Download against Viruses in Innate Immune Cells B Kinase in IFN Responses

Cutting Edge: Role of TANK-Binding Kinase
1 and Inducible I κB Kinase in IFN Responses
against Viruses in Innate Immune Cells
This information is current as
of June 18, 2017.
Kosuke Matsui, Yutaro Kumagai, Hiroki Kato, Shintaro
Sato, Tatsukata Kawagoe, Satoshi Uematsu, Osamu
Takeuchi and Shizuo Akira
J Immunol 2006; 177:5785-5789; ;
doi: 10.4049/jimmunol.177.9.5785
http://www.jimmunol.org/content/177/9/5785
References
Subscription
Permissions
Email Alerts
http://www.jimmunol.org/content/suppl/2006/10/17/177.9.5785.DC1
This article cites 18 articles, 8 of which you can access for free at:
http://www.jimmunol.org/content/177/9/5785.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2006 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
Supplementary
Material
OF
THE
JOURNAL IMMUNOLOGY
CUTTING EDGE
Cutting Edge: Role of TANK-Binding Kinase 1 and
Inducible I␬B Kinase in IFN Responses against Viruses
in Innate Immune Cells1
Kosuke Matsui,*† Yutaro Kumagai,*† Hiroki Kato,* Shintaro Sato,† Tatsukata Kawagoe,*†
Satoshi Uematsu,* Osamu Takeuchi,*† and Shizuo Akira2*†
ecognition of viral components, such as ds- and ssRNA, by innate immune cells leads to rapid induction
of type I IFNs, which are essential mediators of initial
host defense against viruses (1). The recognition of viral dsRNA
is mediated by host pattern recognition receptors, including
retinoic acid-inducible gene-I (RIG-I),3 melanoma differentiation-associated gene-5 (MDA5), and TLR3 (2– 4). RIG-I and
MDA5 are cytoplasmic proteins comprised of caspase recruitment domains (CARDs) and a helicase domain. Whereas
RIG-I is responsible for the recognition of various RNA viruses
including paramyxoviruses, vesicular stomatitis virus (VSV),
influenza virus, and Japanese encephalitis virus, MDA5 detects
viruses belonging to picornavirus family such as encephalomyocarditis virus (EMCV) (5). RIG-I and MDA5 detect dsRNAs
via the helicase domain and initiate downstream signaling cascades via the CARDs by associating with a CARD-containing
signaling protein, named IFN-␤ promoter stimulator-1 (also
known as MAVS, VISA, or CARDIF) (6 –9). TLR3, which localizes on the endosomal membrane, recruits a TIR-domaincontaining adaptor-inducing IFN-␤ (TRIF) to the receptor
upon ligand stimulation (10). In addition, LPS, a TLR4 ligand,
is shown to induce type I IFNs via the TRIF-dependent signaling pathway.
Downstream of the IFN-␤ promoter stimulator-1 or TRIF,
I␬B kinase-related kinases, called TANK-binding kinase 1
(TBK1) and inducible I␬B kinase (IKK-i), also known as
IKK-␧, are activated in response to the stimuli (11, 12). They
can phosphorylate IFN-regulatory factor (IRF)-3 and IRF-7,
which in turn translocate into the nucleus and induce the expression of type I IFN as well as IFN-inducible genes. It has
been shown that TBK1 plays a critical role in the induction of
IFN-␤ as well as IFN-inducible genes in mouse embryonic fibroblasts (13, 14). However, TBK1-deficient bone marrow
macrophages showed normal IFN responses against RNA virus
infection, and it was unclear whether TBK1 and IKK-i play a
pivotal role in the regulation of type I IFNs in innate immune
cells (15). Moreover, a recent study suggested that TBK1 and
IKK-i can regulate different IFN-␣ genes, IFN-␣11 and IFN␣4, respectively (16). Moreover, it was shown that plasmacytoid dendritic cells (pDCs) could produce IFN-␣ in response to
TLR9 ligands independent of TBK1 via the direct association
of MyD88 and IRF-7.
