Download Redistribution of membrane proteins between the Golgi apparatus

The Plant Journal (2002) 29(5), 661±678
Redistribution of membrane proteins between the Golgi
apparatus and endoplasmic reticulum in plants is reversible
and not dependent on cytoskeletal networks
Claude M. Saint-Jore1, Janet Evins1, Henri Batoko2, Federica Brandizzi1, Ian Moore2 and Chris Hawes1,*
1
School of Biological and Molecular Sciences, Oxford Brookes University, Headington, Oxford OX3 0BP, UK
2
Department Plant Sciences, Oxford University, South Parks Road, Oxford OX1 3RB, UK.
Received 21 August 2001; revised 5 November 2001; accepted 6 December 2001.
*For correspondence (e-mail [email protected]).
Summary
We have fused the signal anchor sequences of a rat sialyl transferase and a human galactosyl transferase
along with the Arabidopsis homologue of the yeast HDEL receptor (AtERD2) to the jelly®sh green
¯uorescent protein (GFP) and transiently expressed the chimeric genes in tobacco leaves. All constructs
targeted the Golgi apparatus and co-expression with DsRed fusions along with immunolabelling of
stably transformed BY2 cells indicated that the fusion proteins located all Golgi stacks. Exposure of
tissue to brefeldin A (BFA) resulted in the reversible redistribution of ST-GFP into the endoplasmic
reticulum. This effect occurred in the presence of a protein synthesis inhibitor and also in the absence of
microtubules or actin ®laments. Likewise, reformation of Golgi stacks on removal of BFA was not
dependent on either protein synthesis or the cytoskeleton. These data suggest that ER to Golgi
transport in the cell types observed does not require cytoskeletal-based mechanochemical motor
systems. However, expression of an inhibitory mutant of Arabidopsis Rab 1b (AtRab1b(N121I)
signi®cantly slowed down the recovery of Golgi ¯uorescence in BFA treated cells indicating a role for
Rab1 in regulating ER to Golgi anterograde transport.
Keywords: Golgi apparatus, endoplasmic reticulum, green ¯uorescent protein, cytoskeleton, brefeldin A.
Introduction
In higher plants, it is generally accepted that, with a few
exceptions (Hara-Nishimura et al., 1998), transport of
material from the endoplasmic reticulum (ER) along the
secretory pathway, to either the cell surface or the vacuolar
system, is via the Golgi apparatus (Hawes et al., 1999a).
Likewise, it has been suggested that the vectorial transport
of material out of the ER is mediated by membranebounded vesicles (Movafeghi et al., 1999; Pimpl et al.,
2000) as is the case in yeast and mammalian cells
(Klumperman 2000 and references therein). However,
both in vivo and in vitro evidence for the existence of
such vesicles in plants is scant. With the exception of
various unicellular algae, electron microscopy has failed to
produce convincing evidence of either exit sites from the
ER, i.e. areas from which vesicle bud or for transition
vesicles themselves (Hawes et al., 1996). In contrast, there
have been various reports of direct tubular connections
between the ER and Golgi in cells producing storage
ã 2002 Blackwell Science Ltd
protein such as those found in the developing cotyledons
of legume seeds (Harris and Oparka, 1983; Hawes et al.,
1996).
The spatial relationship between the organelles of the
secretory pathway is maintained by the cytoskeleton. In
mammalian cells, both the organisation of, and communication between the endoplasmic reticulum and the Golgi
apparatus, are dependent on the microtubule cytoskeleton
and its associated proteins such as dynein and kinesin
(Allan and Schroer 1999; Harada et al., 1998; Roghi and
Allan, 1999). However, Golgi membranes also appear to
contain myosins, which may indicate the ability to undertake actin based motility under certain conditions (Allan
and Schroer, 1999; Buss et al., 1998). In plants it appears
that the actin network is the major cytoskeletal component
maintaining the spatial organisation of the Golgi apparatus (Boevink et al., 1998; NebenfuÈhr et al., 1999; SatiatJeunemaitre et al., 1996), and regulating the organisation
661
662
Claude M. Saint-Jore et al.
ã Blackwell Science Ltd, The Plant Journal, (2002), 29, 661±678
Redistribution of membrane proteins
and movement of the ER network (Boevink et al., 1998;
Liebe and Quader, 1994; Quader, 1990).
Application of ¯uorescent protein technology has
started to revolutionise plant cell biology and the study
of the secretory pathway is no exception. It is now possible
to observe in vivo the dynamic events of secretion and
endomembrane organisation (Boevink et al., 1996, 1998,
1999; NebenfuÈhr et al., 1999). Delivering GFP to the Golgi
apparatus by the addition of targeting regions of Golgi
transferases (Boevink et al., 1998; Essl et al., 1999) or
complete enzymes (NebenfuÈhr et al., 1999) has demonstrated that in suspension culture cells, leaf epidermal
cells, hypocotyls, and roots (Saint-Jore, Moore and Hawes
unpublished) individual Golgi stacks to be highly dynamic,
moving not only in the general cytoplasmic stream but in
more de®ned patterns at the cortex of cells. With a
construct comprising the Arabidopsis HDEL receptor
homologue (Bar-Peled et al., 1995) and GFP (AtERD2GFP)
we have also demonstrated that both the ER and Golgi can
be targeted in leaf epidermal cells of Nicotiana clevelandii
(Boevink et al., 1998). The surprising result was that Golgi
bodies were apparently closely associated with, and
tracked over the surface of the polygonal network of
cortical ER tubules. This ER network overlaid the cortical
actin cytoskeleton, which when disrupted resulted in
cessation of Golgi movement without disrupting the ER
geometry. Use of the fungal macrocyclic lactone brefeldin
A (BFA) induced retrograde transport of these constructs
into the ER of tobacco leaf cells, a phenomenon which was
reversible on removal of the drug (Boevink et al., 1998).
Although it appears that Golgi movement in plants is
mediated by the actin cytoskeleton, the role of the
cytoskeleton in the vectorial transport of material between
putative exit sites on the ER and the cis-Golgi is unknown,
as is the mode of retrograde retrieval of Golgi proteins to
the ER. By utilising the BFA effect combined with transient
expression (Batoko et al., 2000) of Golgi targeted GFP
constructs or stably transformed BY-2 cells, cytoskeletal
inhibitors and immunocytochemistry, we show here that
BFA mediated retrograde transport to the ER and ante-
663
rograde recovery of Golgi membrane from the ER is
insensitive to the action of cytoskeletal inhibitors.
However, expression of a dominant-inhibitory mutant of
the Arabidopsis Rab GTPase AtRab1b (Batoko et al., 2000)
had no effect on BFA induced retrograde transport of Golgi
targeted GFP but inhibited recovery of Golgi on BFA
release. These observations pose important questions on
the nature of the physical relationship between the two
organelles.
Results
GFP constructs target the Golgi apparatus in tobacco
leaves and BY-2 cells
In tobacco leaves, GFP when fused to the signal anchor
sequences of a rat sialyl transferase (ST-GFP) and
transiently expressed using Agrobacterium in®ltration
targeted a system of highly motile ¯uorescent structures
(Figure 1a). A human galactosyl transferase signal anchor
sequence construct (GT-GFP, Zaal et al., 1999) and the
Arabidopsis ERD2-GFP also targeted motile ¯uorescent
structures (Figure 1b,c), but also often showed ¯uorescence of the ER. It was assumed that the ¯uorescent
bodies were individual Golgi stacks as described previously by Boevink et al. (1998). In transformed BY2 cells STGFP again labelled Golgi-like structures (Figure 1d,e). One
of the properties of GFP is that the ¯uorophore retains its
capability to ¯uoresce after chemical ®xation. This enabled
the staining ST-GFP cells with JIM84, a Golgi marker
antibody, revealing that JIM84 epitopes co-localised with
the GFP tagged structures (Figure 1f,g,h). To con®rm that
our constructs labelled the same population of Golgi we
co-expressed, in tobacco leaves, AtERD2-GFP and the red
¯uorescent protein, DsRed, fused to the sialyl transferase
signal anchor sequence. Figure 1(i,j,k) shows that in cells
expressing low levels of the DsRed construct, the two
¯uorescent proteins co-localise, indicating that it is likely
that each construct targets every Golgi body in the cell.
Figure 1. Expression of Golgi targetted constructs in tobacco leaves and BY2 cells.
