild-type oocytes, syntabulin
RNA localizes to the Balbiani body (A,B; 84%, n=104). In bucp106 (C;
97%, n=87 oocytes from three females) and bucp43 (D; 100%, n=36
from one female) mutant oocytes, syntabulin is not spatially restricted
or localized. (E,F) Localization of syntabulin RNA. In wild-type oocytes
(E), syntabulin localizes to the Balbiani body, whereas syntabulin is
detected throughout the cytoplasm in bucp106 mutants (F; 100%, n=27
from one female). (G) Quantification of syntabulin expression in wildtype and buc oocytes. Although syntabulin is not localized in buc
mutants, the transcripts are present in early and late stage oocytes.
(H-J) Localization of syntabulin RNA in wild-type and buc activated
eggs. In activated eggs from wild type, syntabulin shows polarized
localization (H; 100% n=37 from two females). In activated eggs from
bucp106 (I; 100%, n=44 from three females) and bucp43 (J; 100%, n=8
from one female) mutants, syntabulin is detected around the
circumference. Arrows indicate localization of syntabulin at the vegetal
pole in wild type and its circumferential expansion in buc eggs. nuc,
nucleus; Bb, Balbiani body. Scale bars: 50 mm.
as vasa (Knaut et al., 2000), redistribute around the circumference
of the oocyte cortex or, such as nanos (Draper et al., 2007), are found
throughout late stage oocytes. Despite their distinct positions in late
stage oocytes, the germline-specific mRNAs are transported to the
animal pole during egg activation, and subsequently localize to the
distal ends of the blastomere cleavage furrows, where germ plasm
is thought to be present during early cleavage stages (Hashimoto et
al., 2004; Kosaka et al., 2007; Maegawa et al., 1999; Suzuki et al.,
2000). By contrast, syntabulin mRNA remained at the vegetal pole
until the 16-cell stage, and was not transported to the cleavage
furrows or to the primordial germ cells (Fig. 2E and see Fig. S4 in
the supplementary material). Second, whereas the 3⬘ UTR is
sufficient for localization of germline-specific mRNAs to the vegetal
pole (Kosaka et al., 2007), the 3⬘ UTR of syntabulin was not
sufficient for its vegetal localization (Figs 3 and 4). Therefore,
although both syntabulin and the germline-specific mRNAs rely on
the Balbiani body for transport to the vegetal pole, they may utilize
distinct mechanisms for later aspects of their localization.
In Drosophila oocytes, posterior localization of oskar mRNA
requires elements within its 3⬘ UTR and proper splicing, and occurs
by a mechanism that is proposed to involve the exon-exon junction
complex (EJC), which includes the nuclear shuttling proteins
DEVELOPMENT
Dorsal termination by a motor protein linker
RESEARCH ARTICLE
Fig. 7. The role of Syntabulin in dorsal determination in
zebrafish. During oogenesis, syntabulin RNA is transported from the
nucleus to the vegetal pole through the Buc-mediated Balbiani bodydependent pathway. During early embryogenesis, Syntabulin links the
dorsal determinants (DDs) to Kif5B, the heavy chain of kinesin I. At 20
mpf, a microtubule array forms and Syntabulin transports the DDs to
the plus end of microtubules. Around the 2-cell stage (60 mpf),
Syntabulin is degraded and releases the DDs, which are eventually
incorporated by dorsal blastomeres and activate zygotic gene
expression cascades required for the formation of the dorsal organizer.
Tsunagi (Y14) and Mago nashi (Hachet and Ephrussi, 2004).
syntabulin mRNA produced from the transgene containing the exonintron structure and 3⬘ UTR was more enriched at the vegetal pole
than RNA from the transgene containing the cDNA, first intron and
3⬘ UTR (Figs 3 and 4), suggesting that splicing of syntabulin RNA,
and its Buc-mediated Balbiani body-dependent transport, also
involve EJC components. syntabulin mRNA expressed from the
transgene containing the full genomic structure of syntabulin, except
the promoter and enhancer, was localized to the vegetal pole, but
was also detected within the blastoderm (Fig. 4K). This is possibly
due to the presence of the 2A peptide sequence and the Venus cDNA
between the coding region and the 3⬘ UTR, which might affect the
structure of nascent syntabulin mRNA and its transport.