In this study, we investigated the role of TBK1 and IKK-i in
innate immune cells by generating macrophages and DCs from
fatal liver cells under TNF⫺/⫺ background. Our results clearly
demonstrate that both TBK1 and IKK-i are key players for the
expression of type I IFNs and IFN-inducible genes in response
to exposure to various RNA viruses in conventional DCs
(cDCs), but not in pDCs.
*Department of Host Defense, Research Institute for Microbial Diseases, Osaka University, Suita, Osaka, Japan; and †Exploratory Research for Advanced Technology, Japan Science and Technology Agency, Suita, Osaka, Japan
2
Address correspondence and reprint requests to Dr. Shizuo Akira, Department of Host
Defense, Research Institute for Microbial Diseases, Osaka University, 3-1 Yamada-oka,
Suita, Osaka 565-0871, Japan. E-mail address: [email protected]
Received for publication May 22, 2006. Accepted for publication August 25, 2006.
3
Abbreviations used in this paper: RIG-I, retinoic acid-inducible protein-I; MDA5, melanoma differentiation-associated gene-5; CARD, comprised of caspase recruitment domain; VSV, vesicular stomatitis virus; EMCV, encephalomyocarditis virus; TRIF, TIRdomain-containing adaptor-inducing IFN-␤; TBK1, TANK-binding kinase 1; IKK-i,
inducible I␬B kinase; IRF, IFN-regulatory factor; pDC, plasmacytoid dendritic cell; cDC,
conventional DC; NDV, Newcastle disease virus; Q-PCR, quantitative real-time PCR;
moi, multiplicity of infection; IRAK, IL-1R-associated kinase; Flt3L, Fms-like tyrosine
kinase 3 ligand.
R
The costs of publication of this article were defrayed in part by the payment of page charges.
This article must therefore be hereby marked advertisement in accordance with 18 U.S.C.
Section 1734 solely to indicate this fact.
1
This work was supported, in part, by grants from the Ministry of Education, Culture,
Sports, Science, and Technology in Japan, and from the 21st Century Center of Excellence
Program of Japan.
Copyright © 2006 by The American Association of Immunologists, Inc.
0022-1767/06/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
TANK-binding kinase 1 (TBK1) and inducible I␬B kinase (IKK-i) are involved in the activation of transcription factors inducing the production of type I IFNs. Although TBK1, but not IKK-i, is critical for LPS-induced
IFN induction, the role of these kinases in the responses
against viral infection is yet to be determined. In this
study, we show that type I IFN production against various
RNA viruses was completely abrogated in conventional
dendritic cells (DCs) and macrophages induced from fetal
liver cells lacking both TBK1 and IKK-i, whereas considerable amounts of IFN were produced in cells lacking either of them. Microarray analysis revealed that various
IFN-inducible genes were also regulated by the kinases. In
contrast, Fms-like tyrosine kinase 3 ligand-induced DCs
produced IFN-␣ even in the absence of both TBK1 and
IKK-i. Thus, these two kinases are essential and compensate each other for the regulation of IFN responses in innate immune cells except plasmacytoid DCs. The Journal of Immunology, 2006, 177: 5785–5789.
5786
CUTTING EDGE: ROLE OF TBK1 AND IKK-i IN IMMUNE CELLS
Materials and Methods
Mice, cells, reagents, and viruses
TBK1⫺/⫺, IKK-i⫺/⫺, and TNF-␣⫺/⫺ mice have been described previously.
LPS was purchased from Sigma-Aldrich. Poly(I:C) was purchased from Amersham Biosciences. Newcastle disease virus (NDV), VSV, influenza virus lacking
NS1 protein (⌬NS1), and EMCV have been described previously (5). The Ab
against phosphor-IKK␣ (Ser180)/IKK␤ (Ser181) was obtained from Cell Signaling. Abs against IKK␣␤ and I␬B-␣ were purchased from Santa Cruz
Biotechnology.