(a) ST-GFP locates to Golgi bodies in the cortical cytoplasm of a leaf epidermal cell. Note lack of expression in guard cells (arrows) which are rarely
infected by the agrobacteria. Bar = 25 mm.
(b) GT-GFP locates to Golgi bodies and also faintly highlights the ER network. Bar = 25 mm.
(c) AtERD2-GFP locates to the Golgi and to the ER network. Visualisation of the ER depends on expression levels and often necessitates saturation of the
Golgi signal (see also Boevink et al., 1998). Bar = 15 mm.
(d,e) Stable expression of ST-GFP in BY2 cells showing distribution of Golgi bodies in the cortical cytoplasm (d) and in the same cell at a different focal
plane surrounding the nucleus and in transvacuolar strands (e). Bar = 10 mm (d) and 25 mm (e).
(f±h) Colocalisation of ST-GFP with the Golgi marker antibody JIM84 in transformed BY2 cells. ST-GFP distribution in a ®xed cell (f) colocalises (h) with the
JIM84 antigen detected with a Texas red conjugated second antibody (g). Bar = 25 mm.
(i±k) Co-localisation of AtERD2-GFP (i) with ST-DsRed (j) represented in blue (k) with the Zeiss LSM410 co-localisation software. Bar = 10 mm.
(l) Actin labelling with rhodamine phalloidin in BY2 cells expressing ST-GFP. Actin and Golgi are closely associated and Golgi bodies align on actin cables
(insert). Bar = 10 mm.
(m) Immunolocation of cortical microtubules (red) in BY2 cells expressing ST-GFP. Note, in many cells Golgi ¯uorescence was often located in a different
focal plane to the microtubules (data not shown). Bar = 10 mm.
ã Blackwell Science Ltd, The Plant Journal, (2002), 29, 661±678
664
Claude M. Saint-Jore et al.
ã Blackwell Science Ltd, The Plant Journal, (2002), 29, 661±678
Redistribution of membrane proteins
Staining of the actin cytoskeleton in BY2 cells with
rhodamine labelled phalloidin revealed a close association
between Golgi bodies and actin (Figure 1l), with Golgi
bodies aligned along actin cables (Figure 1l insert) as
previously reported for tobacco leaves (Boevink et al.,
1998). However, there generally appeared to be less coalignment between the cortical microtubules and Golgi
bodies (Figure 1m) with the cortical Golgi bodies most
often being located in a different confocal (focal) plane to
the cortical microtubules (data not shown).
665
cence in the ER indicating successful inhibition of GFP
synthesis (Figure 2f). Also, leaves in®ltrated with higher
titres of Agrobacterium expressing secGFP showed low
level of ER ¯uorescence indicating build up of GFP in the
ER lumen prior to secretion. Treatment of these leaves
with cycloheximide resulted in gradual loss of ¯uorescence in the ER over 4 h consistent with inhibition of new
BFA induces redistribution of Golgi proteins into the ER
Treatment of tobacco leaves expressing ST-GFP with
180 mM BFA for 30±60 min, results in cessation of Golgi
movement over the ER followed by some clumping of the
Golgi and ®nally the disappearance of ¯uorescent Golgi
stacks and redistribution of ¯uorescence in the polygonal
ER network (Figure 2a). Likewise, a similar treatment of
AtERD2-GFP expressing leaves resulted in an increase in
ER ¯uorescence and disappearance of Golgi (Figure 2b).
This agrees with the data of Boevink et al. (1998) who used
a viral expression system to target GFP to the Golgi.
BFA is known to inhibit export of some newly synthesised proteins from the ER (Batoko et al., 2000; Boevink
et al., 1999). To rule out the possibility that the BFAinduced accumulation of ST-GFP and ERD2-GFP in the ER
resulted from the synthesis of new ST-GFP in the ER and
loss from the Golgi by secretory activity, we conducted the
experiments above in the presence of cycloheximide. To
verify that cycloheximide can inhibit the accumulation of
new GFP in this system, we investigated the effect of
cycloheximide on the accumulation of a secreted GFP,
secGFP (Batoko et al., 2000). Leaf cells expressing a
secretory form of GFP at levels suf®cient to cause visible
accumulation of ¯uorescence in the apoplast (Figure 2d,
see also Batoko et al., 2000) were treated with BFA for up to
4 h to block secretion and trap GFP in the ER (Figure 2e).
Treatment with 100 mM cycloheximide along with the BFA
prevented any signi®cant accumulation of GFP ¯uores-
Figure 3. Modi®cation of glycans on an ER-resident protein after BFA
treatment.
Leaf samples expressing a myc-tagged N-GFP-HDEL were incubated in
water or water plus 180 mM BFA for 3 h. Protein extracts were subjected
to endo-H digestion prior to SDSA-PAGE. N-GFP-HDEL was detected with
a cMyc antibody. BFA treatment confers endoglycosidase H resistance on
the glycosylated construct indicating a retrograde transfer of medial to
trans-Golgi glycosyl transferases to the ER in response to the drug (a).
In contrast, expression of the mutant (N121I) form of At Rab1b did not
confer resistance to endoglycosidase H (b).
Figure 2. Effect of BFA on Golgi targetted constructs.
(a) Treatment of ST-GFP expressing tobacco leaf epidermal cells with 180 mM BFA for 4 h results in complete loss of Golgi ¯uorescence accompanied a
dramatic increase in ER ¯uorescence. Note lamellate areas of ER in the cortical network, a common feature of BFA treatment. Bar = 25 mm.
(b) BFA at 180 mM for 2.5 h causes the redistribution of Golgi ¯uorescence into the ER in AtERD2-GFP expressing tobacco leaf cells. Bar = 25 mm.
(c) Redistribution of ST-GFP into the ER of transformed BY2 cells after treatment at 180 mM for 2.5 h. Bar = 25 mm.
(d) Secreted GFP locates to the apoplast in transiently expressing tobacco leaf epidermal cells. Bar = 50 mm.
(e) BFA treatment at 360 mM for 3 h results in blockage of secretion and retention of GFP in the ER. Bar = 10 mm.
(f) Leaf tissue treated as in e but also in the presence of 100 mm cycloheximide for 3 h. Note there is no new synthesis of GFP in the ER. Bar = 50 mm.
(g±l) Time course of BFA (360 mM) treatment on BY2 cells. Initially Golgi show some clumping before ER and nuclear envelope ¯uorescence can be
observed. Note that not all Golgi are reabsorbed into the ER. Bar = 50 mm.
(m) The cortical network of ER in a ST-GFP transformed BY2 cells after 180 mM BFA for 6 h. Note that the polygonal network of ER tubules are
interdispersed with small patches of ER lamellae. Bar = 25 mm.
(n) Location of Golgi in ®xed wild type BY2 cells with the monoclonal antibody JIM84. Bar = 25 mm.
(o) Immuno-location of the JIM 84 epitope in BY2 cells after 180 mM BFA for 2 h showing labelling of the ER and Golgi clumps. Note that in such
preparations the morphology of the ER network is affected by the ®xation protocol. Bar = 10 mm.
ã Blackwell Science Ltd, The Plant Journal, (2002), 29, 661±678
666
Claude M. Saint-Jore et al.
Figure 4. BFA treatment reveals ER in the mitotic apparatus.
(a) Metaphase showing aggregations of ER expressing ST-GFP around the spindle. Bar = 25 mm.
(b) Late telophase showing ER accumulating at the phragmoplast and extending between the phragmoplast and the daughter nuclei. Bar = 25 mm.
(c) Late telophase as in (b) but after depolymerisation of the actin cytoskeleton with latrunculin B prior to BFA treatment. Bar = 25 mm.
(d±f) Location of Golgi (d) and microtubules (e) in a telophase cell showing almost complete exclusion of Golgi from the phragmoplast area (f).
Bar = 10 mm.
(g±i) Location of ST-GFP (g) and microtubules (h) in a BFA treated cell showing ER interdispersed with the phragmoplast microtubules array (i).
Bar = 10 mm.
GFP synthesis and secretion of the residual ER located
secGFP (data not shown).