Alternatively, proper expression levels of syntabulin RNA might be
required for its vegetal localization; for example, if components that
localize or tether syntabulin to the vegetal pole are limiting. Future
studies will reveal the precise molecular mechanisms that control
the vegetal pole localization of syntabulin RNA.
The link between AV oocyte polarity and DV axis
formation
The DDs initially localize to the vegetal pole of embryos. It is
anticipated that AV oocyte polarity is linked to dorsal determination,
although this possibility has not been formally tested. We show that
syntabulin gene products, which are necessary for dorsal
determination, localize to the vegetal pole in a Buc-mediated
Balbiani body-dependent manner. Our findings provide evidence
that links early AV polarity in oocytes to DV embryonic axis
formation. Since Syntabulin functions as a cargo linker (Cai et al.,
2005; Cai et al., 2007; Su et al., 2004), we hypothesize that
Syntabulin localizes the DDs to the vegetal pole during oogenesis
and/or in early stage zygotes (Fig. 7).
Development 137 (6)
When tkk embryos were rescued with the plasmid containing the
cDNA, first intron and 3⬘ UTR of syntabulin, the transgene-derived
RNA was not enriched at the vegetal pole (Fig. 3E), implying that
vegetal pole localization of syntabulin RNA is not strictly required
for dorsal determination. Alternatively, because syntabulin RNA
was present throughout the embryo, it is possible that the amount of
syntabulin RNA at the vegetal pole was sufficient for dorsal
determination. Moreover, the rescue data suggest that additional
factors contribute to localizing the DDs to the vegetal pole.
Importantly, RNA from the plasmid containing the syntabulin exonintron structure was enriched at the vegetal pole and rescued the tkk
phenotypes more efficiently (Fig. 4K). Therefore, vegetal
localization of syntabulin RNA might ensure that Syntabulin protein
is positioned to localize the DDs at the vegetal pole to facilitate their
robust transport to the prospective dorsal side.
Recently, a Balbiani body-localized ubiquitin ligase, Trim36,
was identified that regulates microtubule polymerization or
stability in the vegetal cortex of Xenopus (Cuykendall and
Houston, 2009). Depletion of Trim36 leads to ventralization in
Xenopus embryos (Cuykendall and Houston, 2009). Notably, like
other Balbiani-localized transcripts, trim36 associates with the
germ plasm in Xenopus embryos (Cuykendall and Houston,
2009). Our data identify syntabulin as a novel Balbiani bodylocalized mRNA. We find that unlike other Balbiani bodylocalized mRNAs, syntabulin is not a component of germ plasm
in embryos, but instead mediates localization and transport of the
DDs.
Role of Syntabulin in dorsal determination
Removal of the vegetal yolk or disruption of microtubule array
formation during zygote or early cleavage stages perturbs the
development of dorsal structures in zebrafish (Jesuthasan and Stahle,
1997; Mizuno et al., 1999; Ober and Schulte-Merker, 1999). These
studies established the hypothesis that the DDs, initially localized to
the vegetal pole, are subsequently transported to the prospective
dorsal side along microtubules, where they are incorporated by
dorsal blastomeres. We show that Syntabulin, an essential factor for
dorsal determination in zebrafish, is initially localized to, and later
translocates from, the vegetal pole (Fig. 5B-K). Syntabulin functions
as a kinesin I motor protein linker that transports cargo from the
soma to the presynaptic terminal of neuronal axons along
microtubules towards their plus ends (Cai et al., 2005; Cai et al.,
2007; Su et al., 2004). We demonstrate that zebrafish Syntabulin can
interact with zebrafish Kif5b, a maternally expressed kinesin I heavy
chain (Fig. 5A and see Fig. S7 in the supplementary material).
Translocation of Syntabulin from the vegetal pole was microtubule
dependent (Fig. 5B-K). Together, our results strongly suggest that
Syntabulin links the DDs to kinesin I to mediate their initial vegetal
pole localization and subsequent transport to the prospective dorsal
side along the microtubule array that emanates from the vegetal pole
(Fig. 7).