Quantitative real-time PCR (Q-PCR)
RNA was prepared from cDCs stimulated with 100 ng/ml LPS or infected with
NDV, and cDNA was synthesized using Superscript II (Invitrogen Life Technologies). Q-PCR analysis was performed using the 7700 Sequence Detector
(Applied Biosystems). The primers and probes for and IFN-␤, Cxcl10, Cxcl1,
IFN-a2, -a4, -a5, and -a11 were purchased from Applied Biosystems. Primers for
18s rRNA were used as an internal control. To detect the expression of a gene encoding NDV nucleocapsid protein, the following primers and probes were used:
forward primer TTCCGTATTCGACGAGTACGAA, reverse primer CAAGG
GCAACATGGTTCCTC, and the TaqMan probe TCAGGCAAGGTGCTC.
Measurement of IFN-␤ and IFN-␣ production
Native PAGE and Western blot analysis
cDCs (1 ⫻ 106) were infected with NDV for the indicated periods, and then
lysed. The cell lysates were separated on a native-PAGE, and then immunoblotted with anti-IRF-3 Ab as described previously (13).
Microarray analysis
cDCs were exposed to NDV for 8 h. Then, total RNA was extracted with
TRIzol (Invitrogen Life Technologies) and further purified with a RNeasy kit
(Qiagen). Biotin-labeled cDNA was synthesized from 100 ng of total RNA using Ovation Biotin RNA Amplification and Labeling System (Nugen) according to the manufacturer’s protocol. Hybridization, staining, washing, and scanning of Affymetrix mouse Genome 430 2.0 microarray chips were conducted
according to the manufacturer’s instruction. Data analysis was performed using
MicroArray Suite software (Affymetrix) and ArrayAssist software (Stratagene).
Results and Discussion
Generation of cDCs lacking TBK1 and/or IKK-i
TBK1⫺/⫺ mice are embryonic lethal because of liver degeneration
at e14.0 –15.0, and this phenotype has been shown to be rescued in the
absence of TNF receptor signaling. TBK1⫺/⫺IKK-i⫺/⫺ mice are also
embryonic lethal at around e12.0, and it was difficult to prepare fetal
liver cells from them. To investigate the role of TBK1 and IKK-i in
immune cells, we tried to generate mice lacking TBK1 and/or IKK-i
under TNF⫺/⫺ background. First, we could obtain adult mice lacking
TNF and TBK1 (TNF⫺/⫺TBK1⫺/⫺) as reported previously. Nevertheless, TNF⫺/⫺TBK1⫺/⫺IKK-i⫺/⫺ mice were embryonic lethal
at e14.0 and the mice were not born alive. Nevertheless, fetal liver
cells could be prepared from TNF⫺/⫺TBK1⫺/⫺IKK-i⫺/⫺ e13.5
embryos, and the cells were cultured in the presence of GM-CSF.
The surface expression of CD11c and CD11b was not altered in
the GM-CSF-induced cells obtained from TBK1⫹/⫺IKK-i⫹/⫺,
TBK1⫺/⫺IKK-i⫹/⫺, TBK1⫹/⫺IKK-i⫺/⫺, and TBK1⫺/⫺IKK-i⫺/⫺
embryos under TNF⫺/⫺ background (data not shown), and we
used the cells as cDCs for further investigation.
The expression of IFN-inducible genes in response to LPS and NDV
in cDCs
We first examined the role of TBK1 and IKK-i in the expression
of IFN-inducible genes in response to LPS and NDV in cDCs.
cDCs derived from fetal livers were stimulated with 100 ng/ml
LPS for the indicated periods, and the expression of mRNAs for
Ifnb, Cxcl10 (IP-10), and Cxcl1 (KC) were quantified by Q-PCR.