A similar redistribution of ¯uorescence was obtained on
treating ST-GFP BY2 cells with BFA (Figure 2c) where a
time series of micrographs revealed an initial clumping of
Golgi, followed by redistribution into the ER over 25 min
(Figure 2g-l). A full movie sequence of this event can be
viewed at http://www.brookes.ac.uk/schools/bms/research/
molcell/hawes/gfpmoviepage.html. Such redistribution
into the ER revealed the classical cortical network arrangeã Blackwell Science Ltd, The Plant Journal, (2002), 29, 661±678
Redistribution of membrane proteins
667
Figure 5. BFA induces retrograde transport of Golgi targetted ST-GFP in the presence of cycloheximide and cytoskeletal inhibitors.
(a±d) BY2 cells expressing ST-GFP showing BFA induced redistribution of ¯uorescence into the ER in the presence of 100 mM cycloheximide for 2 h
(a) 28.9 mM oryzalin for 1.5 h (b), 39.4 mM cytochalasin D for 1.5 h (c) and 265 mM latrunculin B for 1 h (d). Note the almost complete conversion of the
polygonal cortical ER network to a large fenestrated sheet in one cells (c). Bars = 25 mm.
(e±f) BFA induced retrograde transport of ST-GFP in tobacco leaf epidermal cells in the presence of 39.4 mM cytochalasin D for 2 h (e) and 28.9 mM oryzalin
for 1.5 h (f). Bars = 25 mm.
ment of ER tubules (Figure 2m). BFA treatment also
resulted in distinct morphological changes to the cortical
ER network in that with increasing time in the drug the
network formed small lamellae at the vertices of the
ã Blackwell Science Ltd, The Plant Journal, (2002), 29, 661±678
network tubules (Figure 2m) and in many cells the network
converted into large fenestrated sheets of ER membrane
(Figure 5c) as has been previously reported for a soluble
ER targeted GFP (Boevink et al., 1999).
668
Claude M. Saint-Jore et al.
ã Blackwell Science Ltd, The Plant Journal, (2002), 29, 661±678
Redistribution of membrane proteins
Immuno¯uorescence of BFA treated cells also revealed a
redistribution of the JIM84 epitope into the ER of wild type
BY2 cells, although some clumps of Golgi material also
remained in the cytoplasm (Figure 2n,o). As this antibody
recognises a glycan antigen resident on many Golgi
proteins (Fitchette et al., 1999; Horsley et al., 1993) the
effect of BFA is not restricted to the redistribution of our
chimeric GFP constructs.
To con®rm the above data indicating that the BFA effect
was a true retrograde redistribution of Golgi membrane
proteins into the ER we biochemically tested the endoglycosidase H (endo H) sensitivity of a glycosylated ER
targeted GFP construct (N-GFP-HDEL) after BFA treatment.
Treatment of protein extracts from tobacco leaves transiently expressing N-GFP-HDEL revealed that the construct in
the ER was glycosylated and sensitive to the enzyme.
However, after treatment with 180 mM BFA for 3 h all the
GFP had acquired endo H resistance indicating the BFA
induced presence of mid to late Golgi glycosyl transferases
in the ER (Figure 3a). We carried out a similar experiment
on leaves transiently expressing N-GFP-HDEL along with a
mutant form of the Arabidopsis small GTPase Rab1b
(AtRab1b(N121I; Batoko et al., 2000) which has been
shown to inhibit ER to Golgi transport and to cause
increased accumulation of ST-GFP in the ER. As can be
seen in Figure 3b N-GFP-HDEL in leaves expressing
AtRab1b(N121I) remained Endo H sensitive indicating that
inhibition of forward membrane traf®c by At-Rab1b(N121I)
was not suf®cient to cause accumulation of detectable
Golgi transferase activity in the ER. These biochemical data
are consistent with the complete loss of morphologically
distinct Golgi structures in BFA-treated cells in contrast to
the persistence of GFP-labelled Golgi stacks in the presence
of At-Rab1b(N121I) (Batoko et al., 2000).
One unexpected feature of BFA treatment on BY2 cells
expressing ST-GFP cells was the highlighting of mitotic
pro®les by a characteristic distribution of ER around the
spindle apparatus and phragmoplast. Thus, highly characteristic patterns of ER surrounding and running through
metaphase spindles were revealed (Figure 4a) and in
telophase, the new nuclear envelopes, ER compacted
around the phragmoplast and membrane spanning the
669
nuclear envelopes and phragmoplast were revealed
(Figure 4b). These pro®les were also observed after BFA
treatment following actin depolymerisation in the presence of latrunculin B (Figure 4c). Immunostaining of
telophase cells with anti-tubulin revealed a classic phragmoplast array of microtubules, which appeared to exclude
the majority of Golgi bodies (Figure 4d,e,f). However, BFA
treatment appeared not to interfere with the cytoskeleton
but revealed ER tubules interdispersed with the phragmoplast microtubules (Figure 4g,h,i).
Brefeldin A induces redistribution of Golgi proteins in the
presence of cytoskeletal inhibitors
In plant cells the movement, and to a certain extent the
distribution, of ER and Golgi appears to be dependent on
the actin cytoskeleton (Boevink et al., 1998; Quader, 1990).
To test whether cytoskeletal elements are necessary for the
redistribution of Golgi membrane proteins into the ER we
carried out a series of experiments in the presence of
various inhibitors.
In BY2 cells the redistribution of ST-GFP with BFA was
not affected by pre-treatment with the protein synthesis
inhibitor cycloheximide (Figure 5a), by the microtubule
inhibitor oryzalin (Figure 5b) or by the actin inhibitors
cytochalasin D and latrunculin B (Figure 5c,d). Similar
results were obtained for tobacco leaf cells expressing STGFP (Figure 5e,f).
The effects of the cytoskeletal inhibitors were also
assessed by the use of af®nity probes and immuno¯uorescence. In BY2 cells expressing ST-GFP the cortical actin
cytoskeleton was unaffected by BFA treatment whilst the
ER appeared in the form of cortical sheets and tubules
(compare Figure 6a with Figure 6b). Treatment with cytochalasin D resulted in the disappearance of major actin
cables leaving short stubby actin ®laments in the cytoplasm (Figure 6c) whereas latrunculin B resulted in the
depolymerisation of the majority of the actin cytoskeleton
(Figure 6d). In both cases, depolymerisation of the actin
cytoskeleton induced cessation of long-range Golgi movement but BFA treatment still resulted in disappearance of
the ¯uorescent Golgi bodies and ¯uorescence of the ER
Figure 6. Merged images showing af®nity labelling of actin and microtubules (red channel) in BY2 cells expressing ST-GFP (green channel) before and
after treatment with cytoskeletal disrupting agents and BFA.
(a,b) The cortical actin cytoskeleton (a) is not disrupted by 180 mM BFA treatment for 5 h and large sheets of green ER can be seen associated with the
cortical actin (b). Bars = 10 mm.
(c,d) Disruption of the actin cytoskeleton with 39.4 mM cytochalasin D for 1.3 h, which leaves some short stubs of ®laments (c), and 10 mm latrunculin B for
1 h which completely disperses the actin cytoskeleton (d), results in some clumping of Golgi stacks. Bars = 10 mm (c), 25 mm (d).
(e,f) Disruption of the actin cytoskeleton with 39.4 mM cytochalasin D for 1.5 h (e) and 25 mm latrunculin B for 1 h (f) does not disturb the effect of BFA
which results in the formation of large cortical sheets of ER. Bars = 25 mm.
(g,h) The cortical microtubule cytoskeleton (g) is not disrupted by 180 mM BFA treatment for 3 h (h). Bars = 10 mm (g), 25 mm (h).
(i,j) Depolymerisation of the microtubule cytoskeleton with 28.9 mM oryzalin for 1 h (i) does not affect Golgi distribution (or movement) and does not
disturb the BFA affect (j). Bars = 10 mm.
ã Blackwell Science Ltd, The Plant Journal, (2002), 29, 661±678
670
Claude M. Saint-Jore et al.
Figure 7. Recovery of Golgi ¯uorescence after BFA removal does not require the cytoskeleton and can be independent of protein synthesis.
(a) Reformation of ¯uorescent Golgi in BY2 cells expressing ST-GFP after removal into fresh medium minus BFA for 3.5 h. Note some residual ER
¯uorescence remains. Bar = 25 mm.
(b) Reformation of Golgi in the presence of 28.9 mM oryzalin for 7 h. Bar = 10 mm.
(c,d) Reformation of Golgi in the presence of 39.4 mM cytochalsin D for 7 h (c) and 25 mM latrunculin B for 15 h (d). Bars = 10 mm (c), 25 mm (d).