Our results revealed that although maternal syntabulin RNA
persisted through the 16-cell stage, Syntabulin protein was absent
from around the 2-cell stage (Fig. 5K,L). It is unlikely that
translation of Syntabulin is suppressed in this limited period. We
favor the hypothesis that Syntabulin protein is degraded around the
2-cell stage. The rapid degradation of Syntabulin protein temporally
coincides with stages when dorsalizing activity vacates the vegetal
yolk (Mizuno et al., 1999; Ober and Schulte-Merker, 1999),
indicating a possible mechanism whereby Syntabulin first positions
the DDs and subsequently releases them from the vegetal
microtubules following its own degradation (Fig. 7).
DEVELOPMENT
8
How are the DDs transported to the dorsal blastomeres after
their release from Syntabulin protein? Inhibition of microtubule
formation at 8- or 16-cell stages leads to defective organizer
formation (Jesuthasan and Stahle, 1997). Vegetal microtubules are
only transiently detected in zygotes before the first cleavage, but
are not detected at the 8- or 16-cell stage (Jesuthasan and Stahle,
1997). At these later stages, long microtubule arrays emanate
from the marginal blastomeres (Jesuthasan and Stahle, 1997;
Solnica-Krezel and Driever, 1994). Whether these microtubule
arrays contribute to DD transport to the dorsal blastomeres
requires further study. Our findings reveal two steps in DD
transport from the vegetal pole to the dorsal blastomeres. Initially,
the DDs are localized within the vegetal yolk. The first phase
involves asymmetric translocation of the DDs via the vegetal
microtubules, followed by their release from the vegetal portion
of the yolk. Second, the DDs are transported to, and incorporated
by, the prospective dorsal blastomeres. Syntabulin is essential for
the first phase of DD transport (Fig. 7).
Dorsal determinants
In zebrafish, transcripts of the nodal-related gene ndr1 localize
asymmetrically in a microtubule-dependent manner, which predicts
the dorsal side of the embryos, and antisense morpholino-mediated
knockdown of ndr1 affects the formation of dorsal structures (Gore
et al., 2005). In contrast to syntabulin transcripts, which are
localized to the vegetal pole of early oocytes and embryos, ndr1
mRNA is uniformly distributed throughout oocytes and localizes to
the animal pole during egg activation before the first cleavage
(Gore and Sampath, 2002). During this time in development,
syntabulin mRNA and protein remain in the vegetal yolk (Fig. 2C,E
and Fig. 6). Later, during early cleavage stages, ndr1 mRNA
localizes asymmetrically within the blastomeres of the 2- to 4-cell
stage embryo (Gore et al., 2005). At this time, maternal Syntabulin
protein is no longer detected in the embryo (Fig. 5J,K). Moreover,
asymmetric localization of ndr1 is b-catenin independent (Gore et
al., 2005), and Nodal signaling is not required before the midblastula transition (Hagos and Dougan, 2007; Hagos et al., 2007),
after b-catenin is detected in the nuclei of dorsal blastomeres (Fig.
1) (Dougan et al., 2003). Although it is possible that Syntabulin is
involved in ndr1 mRNA transport, the reports discussed above and
our spatial-temporal analysis of Syntabulin localization and
function suggest that the mechanisms that mediate the translocation
of ndr1 and the Wnt pathway-activating DDs are distinct. The
notion that distinct mechanisms contribute to translocation of the
DDs and ndr1 is compatible to a model whereby Syntabulin
transports the DDs to activate b-catenin, which then induces
essential zygotic regulators of axis formation, including ndr1
(Bennett et al., 2007; Dougan et al., 2003; Shimizu et al., 2000b).