As shown in Fig. 1A, LPS-induced expression of IFN-␤ and IP-10
FIGURE 1. Induction of IFN-inducible genes in cDCs lacking TBK1
and IKK-i in response to LPS and NDV. A, cDCs induced from
TBK1⫹/⫺IKK-i⫹/⫺, TBK1⫺/⫺IKK-i⫹/⫺, TBK1⫹/⫺IKK-i⫺/⫺, and
TBK1⫺/⫺IKK-i⫺/⫺ embryos under TNF⫺/⫺ background were stimulated
with 100 ng/ml LPS for 2 or 4 h. B, cDCs described in A were exposed to
NDV for 4 h. Total RNA was extracted, and mRNA levels for IFN-␤
(Ifnb), IP-10 (Cxcl10), KC (Cxcl1), and NDV nucleoprotein were determined by Q-PCR.
genes was not impaired in IKK-i⫺/⫺ cDCs, and was severely impaired in either TBK1⫺/⫺ or TBK1⫺/⫺IKK-i⫺/⫺ cDCs in accordance with a previous report. In contrast, induction of Cxcl1 was
not impaired even in the absence of both TBK1 and IKK-i. These
results indicate that the TLR4-induced IFN-production predominantly depends on TBK1, whereas Cxcl1 is induced independent
of TBK1 and IKK-i in cDCs. When the cells were exposed to
NDV, the induction of Ifnb gene was not impaired in IKK-i⫺/⫺
and was only partially impaired in TBK1⫺/⫺ cDCs (Fig. 1B).
Nevertheless, TBK1⫺/⫺IKK-i⫺/⫺ cDCs failed to induce Ifnb and
Cxcl10, genes in response to NDV. The Cxcl1 gene was normally
induced even in the absence of both TBK1 and IKK-i. The
expression of the gene encoding NDV nucleoprotein was comparable between the cells examined, indicating the proper infection
of NDV regardless of the absence of TBK1 and/or IKK-i (Fig. 1B
and data not shown).
Therefore, we further used DNA microarrays for analyzing gene
expression profile after NDV stimulation comprehensively.
NDV stimulation resulted in the up-regulation of 455 genes in
TBK1⫹/⫺IKK-i⫹/⫺ cDCs (Supplementary Table I).4 Hierarchical
clustering revealed that NDV-inducible genes were divided into
two clusters based on the dependence on TBK1 and IKK-i for their
expression (Fig. 2A). Deficiency in IKK-i alone did not affect the
induction of genes compared with control cDCs. Genes annotated
as IFN-inducible appeared in the cluster containing genes that
were not induced in the absence of TBK1 and IKK-i (cluster I).
Nevertheless, a set of NDV-inducible genes were up-regulated
even in TBK1⫺/⫺IKK-i⫺/⫺ cDCs (cluster II). These genes include
4
The online version of this article contains supplemental material.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
Culture supernatants were collected and analyzed for production of IFN-␤ and
IFN-␣ (PBL Biomedical Laboratories) by ELISA.
The Journal of Immunology
Cxcl1, Nfkbiz, Socs3, Tnfsf9, all of which are known to be activated by the transcription factor, NF-␬B.
It has been suggested by in vitro studies that TBK1 and IKK-i
regulate different subtypes of IFN-␣ genes. Therefore, we investigated the expression of various IFN-␣ genes in response to NDV
infection. As shown in Fig. 2B, there was no difference in the
induction of various IFN-␣ genes between TBK1⫹/⫺IKK-i⫹/⫺ and
TBK1⫹/⫺IKK-i⫺/⫺ cells. In contrast, TBK1⫺/⫺IKK-i⫹/⫺ cells
showed modest reduction in all IFN-␣ genes examined. Q-PCR
analysis of IFN-a2, IFN-a5, and IFN-a11 genes further confirmed the
result obtained by microarray analysis (Fig. 2C). This result indicates
that both IKK-i and TBK1 control expression of various IFN-␣ genes,
and there seems to be no specific regulation of IFN-␣ subtypes by
either IKK-i or TBK1 in cDCs. Genes regulated by NF-␬B are significantly up-regulated in response to NDV infection even in
TBK1⫺/⫺IKK-i⫺/⫺ cDCs.