(e) Reformation of Golgi in the presence of 100 mm cycloheximide for 15 h. Bar = 10 mm.
(f,g) ST-GFP in ®xed cells after 7 h recovery from BFA (f) colocates with the JIM84 epitope (g) con®rming anterograde transport of the construct into newly
formed Golgi bodies. Bar = 10 mm.
(h±k) Reformation of Golgi in tobacco leaf epidermal cells after incubation of BFA treated leaves for 15 h in water (h), cycloheximide (i), cytochalasin D (j)
and 9 h in oryzalin (k).
Note, some residual ¯uorescence in the ER can be seen in the cells. Bars = 25 mm.
ã Blackwell Science Ltd, The Plant Journal, (2002), 29, 661±678
Redistribution of membrane proteins
671
Figure 8. Co-expression of AtRab1b(N121I) with ST-GFP and N-secYFP in tobacco leaf epidermal cells slows the recovery of Golgi ¯uorescence after BFA
treatment.
Treatment of ST-GFP and N-secYFP expressing tobacco leaf epidermal cells (a) with 180 mM BFA for 3 h results in ¯uorescence of the ER (b) and Golgi
¯uorescence recovers after 7 h incubation in water (c).Co-expression of ST-GFP/N-secYFP with AtRab1b(N121I) results in ¯uorescence of ER and Golgi (d,
see also Batoko et al., 2000) and treatment with 180 mM BFA for 4 h results in disappearance of Golgi ¯uorescence along with an increase in ER
¯uorescence (e).
After 8 h incubation in water, recovery from the drug can be seen to be impeded by co-expression of AtRab1b(N121I) while the ER remains brightly
¯uorescent (f). A comparison of the two BFA recovery experiments at higher magni®cation: (g) recovery in absence of Rab mutant, (h) recovery in
presence of Rab mutant. Bars = 25 mm.
often in the form of large cortical sheets (Figure 6e,f).
Similarly, BFA had no effect on the arrangement of the
cortical microtubule cytoskeleton (Figure 6g,h), whilst
depolymerisation of the microtubule cytoskeleton with
oryzalin had no effect on the distribution of the Golgi
apparatus (Figure 6i) nor on BFA induced redistribution of
the Golgi targeted GFP constructs (Figure 6j and compare
with Figure 2o).
ã Blackwell Science Ltd, The Plant Journal, (2002), 29, 661±678
The effect of cytochalasin D on ST-GFP labelled Golgi
has previously been reported in tobacco leaves (Boevink
et al., 1998). Using the freeze-shatter technique to immunostain tobacco leaf epidermal cell microtubules we con®rmed that oryzalin induced depolymerisation of leaf
microtubules. In the presence of either drug, BFA-induced
redistribution of ST-GFP into the ER was observed as in
BY2 cells (data not shown).
672
Claude M. Saint-Jore et al.
Reformation of Golgi stacks can take place in the
absence of the cytoskeleton
On removal of BFA from treated BY2 cells, new Golgi
bodies are formed over a period of about 5 h along with a
loss of ¯uorescence intensity in the ER (Figure 7a) as has
previously been demonstrated in tobacco leaves using a
viral expression system (Boevink et al., 1998). This recovery can also occur in the presence of the three cytoskeletal
inhibitors (Figure 7b,c,d) and remarkably in the presence
of cycloheximide (Figure 7e). This reformation of the Golgi
can also be monitored not only by the presence of the GFP
constructs in the ¯uorescent Golgi bodies but also by the
presence of the JIM84 epitope after immuno¯uorescence
staining (Figure 7f,g). A similar pattern of recovery after
treatment with cycloheximide, cytochalasin D and oryzalin,
was also observed in BFA treated leaf segments
(Figure 7h-k).
At-Rab1b(N121I) inhibits recovery of Golgi stacks on
withdrawal of BFA
To investigate whether BFA-induced alterations in ER and
Golgi organisation are dependent on normal vesicle
transport, we investigated the effect of a mutant form of
the regulatory GTPase, At-Rab1 which has been shown to
inhibit transport of a secretory GFP marker between the ER
and Golgi (Batoko et al., 2000). In order to con®rm that
mutant protein was expressed in the cells imaged, plants
were co-in®ltrated with ST-GFP and a secretory version of
YFP (N-secYFP) which, like secGFP (Batoko et al., 2000),
accumulates in the ER upon any blockage of ER to Golgi
transport (¯uorescence data from GFP and the accumulated N-secYFP were collected from the same confocal
detector). Using transient expression in tobacco leaves,
BFA induced accumulation and/or redistribution of ¯uorescence in the ER, with recovery of Golgi bodies after
removal of the drug (Figure 8a-c,g). Co-expression of the
AtRab1b(N121I) mutant protein with ST-GFP and N-secYFP
in tobacco leaves resulted in increased accumulation of
¯uorescence in the ER compared with control leaves as
reported by Batoko et al. (2000), without signi®cant loss of
Golgi ¯uorescence (compare Figure 8a and Figure 8d).
This con®rmed some inhibition of ER to Golgi transport by
the dominant-inhibitory Rab1 mutant. Treatment of such
leaf cells with BFA for 4 h resulted in total loss of Golgi
¯uorescence along with an increase in intensity of ER
¯uorescence (Figure 8e), due to ST-GFP redistribution
alongside accumulation of N-secYFP, indicating that redistribution of ST-GFP is not affected by Rab1 inhibition. In
control leaves incubated in water for an equivalent period
there was no disruption of Golgi. However, in the leaves
expressing the At-Rab1b(N121I) mutant there was a greatly
reduced recovery of Golgi ¯uorescence 7 h after removal
of BFA while the ER remaining brightly ¯uorescent as
expected in the presence of N-secYFP and the AtRab1b(N121I) mutant (Figure 8f, and compare Figure 8g
with Figure 8h). This retention of ER ¯uorescence was
apparent up to 20 h after removal of the BFA and was not
observed in leaves recovering from BFA treatment without
AtRab1b(N121I) expression where Golgi reformed. The
BFA recovery phenotype was also rescued by the coexpression of wild type AtRab1b along with the mutant
(data not shown) indicating that the inhibition of recovery
from the BFA phenotype was indeed due to loss of
AtRab1b function (see Batoko et al., 2000 for discussion).
Discussion
Targeting GFP to the plant Golgi apparatus
It has been shown that the signal anchor sequences of
both mammalian and plant glycosyl transferases are
suf®cient to target GFP to the Golgi apparatus in tobacco
(Boevink et al., 1998; Essl et al., 1999). Here we also show
that the C-terminal 60 amino acids of a human b-1,4galactosyl transferase composing the signal anchor
sequence is also suf®cient to target GFP to the plant
Golgi. Targeting of GFP constructs to the plant Golgi has
now been reported using various expression systems: viral
(Boevink et al., 1998; Essl et al., 1999); biolistics (Baldwin
et al., 2001; Takeuchi et al., 2000); Agrobacterium-mediated
(Batoko et al., 2000 and this report); and stable in suspension culture cells (this report). Similar ¯uorescent patterns
also result from the expression of complete Golgi proteinGFP constructs in leaves and suspension cultures (Baldwin
et al., 2001; NebenfuÈhr et al., 1999; this report). We have
also successfully expressed the AtERD2 and ST constructs
reported here in transformed Arabidopsis plants (SaintJore, Moore and Hawes unpublished). Co-expression of
the AtERD2-GFP with ST-DsRed (Matz et al., 1999) in leaves
and immunolabelling of ST-GFP cells with JIM 84 in BY2
cells con®rmed that in all cases, all the Golgi stacks in cells
were targeted with the ¯uorescent proteins and we have
no evidence of differential targeting to subsets of Golgi.
Expression of AtERD2-GFP and GT-GFP also con®rmed the
previous report (Boevink et al., 1998) that leaf Golgi are
closely associated with the cortical endoplasmic reticulum
and track over the polygonal network of ER tubules. Of the
three constructs, as ST-GFP showed the lowest level of ER
labelling, it was decided to use this as the marker of choice
for further experiments.