In Xenopus, maternal Wnt11 and Wnt5a function in dorsal
determination (Cha et al., 2008; Tao et al., 2005). wnt11 mRNA
localizes to the Balbiani body (Kloc and Etkin, 1995) and to the
vegetal pole (Ku and Melton, 1993) of Xenopus oocytes. Wnt11
protein is enriched dorsally in cleavage-stage Xenopus embryos
(Schroeder et al., 1999). Depletion of maternal wnt11 from late
stage Xenopus oocytes leads to dorsal axis defects (Tao et al.,
2005). In zebrafish, expression of wnt11/wnt11r and wnt5a/b
genes is weak or below detection in 1-cell stage embryos, as
compared with gastrula and/or pharyngula stages (see Fig. S9 in
the supplementary material) when these Wnts function in cell
migration (Heisenberg et al., 2000; Matsui et al., 2005; Rauch et
al., 1997). Maternal zygotic wnt11 (silberblick) mutant embryos
do not exhibit disrupted DV axis formation (Heisenberg et al.,
RESEARCH ARTICLE
9
2000). Injection of wnt5a/b and/or wnt11/11r RNA just after
fertilization impairs gastrulation movements (data not shown), but
neither affected dha expression in wild-type embryos nor rescued
dha expression in tkk embryos (see Fig. S10 in the supplementary
material), suggesting negligible contributions of these Wnts to
Syntabulin-mediated dorsal determination. Furthermore,
overexpression of the Wnt signaling components Dishevelled 3
(Dvl3), Glycogen synthase kinase (Gsk) binding protein (Gbp),
dominant-negative Axin1 or dominant-negative Gsk3b rescued
and/or induced hyper-dorsalization in tkk embryos; by contrast,
Wnt8, Wnt3a or Frizzled 8b did not efficiently dorsalize tkk
embryos (Nojima et al., 2004). These data suggest that Syntabulin
functions downstream of Wnt receptors and upstream of bcatenin, in agreement with the hypothesis that Syntabulin does not
transport Wnt RNAs or proteins. In Xenopus, Dishevelled (Dvl)
and Gbp undergo microtubule- and/or motor protein-dependent
transport and contribute to dorsal axis determination (Miller et al.,
1999; Weaver et al., 2003; Yost et al., 1998). In early zebrafish
embryos, biased localization of Dvl2, Dvl3 and Gbp was not
detected (data not shown). Therefore, zebrafish and Xenopus may
utilize different DDs, or there are DDs that are shared among
vertebrate species that remain to be discovered. In either case, the
answer to this question requires the isolation and identification of
the DDs. As a linker protein that attaches cargo, presumably
including the DDs, to kinesin I, Syntabulin might facilitate
identification of the elusive DDs.
In summary, the regulation of dorsal determination via
microtubule dynamics and association with motor and adaptor
proteins is shared among zebrafish and amphibians. Our findings
provide a missing component of the microtubule-dependent DD
transport machinery. Moreover, our finding that syntabulin, an
essential regulator of dorsal axis formation, relies on early AV
oocyte polarity for its localization provides new insight into the link
between the first embryonic axis and dorsal determination in
zebrafish.
Acknowledgements
We thank K. Kawakami for the Tol2 transposon system; M. Tsang, M. Tada, D.
Onichtchouk, T. Matsui and J. C. Belmonte for plasmids; M. Mullins for
comments on the manuscript; K. Bando, S. Fujii, A. Katsuyama, S. Onishi for
technical assistance; and the members of the Hibi laboratory for helpful
discussions. This work was supported by Grants-in-Aid for Scientific Research
from the Ministry of Education, Science, Sports and Technology, Japan
(21370103 to M.H.).
Competing interests statement
The authors declare no competing financial interests.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/lookup/suppl/doi:10.1242/dev.046425/-/DC1
References
Bellipanni, G., Varga, M., Maegawa, S., Imai, Y., Kelly, C., Myers, A. P., Chu,
F., Talbot, W. S. and Weinberg, E. S. (2006). Essential and opposing roles of
zebrafish beta-catenins in the formation of dorsal axial structures and
neurectoderm. Development 133, 1299-1309.
Bennett, J. T., Stickney, H. L., Choi, W. Y., Ciruna, B., Talbot, W. S. and Schier,
A. F. (2007). Maternal nodal and zebrafish embryogenesis. Nature 450, E1-E2;
discussion E2-E4.
Bontems, F., Stein, A., Marlow, F., Lyautey, J., Gupta, T., Mullins, M. C. and
Dosch, R. (2009). Bucky ball organizes germ plasm assembly in zebrafish. Curr.