Abrogated type I IFN production in TBK1⫺/⫺IKK-i⫺/⫺ cDCs in
response to various RNA viruses
We have recently shown that RIG-I and MDA5 are responsible for
the recognition of different viruses; RIG-I detects various RNA
viruses including paramyxoviruses, VSV, and Japanese encephalitis virus, whereas MDA5 specifically detects picornaviruses such
as EMCV. To examine whether both RIG-I and MDA5 signal
through TBK1 and IKK-i, we infected cDCs with increasing multiplicity of infection (moi) of RNA viruses, including NDV, influenza virus, VSV, and EMCV, and measured type I IFN production.
As shown in Fig. 3A, TBK1⫹/⫺IKK-i⫹/⫺ and TBK1⫹/⫺IKK-i⫺/⫺
cDCs produced comparable amounts of IFN-␣ in response to various RNA viruses. In accordance with a previous report, infection
of DCs with viruses induced production of IFN-␣ even in the ab-
FIGURE 3. Production of type I IFNs RNA virus infection in cells lacking TBK1 and/or IKK-i. A and B, cDCs from embryos with indicated
genotypes were infected with the indicated moi of NDV, VSV, influenza
virus, or EMCV, or transfected with indicated concentrations of poly(I:C).
IFN-␣ (A) or IFN-␤ (B) production in the culture supernatants was measured by ELISA. C, M-CSF-induced fetal liver macrophages were infected
with EMCV or VSV, and IFN-␤ production was measured by ELISA.
Error bars, ⫾SD between triplicates. The data shown are representative of
three independent experiments.
sence of TBK1, although the production was significantly impaired
(15). However, cDCs lacking both TBK1 and IKK-i did not produce any detectable amounts of IFN-␤ or IFN-␣ in response to all
viruses tested. Production of IFN-␤ in response to the viruses was
similarly regulated by TBK1 and IKK-i (Fig. 3B). Moreover, macrophages induced from fetal liver in the presence of M-CSF also
produced type I IFNs in response to EMCV and VSV in a TBK1/
IKK-i-dependent manner (Fig. 3C). These results indicate that
TBK1 and IKK-i are essential for the IFN responses against viruses recognized by both RIG-I and MDA5.
TBK1 and IKK-i are critical for the activation of IRF-3 in cDCs in
response to NDV
Next, we examined the activation of intracellular signaling pathways triggered in response to viral infection in cDCs. It has been
shown that IRF-3 is phosphorylated, homodimerizes, and translocates into the nucleus in response to viral infection. Although
NDV-induced dimerization of IRF-3 was induced in cDCs lacking
either IKK-i or TBK1 as well as in control cells, the activation was
abrogated in TBK1⫺/⫺IKK-i⫺/⫺ cells (Fig. 4A). In contrast, degradation of I␬B-␣ as well as I␬B kinases in response to NDV
infection was induced even in TBK1⫺/⫺IKK-i⫺/⫺ cDCs, indicating that TBK1 and IKK-i are not requisite for NF-␬B activation in
accordance with previous reports (Fig. 4B).
TBK1/IKK-i-independent IFN-␣ production in response to NDV in pDCs
Stimulation with TLR7 and TLR9 ligands recruits a complex composed of MyD88, IL-1R-associated kinase (IRAK)1, IRAK4,
TRAF6, and IRF-7 to the receptor in pDCs. IRAK1 and IKK␣
have been implicated in the phosphorylation of IRF-7 in these
cells. It has also been shown that recognition of RNA viruses has
been shown to be mediated in a MyD88-dependent manner in
pDCs. However, the contribution of TBK1 and IKK-i in the IFN
response in pDCs is yet to be clarified. Therefore, we induced DCs
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 2. The cluster images of NDV-inducible genes in cDCs lacking TBK1 and/or IKK-i. cDCs from embryos in indicated genotypes were
infected with NDV for 8 h, and total RNA was prepared. The microarray
analysis was performed as described in Materials and Methods, and 455
genes were selected as NDV-inducible genes based on the following definition: the MAS5.0 detection call was “Present” in at least one condition,
and the robust multichip average expression value in TBK1⫹/⫺IKK-i⫹/⫺
cDCs after NDV infection was higher than 5-fold compared with that in
unstimulated cells. The genes were hierarchically clustered by Pearson
correlation. The resulted heatmap and dendrogram are shown in A. A heatmap representation of change in expression of type I IFN genes in response
to NDV stimulation is shown in B. C, mRNA levels for IFN-a2, -a5, and
-a11 were determined by Q-PCR for the total RNA prepared in A.