BFA induces retrograde redistribution of GFP constructs
to the ER
BFA has long been used as a drug by which the mechanisms of protein transport within the secretory system can
ã Blackwell Science Ltd, The Plant Journal, (2002), 29, 661±678
Redistribution of membrane proteins
be investigated (Klausner et al., 1992; Satiat-Jeunemaitre
et al., 1996). The most apparent effect in mammalian cells
is the induction of a rapid recycling of Golgi enzymes and
membrane into the ER via a tubule mediated fusion
process driven by microtubules (Lippincott-Schwartz
et al., 1990). At the molecular level BFA prevents the
budding of COPI vesicles on membranes by inhibiting the
recruitment of the GTP form of ADP ribosylation factor
(ARF) onto cisternae, thus preventing the construction of
the vesicle coat from the coatomer subunits (Donaldson
et al., 1992; Helms and Rothman, 1992). One molecular
target of the drug is a 200 amino acid domain identi®ed
from the sec7 gene product found in various guanine
nucleotide exchange factors (GEF, Mansour et al., 1999;
Robineau et al., 2000). Speci®c residues in Sec7p appear to
be critical for BFA action (Peyroche et al., 1999; Sata et al.,
1998) preventing the GDP/GTP exchange on ARF
(Donaldson et al., 1992).
Before the advent of GFP technology the structural
effects of BFA on plant cells were described, mainly form
ultrastructural observations coupled with a few immunocytochemical reports (Satiat-Jeunemaitre and Hawes,
1992; Satiat-Jeunemaitre et al., 1996; Staehelin and
Driouich, 1997). In roots it had been shown that in some
species the drug induces a trans-face vesiculation of the
Golgi and the formation of so called `BFA compartments'
(Satiat-Jeunemaitre and Hawes, 1992; Wee et al., 1998). In
other tissues authors reported on the redistribution of
Golgi membranes to the ER, but with no marker proteins to
visualise the Golgi, such evidence was weak (Rutten and
Knuiman, 1993; Yasuhara et al., 1995).
With the publication of the ®rst Golgi targeted GFP
constructs in planta, it was shown that in tobacco leaves
BFA appeared to induce a retrograde delivery of Golgi
targeted ST signal anchor sequence and AtERD2-GFP
chimeras back to the ER (Boevink et al., 1998). The wild
type, slow folding GFP, was utilised in this latter study,
suggesting that the BFA induced ER ¯uorescence was due
to retrograde transport and not the translation and folding
of new GFP within the ER. However, no evidence was
available to prove that the ER resident GFP originated from
the Golgi. In this report we have shown the protein
synthesis inhibitor cycloheximide can inhibit the production of a secretory form of GFP, as the BFA induced ER
retention of secGFP, previously reported by Batoko et al.
(2000), was inhibited by the drug. We therefore carried out
BFA experiments in the presence of the inhibitor demonstrating that ER ¯uorescence is indeed a result of redistribution of pre-existing GFP chimeric proteins and not a
result of blockage of GFP export from the ER followed by
accumulation of newly folded GFP in the ER. This result
was also con®rmed by the presence of an endo-H resistant
form of a glycosylated GFP construct in BFA treated
leaves suggesting the relocation of some Golgi transferase
ã Blackwell Science Ltd, The Plant Journal, (2002), 29, 661±678
673
activity to the ER. In contrast, inhibition of anterograde
transport by the expression of a dominant inhibitory
mutant of At-Rab1 did not cause accumulation of an
endo-H resistant form of ER resident GFP. Similar GFP
redistribution was also observed in both tobacco leaves
and BY2 cells, and immunocytochemical staining with the
Golgi marker antibody JIM 84 showed redistribution of the
JIM84 Lewis A type glycan epitope into the ER of BY2 cells.
Previously, such immunocytochemistry on BFA treated
maize roots showed JIM84 staining to be located in the
Golgi derived `BFA compartments' and not in the ER
(Satiat-Jeunemaitre and Hawes, 1992; Wee et al., 1998).
Recently BFA has been shown to induce clumping of Golgi
in onion epidermal cells expressing a GFP tagged
Arabidopsis GDP-mannose transporter with no apparent
redistribution of the protein into the ER (Baldwin et al.,
2001), indicating that there can indeed be a variety of
responses of plant tissues to BFA.
The molecular target and major site of action of BFA in
plant cells has yet to be con®rmed. However, at the
structural level it has been shown, using both virus and
Agrobacterium-based expression systems in tobacco
leaves, that BFA treatment results in the inhibition of the
export of a secretory form of GFP and its accumulation in
the fused ER-Golgi compartment that arises from BFA
treatment (Batoko et al., 2000; Boevink et al., 1999). If BFA
initially causes inhibition of export from ER prior to its
fusion with the Golgi, and, if a continual recycling of Golgi
material to and from the ER occurs, inhibition of the
anterograde pathway by BFA could result in an imbalance
in the usual Golgi membrane cycling, resulting in reabsorption into the ER. However, this data does not preclude
a lesser effect of BFA on the trans-Golgi as previously
reported in roots. Interestingly, reports in the mammalian
literature have suggested that remnants of Golgi can
remain after BFA treatments which are free of glycosylation enzymes but contain matrix proteins such as Golgin
(Seeman et al., 2000). The other, and more generally
accepted possibility is that the principal site of BFA action
would be, as suggested for mammals and yeast, in the
inhibition of COPI coats on retrograde Golgi derived
transport vesicles (Donaldson et al., 1992; Helms and
Rothman, 1992). This would result in the breakdown of
the physical discontinuity between Golgi and ER and the
formation of tubular connections between the organelles
resulting in an effective merging of the two structures
(Lippincott-Schwartz et al., 1989, 1990). The intracellular
accumulation of secreted markers such as secGFP may
then result secondarily from the inability of this fused
organelle to sustain anterograde transport to post-Golgi
compartments. However, tubulation of the GFP expressing
Golgi at the confocal level was not seen in any of our
experiments, though considering the close physical proximity of the two organelles and the possibility that sites of
674
Claude M. Saint-Jore et al.
membrane exchange are localised and transient, any such
tubules may well be missed.
As previously reported, the BFA phenotype can easily be
reversed on removal of the drug (Boevink et al., 1998;
Satiat-Jeunemaitre and Hawes, 1992) with the Golgi
reforming, over a number of hours, apparently from the
ER network. Surprisingly there was also some reformation
of Golgi-like structures in the presence of cycloheximide,
which suggests that the proteins required for Golgi
reformation, including the many that are required to
sustain ER to Golgi transport (Andreeva et al., 2000), can
retain activity over the time course of such an experiment.
A feature of BFA treated cells was the appearance of
mitotic pro®les due to extensive ER ¯uorescence, con®rming the extensive accumulation of ER at the mitotic spindle
poles, around the spindle and at the phragmoplasts, as
previously reported by electron microscopy (Hawes et al.,
1981) and immunolabelling (Gunning and Steer, 1996).
Such a result indicates that redistribution of membrane
from the Golgi to the ER can take place during the division
process and that the membrane protein can disperse
around the ER into areas that were previously devoid of
Golgi (compare Figure 3f and Figure 3i). Alternatively, and
in our opinion a more unlikely scenario, is that BFA treated
cells could continue the mitotic process in the absence of
functional Golgi stacks. It is accepted that in mammalian
cells during mitosis, anterograde export from the ER is
inhibited and the Golgi is dispersed (Lippincott-Schwartz
and Zaal 2000), but experiments with GFP tagged galactosyl transferase have shown continued retrograde transport
of the construct into the ER during early stages of mitosis
resulting in a complete reabsorption of Golgi enzymes into
the ER (Zaal et al., 1999). In plant cells Golgi bodies remain
intact during mitosis and cytokinesis and there is no
information as to whether the secretory pathway is
inactivated at any stage during the division process.
Interestingly NebenfuÈhr et al. (2000) reported faint ER
¯uorescence during anaphase in a BY2 line expressing a
soybean a-1,2-mannosidase-GFP chimera. One explanation was that this represented an up-regulation of the
retrograde pathway during mitosis. However, in our STGFP cells we saw no evidence of ER ¯uorescence during
mitosis and cytokinesis (Figure 3d). The distribution of ER
at the spindle poles, around the spindle apparatus and at
the phragmoplast revealed by BFA treatment, corresponded exactly to that previously reported in non-drug
treated plant cells by electron microscopy (Hawes et al.,
1981), by immuno¯uorescence (Gunning and Steer, 1996)
and with a GFP-HDEL construct (NebenfuÈhr et al., 2000).