Biol. 19, 414-422.
Cai, Q., Gerwin, C. and Sheng, Z. H. (2005). Syntabulin-mediated anterograde
transport of mitochondria along neuronal processes. J. Cell Biol. 170, 959969.
Cai, Q., Pan, P. Y. and Sheng, Z. H. (2007). Syntabulin-kinesin-1 family member
5B-mediated axonal transport contributes to activity-dependent presynaptic
assembly. J. Neurosci. 27, 7284-7296.
DEVELOPMENT
Dorsal termination by a motor protein linker
RESEARCH ARTICLE
Cha, S. W., Tadjuidje, E., Tao, Q., Wylie, C. and Heasman, J. (2008). Wnt5a
and Wnt11 interact in a maternal Dkk1-regulated fashion to activate both
canonical and non-canonical signaling in Xenopus axis formation. Development
135, 3719-3729.
Cuykendall, T. N. and Houston, D. W. (2009). Vegetally localized Xenopus
trim36 regulates cortical rotation and dorsal axis formation. Development 136,
3057-3065.
De Robertis, E. M. (2006). Spemann’s organizer and self-regulation in amphibian
embryos. Nat. Rev. Mol. Cell Biol. 7, 296-302.
De Robertis, E. M., Larrain, J., Oelgeschlager, M. and Wessely, O. (2000). The
establishment of Spemann’s organizer and patterning of the vertebrate embryo.
Nat. Rev. Genet. 1, 171-181.
Dosch, R., Wagner, D. S., Mintzer, K. A., Runke, G., Wiemelt, A. P. and
Mullins, M. C. (2004). Maternal control of vertebrate development before the
midblastula transition: mutants from the zebrafish I. Dev. Cell 6, 771-780.
Dougan, S. T., Warga, R. M., Kane, D. A., Schier, A. F. and Talbot, W. S.
(2003). The role of the zebrafish nodal-related genes squint and cyclops in
patterning of mesendoderm. Development 130, 1837-1851.
Draper, B. W., McCallum, C. M. and Moens, C. B. (2007). nanos1 is required to
maintain oocyte production in adult zebrafish. Dev. Biol. 305, 589-598.
Elinson, R. P. and Rowning, B. (1988). A transient array of parallel microtubules
in frog eggs: potential tracks for a cytoplasmic rotation that specifies the dorsoventral axis. Dev. Biol. 128, 185-197.
Gerhart, J., Danilchik, M., Doniach, T., Roberts, S., Rowning, B. and Stewart,
R. (1989). Cortical rotation of the Xenopus egg: consequences for the
anteroposterior pattern of embryonic dorsal development. Development 107,
37-51.
Gore, A. V. and Sampath, K. (2002). Localization of transcripts of the zebrafish
morphogen Squint is dependent on egg activation and the microtubule
cytoskeleton. Mech. Dev. 112, 153-156.
Gore, A. V., Maegawa, S., Cheong, A., Gilligan, P. C., Weinberg, E. S. and
Sampath, K. (2005). The zebrafish dorsal axis is apparent at the four-cell stage.
Nature 438, 1030-1035.
Guraya, S. S. (1979). Recent advances in the morphology, cytochemistry, and
function of Balbiani’s vitelline body in animal oocytes. Int. Rev. Cytol. 59, 249321.
Hachet, O. and Ephrussi, A. (2004). Splicing of oskar RNA in the nucleus is
coupled to its cytoplasmic localization. Nature 428, 959-963.
Hagos, E. G. and Dougan, S. T. (2007). Time-dependent patterning of the
mesoderm and endoderm by Nodal signals in zebrafish. BMC Dev. Biol. 7, 22.
Hagos, E. G., Fan, X. and Dougan, S. T. (2007). The role of maternal Activin-like
signals in zebrafish embryos. Dev. Biol. 309, 245-258.
Hashimoto, Y., Maegawa, S., Nagai, T., Yamaha, E., Suzuki, H., Yasuda, K.
and Inoue, K. (2004). Localized maternal factors are required for zebrafish
germ cell formation. Dev. Biol. 268, 152-161.