5787
5788
CUTTING EDGE: ROLE OF TBK1 AND IKK-i IN IMMUNE CELLS
from fetal livers in the presence of Fms-like tyrosine kinase 3
ligand (Flt3L). In fetal liver cell culture, Flt3L induced a similar
population of B220⫹CD11c⫹ cells in all genotypes tested (data not
shown), although the frequency of B220⫹CD11c⫹ cells was lower
compared with those induced from bone marrow cells. When
Flt3L-cultivated fetal liver cells were stimulated with A/D-type
CpG-DNA, the production of IFN-␣ was comparable between cells
from TBK1⫹/⫺IKK-i⫹/⫺, TBK1⫹/⫺IKK-i⫺/⫺, TBK1⫺/⫺IKK-i⫹/⫺,
and TBK1⫺/⫺IKK-i⫺/⫺ embryos (Fig. 5B). In addition, NDVinduced IFN-␣ production was also induced even in the absence of
both TBK1 and IKK-i (Fig. 5A). TLR9-induced induction of IFN-
FIGURE 5. TBK1/IKK-i-independent production of IFN-␣ in response
to CpG-DNA and NDV in pDCs. A, Flt3L-induced DCs from embryos in
indicated genotypes were stimulated with an A/D-type CpG oligonucleotide (D35) or exposed to indicated moi of NDV for 24 h. IFN-␣ production
in the culture supernatants was measured by ELISA. Error bars, ⫾SD
between triplicates. B, Flt3L-induced DCs were stimulated with a D35 for
4 h. mRNA levels for IFN-a2, IFN-a4, IFN-a5, and IFN-a6 were determined by Q-PCR.
Acknowledgments
We thank all colleagues in our laboratory, Drs. T. Abe, Y. Matsuura, and
T. Fujita for viruses, M. Hashimoto for secretarial assistance, and Y. Fujiwara,
M. Shiokawa, and N. Kitagaki for technical assistance.
Disclosures
The authors have no financial conflict of interest.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 4. Activation of intracellular signaling molecules in cDCs
lacking TBK1 and IKK-i. A, cDCs were exposed with NDV for the indicated periods. Cell lysates were prepared and subjected to native-PAGE.
Monomeric and dimeric forms of IRF-3 were detected by Western blotting.
B, cDCs were exposed with NDV for the indicated periods. Then cell
lysates were prepared, and subjected to Western blotting using Abs against
phospho-IKK␣␤, IKK␤, and I␬B-␣.
a2, IFN-a4, IFN-a5, and IFN-a6 genes was also not altered between cells from control and TBK1⫺/⫺IKK-i⫺/⫺ embryos (Fig.
5B). Of note, the amounts of IFN-␣ produced in Flt3L-induced
fetal liver cells were lower than those produced from Flt3L-cultured bone marrow cells, implying that cells induced from fetal
liver in the presence of Flt3L are less potent in producing IFN-␣.
Further studies are required to further confirm the role of TBK1
and IKK-i in pDCs in adult mice. Nevertheless, it is obvious that
Flt3L-induced cells could produce IFN-␣ in a mechanism independent of TBK1 and IKK-i in response to a TLR9 ligand and to
NDV exposure.