The cytoskeletal networks do not mediate the BFA effect
Transport from the ER to the Golgi in mammalian cells is
mediated by the microtubule cytoskeleton and is sensitive
to microtubule inhibitors (Thyberg and Moskalewski,
1999). However, as it has previously been shown that
actin is responsible for Golgi positioning and movement in
plant cells (Boevink et al., 1998; NebenfuÈhr et al., 1999;
Satiat-Jeunemaitre et al., 1996), the role of the cytoskeleton
in the BFA effect in leaves and BY2 cells was investigated.
Both F-actin inhibiting drugs, cytochalasin D and latrunculin B suppressed Golgi movement as expected but surprisingly did not inhibit the retrograde transport of ST-GFP
in the presence of BFA. This indicates that an actin network
is not required for the BFA induced redistribution of Golgi
to ER. Likewise the microtubule depolymerising drug
oryzalin did not inhibit either Golgi movement or the
BFA effect. Recovery of Golgi bodies was observed on
removal of BFA after depolymerisation of the cytoskeleton
indicating that formation of new Golgi membrane from the
ER is also independent of the microtubule and actin
networks. Therefore, it is tempting to speculate that direct
transport from the ER to the Golgi, in the systems
investigated here, may be free from cytoskeletal regulation
even though their motility is actin dependent. This could
well be a consequence of the close proximity of the two
organelles to each other, moving over actin tracks,
indicating a fundamental difference between plant and
mammalian early secretory pathways.
In the leaf system it has been shown that the Golgi
stacks and ER are very closely aligned (Batoko et al., 2000;
Boevink et al., 1998). So much so that only very rarely can
Golgi stacks be visualised apart from an ER tubule or
lamellar region in the slower streaming cortical cytoplasm.
As a result of this observation the `vacuum cleaner' model
for Golgi ER exchange has been postulated, whereby the
Golgi stacks travel over the ER network picking up
products from the ER either through direct connections,
tubules or vesicles (Boevink et al., 1998; Hawes et al.,
1999a). An alternative `recruitment' model, based on the
fact that some Golgi stacks undergo periods of stasis on
ER tubules, suggests they rest, in response to a `stop'
signal, to pick up vesicles produced at exit sites on the ER
(NebenfuÈhr and Staehelin 2001; NebenfuÈhr et al., 1999).
This is in effect a close range and transient version of the
mammalian model of ER to Golgi traf®c. The results
presented here indicate that the short distance travelled by
any cargo-carrying vector between ER and Golgi is insuf®cient to warrant a mechanochemical motor system based
on the cytoskeleton. Therefore, one has to postulate a
short-range regulated transport of ER derived vesicles or
some form of direct connection between the two organelles either permanent or transient. As we also show BFA
induced redistribution and recovery of the Golgi can take
place when Golgi bodies are static, they must halt at
putative exit sites, if these events depend on normal
retrograde traf®cking pathways. Previously it has been
shown that on disruption of the actin cytoskeleton with
ã Blackwell Science Ltd, The Plant Journal, (2002), 29, 661±678
Redistribution of membrane proteins
cytochalasin D, Golgi clustered on small islands of ER
lamellae at the vertices of the tubules of the polygonal
cortical network (Boevink et al., 1998). How these structures relate to exit sites has yet to be determined. It is
therefore pertinent to investigate the location and role of
the gamut of accessory proteins such as Rab1, Sar1 and
Sec12, that regulate the formation of putative ER/Golgi
transport vesicles in leaves and also in a system that is not
so spatially limited.
One of the advantages of the transient expression
system in leaves described in this and previous papers
(Andreeva et al., 2000; Batoko et al., 2000) is that not only
can a number of different constructs be tested quickly, but
also several genes can be co-expressed at the same time,
such as the combination of GFP and DsRed tagged
proteins. Also the system enables the testing of the
function of regulatory proteins within the secretory pathway. In a recent publication Batoko et al. (2000) presented
the ®rst evidence for the membrane traf®cking function of
a plant Rab GTPase in plant cells. Expression of
AtRab1b(N121I) inhibited transport of a secretory form of
GFP and the membrane bound glycosylated form of STGFP (N-ST-GFP) out of the ER. Here we have shown that
expression of the same mutant Rab1, which is defective in
its ability to be converted to the active GTP-bound form,
suppresses the recovery of Golgi after BFA treatment but
has no effect on the retrograde transport of ST-GFP back to
the ER. This indicates that even if the transport distance
between ER and Golgi is minimal, regulatory proteins still
exert a level of control over the ER to Golgi transport step.
675
Construction of STtmd-GFP, STtmd-DsRed and GTtmdGFP
The trans-membrane domain and short cytoplasmic tail (52
amino acids) of a rat a-2,6-sialyltransferase (gift of S. Munro,
Cambridge, UK) was ampli®ed by PCR (ST5¢: 5¢-aaatctagaccatgattcataccaacttgaag; ST3¢: 5¢-ccaaagtcgacatggccactttctcctg) and
fused to the 5¢ end of GFP5 in place of ERD2 in p pVKH-ERD2-GFP
using SalI and XbaI restriction sites, in pVKHEn6Erd2 plasmid.
DsRed (BD Clontech UK, Cat. # 6923±1) was ampli®ed by PCR
(RFP5¢- ggcggcgtcgactatgaggtcttccaagaatgttatcaaggagttcatgagg;
RFP3¢: 5¢-gcgcggggatccctaaaggaacagatggtggcgt-ccctcgg). GFP5
was then replaced by DsRed (BD Clontech UK, Cat. # 6923±1)
using SalI and BamHI restriction sites.
The trans-membrane domain and short cytoplasmic tail (60
amino acids) of a human b-1,4-galactosyltransferase (gift of J.
Lippincott-Schwartz, Bethesda, USA) was ampli®ed by PCR (GT5¢:
5¢aaaatctagaccatgaggcttcgggagccg; GT3¢: 5¢aaaaagtcgactgcagcggtgtggagactccg) and fused to the 5¢ end of GFP5 at the place of
ERD2 using SalI and XbaI restriction sites, in the pVKH-Erd2-GFP
plasmid.
Agrobacterium-mediated BY2 cells transformation
pBINPLUS, which carries a kanamycin resistance marker, was
used to select transgenic BY2 cells. ST-GFP was subcloned in
pBINPLUS using HindIII and BglII/BamH I restriction sites
(Figure 1). The construct derived (pBIN-ST-GFP) was transferred
into Agrobacterium (strain GV3101 pMP90, Koncz and Schell,
1986) by electroporation. Transgenic Agrobacterium were selected on YEB medium (per litre: beef extract 5 g, yeast extract
1 g, sucrose 5 g, MgSO4±7H2O 0.5 g) containing kanamycin
(100 mgml±1) and gentamycin (10 mgml±1) and were used to
transform BY-2 cells, as described in Gomord et al. (1998).
Transformed tobacco cells were selected in the presence of
kanamycin (100 mgml±1) and cefotaxime (250 mgml±1). After
screening by ¯uorescence microscopy and immunodetection,
calli expressing ST-GFP were used to initiate suspension cultures
of transgenic cells.
Experimental procedures
Construction of AtERD2-GFP
The binary vector pVKH18En6-GUS was generated by inserting
the expression cassette of pE6113-GUS (gift of M. Ugaki, Ibaraki,
Japan; see Mitsuhara et al., 1996) as a PvuII and HindIII into the
SacI and HindIII sites of the polylinker of binary vector pVKH18, a
derivative of pVK18 (Moore et al., 1998) where the methotrexate
resistance marker of pVK18 had been replaced by an hygromycin
selectable marker (Zheng and Moore, unpublished). To create
pVKH18En6-ERD2-GFP, the coding sequence of GFP5 (Haseloff
et al., 1997) was ampli®ed from pBINmGFP5ER (kindly provided
by J. Haseloff, Cambridge, UK) by PCR using primers GFP5¢: 5¢tttaagcttcctgcgtcgactttcagtaaaggagaagaacttttca and GFP3¢: 5¢tttggatccttacaaatcctcctcagagataagtttctgctctttgtatagttcatccatgc (cmyc epitope tag sequence is in italics). The cDNA encoding the
Arabidopsis H/KDEL receptor ± AtERD2 ± (provided by N. Raikhel,
Michigan, USA) was inserted as a HindIII fragment at the HindII
site introduced into the 5¢ end of GFP5. The GFP-fusion was
subcloned in pVKH18En6 as a BamHI fragment, replacing the
GUS coding region of the E6113 cassette to generate plasmid
pVKH-ERD2-GFP.