Heisenberg, C. P., Tada, M., Rauch, G. J., Saude, L., Concha, M. L., Geisler, R.,
Stemple, D. L., Smith, J. C. and Wilson, S. W. (2000). Silberblick/Wnt11
mediates convergent extension movements during zebrafish gastrulation.
Nature 405, 76-81.
Hibi, M., Hirano, T. and Dawid, I. B. (2002). Organizer formation and function.
Results Probl. Cell Differ. 40, 48-4871.
Houliston, E. and Elinson, R. P. (1991). Evidence for the involvement of
microtubules, ER, and kinesin in the cortical rotation of fertilized frog eggs. J.
Cell Biol. 114, 1017-1028.
Jesuthasan, S. and Stahle, U. (1997). Dynamic microtubules and specification of
the zebrafish embryonic axis. Curr. Biol. 7, 31-42.
Kawakami, K., Takeda, H., Kawakami, N., Kobayashi, M., Matsuda, N. and
Mishina, M. (2004). A transposon-mediated gene trap approach identifies
developmentally regulated genes in zebrafish. Dev. Cell 7, 133-144.
Kelly, C., Chin, A. J., Leatherman, J. L., Kozlowski, D. J. and Weinberg, E. S.
(2000). Maternally controlled (beta)-catenin-mediated signaling is required for
organizer formation in the zebrafish. Development 127, 3899-3911.
Kloc, M. and Etkin, L. D. (1995). Two distinct pathways for the localization of
RNAs at the vegetal cortex in Xenopus oocytes. Development 121, 287-297.
Kloc, M., Larabell, C. and Etkin, L. D. (1996). Elaboration of the messenger
transport organizer pathway for localization of RNA to the vegetal cortex of
Xenopus oocytes. Dev. Biol. 180, 119-130.
Kloc, M., Bilinski, S., Chan, A. P., Allen, L. H., Zearfoss, N. R. and Etkin, L. D.
(2001). RNA localization and germ cell determination in Xenopus. Int. Rev. Cytol.
203, 63-91.
Kloc, M., Bilinski, S. and Etkin, L. D. (2004). The Balbiani body and germ cell
determinants: 150 years later. Curr. Top. Dev. Biol. 59, 1-36.
Knapik, E. W., Goodman, A., Atkinson, O. S., Roberts, C. T., Shiozawa, M.,
Sim, C. U., Weksler-Zangen, S., Trolliet, M. R., Futrell, C., Innes, B. A. et al.
(1996). A reference cross DNA panel for zebrafish (Danio rerio) anchored with
simple sequence length polymorphisms. Development 123, 451-460.
Knaut, H., Pelegri, F., Bohmann, K., Schwarz, H. and Nusslein-Volhard, C.
(2000). Zebrafish vasa RNA but not its protein is a component of the germ
plasm and segregates asymmetrically before germline specification. J. Cell Biol.
149, 875-888.
Development 137 (6)
Kosaka, K., Kawakami, K., Sakamoto, H. and Inoue, K. (2007). Spatiotemporal
localization of germ plasm RNAs during zebrafish oogenesis. Mech. Dev. 124,
279-289.
Ku, M. and Melton, D. A. (1993). Xwnt-11: a maternally expressed Xenopus wnt
gene. Development 119, 1161-1173.
Leung, T., Soll, I., Arnold, S. J., Kemler, R. and Driever, W. (2003). Direct
binding of Lef1 to sites in the boz promoter may mediate pre-midblastulatransition activation of boz expression. Dev. Dyn. 228, 424-432.
Maegawa, S., Yasuda, K. and Inoue, K. (1999). Maternal mRNA localization of
zebrafish DAZ-like gene. Mech. Dev. 81, 223-226.
Marlow, F. L. and Mullins, M. C. (2008). Bucky ball functions in Balbiani body
assembly and animal-vegetal polarity in the oocyte and follicle cell layer in
zebrafish. Dev. Biol. 321, 40-50.
Matsui, T., Raya, A., Kawakami, Y., Callol-Massot, C., Capdevila, J.,
Rodriguez-Esteban, C. and Izpisua Belmonte, J. C. (2005). Noncanonical
Wnt signaling regulates midline convergence of organ primordia during
zebrafish development. Genes Dev. 19, 164-175.