In this study, we examined the responses of type I IFNs to viral
infection in innate immune cells including cDCs, pDCs, and macrophages. Although cDCs lacking either TBK1 or IKK-i showed
normal IFN responses against RNA virus infection, absence of
both TBK1 and IKK-i disrupted production of type I IFNs. It has
been shown that cytoplasmic viral detectors, RIG-I and MDA5, are
responsible for the recognition of RNA viruses in most cells. Our
results shown in this study indicate that TBK1 and IKK-i are prerequisite for the signaling of RIG-I/MDA5-dependent IFN-induction in addition to their role in the TLR signaling. In contrast, LPS
exclusively signals through TBK1, but not IKK-i. LPS-induced
TBK1 activation results in the up-regulation of IFN-␤, but not
IFN-␣, in cDCs and macrophages (Fig. 3 and data not shown).
TLR4 was shown to signal through TRIF as an adaptor to activate
IFN responses. It was also shown that IFN responses induced by
LPS, but not by viruses, were diminished in IRF-3⫺/⫺ mice (17).
These observations suggest that TRIF-induced TBK1 activation
leads to the activation of IRF-3-IFN-␤, but not the IRF-7-IFN-␣
pathway. However, RNA viruses, which activate cells via RIG-I/
MDA5-dependent signaling, induced IFN-␣ and -␤ production
even in the absence of IKK-i, implying that TBK1 can phosphorylate IRF-7 when it is activated via RIG-I/MDA5 pathway. Further
investigation will be required for disclosing the precise molecular
mechanisms of TLR- or RIG-I/MDA5-dependent up-regulation of
type I IFNs.
Recent in vitro studies suggested that IKK-i and TBK1 are differentially involved in the regulation of different IFN-␣ genes. For
instance, it is shown that overexpression of IKK-i preferentially
activated the IFN-␣4 gene compared with the IFN-␣11 gene (16).
However, our study demonstrates that IKK-i and TBK1 do not
regulate different genes, but redundantly control optimal IFN responses in response to RNA viruses.
TLR9-induced IFN-␣ production was observed even in the absence of both TBK1 and IKK-i, further supporting our previous
observation that the activation of IRF-7 is mediated by phosphorylation probably through IRAK1 in pDCs (18). Therefore, deletion
of both TBK1 and IKK-i clarified the cell type-specific involvement of these kinases in the regulation of type I IFNs and IFNinducible genes. These kinases are prerequisite for RIG-I/MDA5and TRIF-dependent pathways in cDCs, but not for the MyD88dependent pathway in pDCs. Targeting these kinases will lead to
the selective modulation of type I IFN pathways in various cells
without affecting pDCs.
The Journal of Immunology
References
10. Yamamoto, M., S. Sato, H. Hemmi, K. Hoshino, T. Kaisho, H. Sanjo, O. Takeuchi,
M. Sugiyama, M. Okabe, K. Takeda, and S. Akira. 2003. Role of adaptor TRIF in the
MyD88-independent Toll-like receptor signaling pathway. Science 301: 640 – 643.
11. Fitzgerald, K. A., S. M. McWhirter, K. L. Faia, D. C. Rowe, E. Latz, D. T. Golenbock,
A. J. Coyle, S. M. Liao, and T. Maniatis. 2003. IKK␧ and TBK1 are essential components of the IRF3 signaling pathway. Nat. Immunol. 4: 491– 496.
12. Sharma, S., B. R. tenOever, N. Grandvaux, G. P. Zhou, R. Lin, and J. Hiscott. 2003.
Triggering the interferon antiviral response through an IKK-related pathway. Science
300: 1148 –1151.
13. Hemmi, H., O. Takeuchi, S. Sato, M. Yamamoto, T. Kaisho, H. Sanjo, T. Kawai,
K. Hoshino, K. Takeda, and S. Akira. 2004. The roles of two I␬B kinase-related kinases in lipopolysaccharide and double stranded RNA signaling and viral infection.
J. Exp. Med. 199: 1641–1650.
14. McWhirter, S. M., K. A. Fitzgerald, J. Rosains, D. C. Rowe, D. T. Golenbock, and
T. Maniatis. 2004. IFN-regulatory factor 3-dependent gene expression is defective in
Tbk1-deficient mouse embryonic fibroblasts. Proc. Natl. Acad. Sci. USA 101:
233–238.