ã Blackwell Science Ltd, The Plant Journal, (2002), 29, 661±678
Agrobacterium-mediated transient expression in
Nicotiana tabacum
pVHK18En6GFP fusions transformed A. tumefaciens was cultured
at 28°C, until the stationary phase ( approximately 24 h), washed
and resuspended in in®ltration medium (MES 50 mM pH 5.6,
glucose 0.5% (w/v), Na3PO4 2 mM, acetosyringone (Aldrich)
100 mM from 10 mM stock in absolute ethanol). The bacterial
suspension was pressure injected into the abaxial epidermis of
plant leaves using a 1-ml plastic syringe by pressing the nozzle
against the lower leaf epidermis (Hawes et al., 1999b). Plants were
incubated for 2±3 days at 20±25°C. GFP ¯uorescence was detected
by illuminating leaves with a long wavelength UV lamp.
Cycloheximide treatments
Tobacco leaves were incubated for 3 days after in®ltration with
Agrobacterium transformed with pVKH-secGFP (see Batoko et al.,
2000) resulting in the expression of a secreted form of GFP. Leaf
segments were then incubated in 100 mm cycloheximide, 180 mm
BFA (from 36 mM stock in DMSO, Sigma) or a mixture of BFA and
cycloheximide for 3-4 h before confocal analysis.
676
Claude M. Saint-Jore et al.
Brefeldin A and cytoskeletal inhibitor treatments
All the experiments were carried out using 3- to 4-day-old-cells or
2-3 day post-infection leaves. BFA was kept as a 36-mM stock
solution in DMSO, at ±20°C. BY2 cells were resuspended in culture
medium with brefeldin A (36 or 180 mM). Transfected leaf
segments were incubated in a solution of brefeldin A (180 mM).
For time-lapse visualisation of BFA on BY2 cells, cells were lain on
a thin layer of 2% agar made with culture medium on a slide, BFA
added and the cells viewed immediately by confocal microscopy
using the Zeiss LSM410 time lapse software.
Leaves transiently expressing a myc-tagged, glycosylated NGFP-HDEL construct were treated with BFA (180 mM for 3 h) and
proteins extracted to biochemically test the retrograde transport
of Golgi enzymes. Extraction, endoglycosidase H (endo H) treatment and immuno-blot analysis were as previously described in
Batoko et al. (2000).
Cytochalasin D (Sigma, 1.97 mM stock in DMSO, ±20°C) or
latrunculin B (Calbiochem, 1 mM stock in DMSO, ±20°C) was used
to depolymerise actin. BY2 cells were resuspended in culture
medium containing cytochalasin D (39.4 mM) or latrunculin B
(25 mM). Transfected leaf discs were incubated in a solution of
cytochalasin D (39.4 mM) or latrunculin B (10±25 mM). To disrupt
microtubules, BY2 cells were resuspended in culture medium
containing 28.9 mM oryzalin (Dow Elanco) from a stock solution
(0.15 M in acetone). Transfected leaf discs were incubated in a
solution of oryzalin (28.9 mM). Controls contained an equivalent
concentration of DMSO or acetone.
Immunolabelling
For microtubules, BY2 cells were ®xed for 1 h in 4% (w/v)
paraformaldehyde (PFA) in microtubule stabilising buffer
(MTSB, 0.1 M PIPES, pH 6.9, EGTA 10 mM, MgSO4 10 mM), were
digested for 20 min in 1% (w/v) cellulase (Onozuka R10, Yakult
Honusha Co. Ltd, Japan), 0.1% (w/v) pectinase (Sigma), 1% (w/v)
BSA in buffer, and were permeabilised with 0.5% (v/v) Triton X100 in MTSB, for 15 min. For immunolocalisation, cells were
treated with 1% BSA and 1% ®sh gelatin before incubation with
anti a-tubulin (YOL1/34, Serotec, UK) (diluted 1 : 20) for 2 h at
room temperature followed by incubation with Texas-Red-conjugated goat antirat antibodies (Molecular Probes) for 1 h at room
temperature, washing and mounting in Citi¯uor antifade (Agar
Scienti®c, UK). For Golgi labelling, cells were incubated in the
presence of JIM84 culture supernatant (Horsley et al., 1993) for 2 h
at room temperature followed by Texas-Red-conjugated antirat as
above.
Actin staining
BY2 cells were pre-incubated for 2 min in 100 mM 3-maleidobenzoyl N-hydroxysuccinimide ester (MBS, Sigma) and 0.025%
Triton X-100 to stabilise the actin and permeabilise the cells, and
stained in a solution of rhodamine-phalloidin (SIGMA, 10±5 M in
MTSB) buffer for 4 min. Excess stain was removed by washes in
MTSB.
Expression of AtRab1b(N121I)
Plasmids encoding the Arabidopsis Rab GTPase AtRab1b and the
dominant interfering mutant N121I were described in Batoko et al.
(2000). The YFP variant of N-secGFP was constructed by amplifying the chitinase signal peptide and synthetic N-glycosylated
peptide exactly as described for N-secGFP (Batoko et al., 2000)
and inserting it as an XbaI ± XhoI fragment into the XbaI and SalI
sites upstream of YFP in the plasmid pVKH-N-ST-YFP to generate
pVKH-N-secYFP. pVKH-N-ST-YFP is identical to pVKH-N-ST-GFP
(Batoko et al., 2000) except that the GFP coding region was
replaced with a YFP coding region using the SalI and BamHI sites.
Co-expression of these constructs with the Golgi-targeted ST-GFP
into tobacco leaf epidemal cells was achieved by Agrobacteriummediated transient expression. ST-GFP was introduced at OD600
0.1, AtRab1b(N121I) at OD600 0.03 and N-secYFP at OD600 0.01.
The infected plant was incubated at 20°C for 3 days and samples
from infected areas subjected to BFA treatment as described
above.
Confocal microscopy
All specimens were imaged with a Zeiss LSM-410 or LSM 510
confocal laser scanning microscope (CLSM) with a 488-nm argon
ion laser and a 510±525 or 505±530 nm bypass ®lter to exclude
chlorophyll auto¯uorescence. Texas-Red and rhodamine were
excited with a 543-nm argon ion laser line with a 570-nm bypass
®lter.
Note added in proof
In a recently published paper immuno¯uorescence and protein
blot labelling of BY2 cells expressing a GFP-Golgi marker has
demonstrated a relatively rapid loss of g-COP and a slower loss of
Arf1 from Golgi in BFA treated cells (Ritzenthaler et al., 2002).
Acknowledgements
We acknowledge the BBSRC for a grant to CH supporting this
work. Jennifer Lippincott-Schwartz (NIH Bethesda) for the b1±4
galactosyl transferase, Jim Haseloff (Cambridge) for pBIN
mGFP5ER, Huanquan Zheng (Oxford Brookes) for the sec-GFP
construct and Ulla Neumann (Oxford Brookes) for taking images
in Figure 1i-k.
References
Allan, V.J. and Schroer, T.A. (1999) Membrane motors. Curr. Op.
Cell Biol. 11, 476±482.
Andreeva, A.V., Zheng, H., Saint-Jore, C.M., Kutuzov, M.A.,
Evans, D.E. and Hawes, C. (2000) Organization of transport
from the endoplasmic reticulum to the Golgi in higher plants.
Biochem. Soc. Trans. 28, 505±512.
Baldwin, T.C., Handford, M.G., Yuseff, M.-I., Orellana, A. and
Dupreee, P. (2001) Identi®cation and characterization of
GONST1, a Golgi-localised GDP-mannose transporter in
Arabidopsis. Plant Cell 13, 2283±2295.
Bar-Peled, M., da Silva ConceicË|o, A., Frigerio, L. and Raikhel, N.V.
(1995) Expression and regulation of aERD2, a gene encoding
the KDEL receptor homolog in plants, and other genes
encoding protein involved in ER-Golgi vesicular traf®cking.
Plant Cell 7, 667±676.
Batoko, H., Zheng, H.-Q., Hawes, C. and Moore, I. (2000) A Rab1
GTPase is required for transport between the endoplasmic
reticulum and Golgi apparatus and for normal Golgi
movements in plants. Plant Cell 12, 2201±2218.
ã Blackwell Science Ltd, The Plant Journal, (2002), 29, 661±678
Redistribution of membrane proteins
Boevink, P., Martin, B., Oparka, K., Santa Cruz, S. and Hawes, C.