Mei, W., Lee, K. W., Marlow, F. L., Miller, A. L. and Mullins, M. C. (2009).
hnRNP I is required to generate the Ca2+ signal that causes egg activation in
zebrafish. Development 136, 3007-3017.
Miller, J. R., Rowning, B. A., Larabell, C. A., Yang-Snyder, J. A., Bates, R. L.
and Moon, R. T. (1999). Establishment of the dorsal-ventral axis in Xenopus
embryos coincides with the dorsal enrichment of dishevelled that is dependent
on cortical rotation. J. Cell Biol. 146, 427-437.
Mizuno, T., Yamaha, E., Kuroiwa, A. and Takeda, H. (1999). Removal of
vegetal yolk causes dorsal deficiencies and impairs dorsal-inducing ability of the
yolk cell in zebrafish. Mech. Dev. 81, 51-63.
Nagai, T., Ibata, K., Park, E. S., Kubota, M., Mikoshiba, K. and Miyawaki, A.
(2002). A variant of yellow fluorescent protein with fast and efficient maturation
for cell-biological applications. Nat. Biotechnol. 20, 87-90.
Nojima, H., Shimizu, T., Kim, C. H., Yabe, T., Bae, Y. K., Muraoka, O., Hirata,
T., Chitnis, A., Hirano, T. and Hibi, M. (2004). Genetic evidence for
involvement of maternally derived Wnt canonical signaling in dorsal
determination in zebrafish. Mech. Dev. 121, 371-386.
Ober, E. A. and Schulte-Merker, S. (1999). Signals from the yolk cell induce
mesoderm, neuroectoderm, the trunk organizer, and the notochord in zebrafish.
Dev. Biol. 215, 167-181.
Onichtchouk, D., Aduroja, K., Belting, H. G., Gnugge, L. and Driever, W.
(2003). Transgene driving GFP expression from the promoter of the zona
pellucida gene zpc is expressed in oocytes and provides an early marker for
gonad differentiation in zebrafish. Dev. Dyn. 228, 393-404.
Provost, E., Rhee, J. and Leach, S. D. (2007). Viral 2A peptides allow expression
of multiple proteins from a single ORF in transgenic zebrafish embryos. Genesis
45, 625-629.
Rauch, G. J., Hammerschmidt, M., Blader, P., Schauerte, H. E., Strahle, U.,
Ingham, P. W., McMahon, A. P. and Haffter, P. (1997). Wnt5 is required for
tail formation in the zebrafish embryo. Cold Spring Harb. Symp. Quant. Biol. 62,
227-234.
Ryu, S. L., Fujii, R., Yamanaka, Y., Shimizu, T., Yabe, T., Hirata, T., Hibi, M.
and Hirano, T. (2001). Regulation of dharma/bozozok by the Wnt pathway.
Dev. Biol. 231, 397-409.
Schier, A. F. and Talbot, W. S. (2005). Molecular genetics of axis formation in
zebrafish. Annu. Rev. Genet. 39, 561-613.
Schneider, S., Steinbeisser, H., Warga, R. M. and Hausen, P. (1996). Betacatenin translocation into nuclei demarcates the dorsalizing centers in frog and
fish embryos. Mech. Dev. 57, 191-198.
Schroeder, K. E., Condic, M. L., Eisenberg, L. M. and Yost, H. J. (1999).
Spatially regulated translation in embryos: asymmetric expression of maternal
Wnt-11 along the dorsal-ventral axis in Xenopus. Dev. Biol. 214, 288-297.
Schroeder, M. M. and Gard, D. L. (1992). Organization and regulation of cortical
microtubules during the first cell cycle of Xenopus eggs. Development 114, 699709.
Shimizu, T., Yamanaka, Y., Ryu, S., Hashimoto, H., Yabe, T., Hirata, T., Bae,
Y., Hibi, M. and Hirano, T. (2000a). Cooperative roles of Bozozok/Dharma and
nodal-related proteins in the formation of the dorsal organizer in zebrafish.
Mech. Dev. 91, 293-303.