15. Perry, A. K., E. K. Chow, J. B. Goodnough, W. C. Yeh, and G. Cheng. 2004. Differential requirement for TANK-binding kinase-1 in type I interferon responses to
Toll-like receptor activation and viral infection. J. Exp. Med. 199: 1651–1658.
16. Civas, A., P. Genin, P. Morin, R. Lin, and J. Hiscott. 2006. Promoter organization of
the interferon-A genes differentially affects virus-induced expression and responsiveness to TBK1 and IKK␧. J. Biol. Chem. 281: 4856 – 4866.
17. Honda, K., H. Yanai, H. Negishi, M. Asagiri, M. Sato, T. Mizutani, N. Shimada,
Y. Ohba, A. Takaoka, N. Yoshida, and T. Taniguchi. 2005. IRF-7 is the master regulator of type-I interferon-dependent immune responses. Nature 434: 772–777.
18. Uematsu, S., S. Sato, M. Yamamoto, T. Hirotani, H. Kato, F. Takeshita, M. Matsuda,
C. Coban, K. J. Ishii, T. Kawai, et al. 2005. Interleukin-1 receptor-associated kinase-1
plays an essential role for Toll-like receptor (TLR)7- and TLR9-mediated interferon-␣
induction. J. Exp. Med. 201: 915–923.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
1. Akira, S., S. Uematsu, and O. Takeuchi. 2006. Pathogen recognition and innate immunity. Cell 124: 783– 801.
2. Alexopoulou, L., A. C. Holt, R. Medzhitov, and R. A. Flavell. 2001. Recognition of
double-stranded RNA and activation of NF-␬B by Toll-like receptor 3. Nature 413:
732–738.
3. Yoneyama, M., M. Kikuchi, T. Natsukawa, N. Shinobu, T. Imaizumi, M. Miyagishi,
K. Taira, S. Akira, and T. Fujita. 2004. The RNA helicase RIG-I has an essential
function in double-stranded RNA-induced innate antiviral responses. Nat. Immunol.
5: 730 –737.
4. Yoneyama, M., M. Kikuchi, K. Matsumoto, T. Imaizumi, M. Miyagishi, K. Taira,
E. Foy, Y. M. Loo, M. Gale, Jr., S. Akira, et al. 2005. Shared and unique functions of
the DExD/H-box helicases RIG-I, MDA5, and LGP2 in antiviral innate immunity.
J. Immunol. 175: 2851–2858.
5. Kato, H., O. Takeuchi, S. Sato, M. Yoneyama, M. Yamamoto, K. Matsui,
S. Uematsu, A. Jung, T. Kawai, K. J. Ishii, et al. 2006. Differential roles of MDA5 and
RIG-I helicases in the recognition of RNA viruses. Nature 441: 101–105.
6. Kawai, T., K. Takahashi, S. Sato, C. Coban, H. Kumar, H. Kato, K. J. Ishii,
O. Takeuchi, and S. Akira. 2005. IPS-1, an adaptor triggering RIG-I- and Mda5mediated type I interferon induction. Nat. Immunol. 6: 981–988.
7. Meylan, E., J. Curran, K. Hofmann, D. Moradpour, M. Binder, R. Bartenschlager,
and J. Tschopp. 2005. Cardif is an adaptor protein in the RIG-I antiviral pathway and
is targeted by hepatitis C virus. Nature 437: 1167–1172.
8. Seth, R. B., L. Sun, C. K. Ea, and Z. J. Chen. 2005. Identification and characterization
of MAVS, a mitochondrial antiviral signaling protein that activates NF-␬B and IRF 3.
Cell 122: 669 – 682.
9. Xu, L. G., Y. Y. Wang, K. J. Han, L. Y. Li, Z. Zhai, and H. B. Shu. 2005. VISA is an
adapter protein required for virus-triggered IFN-␤ signaling. Mol. Cell 19: 727–740.
5789