Shimizu, T., Yamanaka, Y., Ryu, S., Hashimoto, H., Yabe, T., Hirata, T., Bae,
Y., Hibi, M. and Hirano, T. (2000b). Cooperative roles of Bozozok/Dharma and
nodal-related proteins in the formation of the dorsal organizer in zebrafish.
Mech. Dev. 91, 293-303.
Shimizu, T., Yabe, T., Muraoka, O., Yonemura, S., Aramaki, S., Hatta, K., Bae,
Y. K., Nojima, H. and Hibi, M. (2005). E-cadherin is required for gastrulation
cell movements in zebrafish. Mech. Dev. 122, 747-763.
Sirotkin, H. I., Dougan, S. T., Schier, A. F. and Talbot, W. S. (2000). bozozok
and squint act in parallel to specify dorsal mesoderm and anterior
neuroectoderm in zebrafish. Development 127, 2583-2592.
Solnica-Krezel, L. and Driever, W. (1994). Microtubule arrays of the zebrafish
yolk cell: organization and function during epiboly. Development 120, 24432455.
DEVELOPMENT
10
Su, Q., Cai, Q., Gerwin, C., Smith, C. L. and Sheng, Z. H. (2004). Syntabulin is a
microtubule-associated protein implicated in syntaxin transport in neurons. Nat.
Cell Biol. 6, 941-953.
Suzuki, H., Maegawa, S., Nishibu, T., Sugiyama, T., Yasuda, K. and Inoue, K.
(2000). Vegetal localization of the maternal mRNA encoding an EDEN-BP/Brunolike protein in zebrafish. Mech. Dev. 93, 205-209.
Tao, Q., Yokota, C., Puck, H., Kofron, M., Birsoy, B., Yan, D., Asashima, M.,
Wylie, C. C., Lin, X. and Heasman, J. (2005). Maternal wnt11 activates the
canonical wnt signaling pathway required for axis formation in Xenopus
embryos. Cell 120, 857-871.
Thisse, C. and Thisse, B. (1998). High resolution whole-mount in situ
hybridization. In Zebrafish Science Monitor, vol. 5, issue 1. Eugene, OR:
University of Oregon Press (http://zfin.org/zf_info/monitor/vol5.1/vol5.1.html).
Tsang, M., Maegawa, S., Kiang, A., Habas, R., Weinberg, E. and Dawid, I. B.
(2004). A role for MKP3 in axial patterning of the zebrafish embryo.
Development 131, 2769-2779.
Weaver, C., Farr, G. H., 3rd, Pan, W., Rowning, B. A., Wang, J., Mao, J., Wu,
D., Li, L., Larabell, C. A. and Kimelman, D. (2003). GBP binds kinesin light
RESEARCH ARTICLE
11
chain and translocates during cortical rotation in Xenopus eggs. Development
130, 5425-5436.
Westerfield, M. (1995). The Zebrafish Book: a Guide for the Laboratory Use of
Zebrafish. Eugene, OR: University of Oregon Press.
Wilk, K., Bilinski, S., Dougherty, M. T. and Kloc, M. (2005). Delivery of germinal
granules and localized RNAs via the messenger transport organizer pathway to
the vegetal cortex of Xenopus oocytes occurs through directional expansion of
the mitochondrial cloud. Int. J. Dev. Biol. 49, 17-21.
Yamanaka, Y., Mizuno, T., Sasai, Y., Kishi, M., Takeda, H., Kim, C. H.,
Hibi, M. and Hirano, T. (1998). A novel homeobox gene, dharma, can
induce the organizer in a non-cell-autonomous manner. Genes Dev. 12,
2345-2353.
Yonemura, S., Matsui, T. and Tsukita, S. (2002). Rho-dependent and independent activation mechanisms of ezrin/radixin/moesin proteins: an
essential role for polyphosphoinositides in vivo. J. Cell Sci. 115, 2569-2580.
Yost, C., Farr, G. H., 3rd, Pierce, S. B., Ferkey, D. M., Chen, M. M. and
Kimelman, D. (1998). GBP, an inhibitor of GSK-3, is implicated in Xenopus
development and oncogenesis. Cell 93, 1031-1041.
DEVELOPMENT
Dorsal termination by a motor protein linker