(1999) Transport of virally expressed green ¯uorescent protein
through the secretory pathway in tobacco leaves is inhibited by
cold shock and brefeldin A. Planta 208, 392±400.
Boevink, P., Oparka, K., Santa Cruz, S., Martin, B., Betteridge, A.
and Hawes, C. (1998) Stacks on tracks: the plant Golgi
apparatus traf®cs on an actin/ER network. Plant J. 15, 441±447.
Boevink, P., Santa Cruz, S., Hawes, C., Harris, N. and Oparka, K.J.
(1996) Virus-mediated delivery of the green ¯uorescent protein
to the endoplasmic reticulum of plant cells. Plant J. 10, 935±941.
Buss, F., Kendrick-Jones, J., Lionne, C., Knight, A.E., Cote, G.P.
and Luzio, J.P. (1998) The localization of myosin VI at the Golgi
complex and leading edge of ®broblasts and its
phosphorylation and recruitment into membrane ruf¯es of
A431 cells after growth factor stimulation. J. Cell Biol. 143,
1535±1545.
Donaldson, J.G., Finazzi, D. and Klausner, R.D. (1992) Brefeldin A
inhibits Golgi membrane-catalyzed exchange of guanine
nucleotide onto ARF protein. Nature 360, 350±352.
Essl, D., Dirnberger. D., Gomord, V., Strasser, R., Faye, L., GloÈssl,
J. and Steinkellner, H. (1999) The N-terminal 77 amino acids
from tobacco N-acetylglucosoaminyltransferase I are suf®cient
to retain a reporter protein in the Golgi apparatus of Nicotiana
benthamiana cells. FEBS Lett. 453, 169±173.
Fitchette, A.-C., Cabanes-Macheteau, M., Marvin, L., Martin, B.,
Satiat-Jeunemaitre, B., Gomord, V., Crooks, K., Faye, L. and
Hawes, C. (1999) Biosynthesis and immunolocalization of Lewis
a-containing N-glycans in the plant cell. Plant Physiol. 121, 333±
343.
Gomord, V., Fitchette-LaineÂ, A.-C., Michaud, D. and Faye, L.
(1998) Production of foreign proteins in tobacco suspension
culture. In: Methods in Biotechnology, Vol. 3 (Cunningham C.
and Porter, A.J.R. eds). Humana Press, Towota, NJ. pp. 155±
164.
Gunning, B.E.S. and Steer, M.W. (1996) Plant Cell Biology:
Structure and Function. Boston: Jones and Bartlett Publishers.
Harada, A., Takei, Y., Kanai, Y., Tanaka, Y., Nonaka, S. and
Hirokawa, N. (1998) Golgi vesiculation and lysosome
dispersion in cells lacking cytoplasmic dynein. J. Cell Biol.
141, 51±59.
Hara-Nishimura, I., Schimada, T., Hatano, K., Takeuchi, Y. and
Nishimura, M. (1998) Transport of storage proteins to protein
storage vacuoles is mediated by large precursor accumulating
vesicles. Plant Cell 10, 825±836.
Harris, N. and Oparka, K. (1983) Connections between
dictyosomes, ER and GERL in cotyledons of mung bean
(Vigna radiata L.). Protoplasma 114, 93±102.
Haseloff, J., Siemering, K.R., Prasher, D.C. and Hodge, S. (1997)
Removal of a cryptic intron and subcellular localization of green
¯uorescent protein are required to mark transgenic Arabidopsis
plants brightly. Proc. Natl Acad. Sci. USA 94, 2122±2127.
Hawes, C., Boevink, P. and Moore, I. (1999b) Green ¯uorescent
protein in plants. In: Protein Localization by Fluorescence
Microscopy: a Practical Approach. (Allen, V. ed). Oxford:
Oxford University Press, pp. 163±177.
Hawes, C.R., Brandizzi, F. and Andreeva, A. (1999a)
Endomembranes and vesicle traf®cking. Curr. Op. Plant Biol.
2, 454±461.
Hawes, C., Faye, L. and Satiat-Jeunemaitre, B. (1996) The Golgi
apparatus and pathways of vesicle traf®cking. In: Membranes:
Specialized Functions in Plants (Smallwood, M., Knox J.P. and
Bowles, D.J., eds). Oxford: Bios Scienti®c Publishers, pp. 337±
365.
Hawes, C.R., Juniper, B.E. and Horne, J.C. (1981) Low and high
ã Blackwell Science Ltd, The Plant Journal, (2002), 29, 661±678
677
voltage electron microscopy of mitosis and cytokinesis in maize
roots. Planta 152, 397±407.
Helms, J.B. and Rothman, J.E. (1992) Inhibition by Brefeldin A of a
Golgi membrane that catalyses exchange of guanine nucleotide
bound ARF. Nature, 360, 352±354.
Horsley, D., Coleman, J., Evans, D., Crooks, K., Peart, J., SatiatJeunemaitre, B. and Hawes, C. (1993) A monocolonal antibody,
JIM 84, recognizes the Golgi apparatus and plasma membrane
in plant cells. J. Exp. Bot. 44, 223±229.
Klausner, R.D., Donaldson, G.J. and Lippincott-Schwartz, J.
(1992) Brefeldin A: Insights into the control of membrane
traf®c and organelle structure. J. Cell Biol. 116, 1071±1080.
Klumperman, J. (2000) Transport between ER and Golgi. Curr. Op.
Cell Biol. 12, 445±449.
Koncz, C. and Schell, J. (1986) The promoter of T-DNA gene 5
controls the tissue-speci®c expression of chimeric genes
carried by a novel type of Agrobacterium binary vector. Mol.
General Genet. 204, 383±396.
Liebe, S. and Quader, H. (1994) Myosin in onion (Allium cepa)
bulb scale epidermal cells: involvement in dynamics of
organelles and endoplasmic reticulum. Physiol. Plant. 90,
114±124.
Lippincott-Schwartz, J., Donaldson, J.G., Schweizer, A., Berger,
E.G., Hauri, H.D., Yuan, L.C. and Klausner, R.D. (1990)
Microtubule-dependant retrograde transport of proteins into
the ER in the presence of Brefeldin A suggests an ER recycling
pathway. Cell 80, 821±836.
Lippincott-Schwartz, J., Yuan, L., Bonifacino, J. and Klausner, R.
(1989) Rapid redistribution of Golgi proteins into the ER in cells
treated with Brefeldin A: evidence for membrane recycling from
Golgi to ER. Cell 56, 801±813.
Lippincott-Swartz, J. and Zaal, K.J.M. (2000) Cell cycle
maintenance and the biogensis of the Glgi complex.
Histochem. Cell Biol. 114, 93±103.
Mansour, S.J., Skaug, J., Zhao, X.-H., Giordana, J., Scherer, S.W.
and MelancËon, P. (1999) p200 ARF-GEP1: a Golgi-localized
guanine nucleotide exchange protein whose Sec7 domain is
targeted by the drug brefeldin A. Proc. Natl Acad. Sci. USA 96,
7968±7973.
Matz, M.V., Fradkov, A.F., Labas, Y.A., Savitsky, A.P., Zaraisky,
A.G., Markelov, M.L. and Lukyanov, S.A. (1999) Fluorescent
proteins from nonbioluminescent Anthozoa species. Nature
Biotech. 17, 969±973.
Mitsuhara, I., Ugaki, M., Hirochika, H., Ohshima, M., Murakami,
T., Gotoh, Y., Katayose, Y., Nakamura, S., Honkura, R.,
Nishimiya, S., Ueno, K., Mochizuki, A., Tanimot, H., Tsukawa,
H., Otsuki, Y. and Ohashi, Y. (1996) Ef®cient promoter cassettes
for enhanced expression of foreign genes in dicotyledonous
and monocotyledonous plants. Plant Cell Physiol. 37, 49±59.
Moore, I., Galweiler, L., Grosskopf, D., Schell, J. and Palme, K.
(1998) A transcription activation system for regulated gene
expressioon in transgenic plants. Proc. Natl Acad. Sci. USA 95,
376±381.
Movafeghi, A., Happel, N., Pimpl, P., Tai, G.H. and Robinson, D.G.
(1999) Arabidopsis Sec21p and Sec23p homologs. Probable
coat proteins of plant COP-coated vesicles. Plant Physiol. 119,
1437±1445.
NebenfuÈhr, A., Frohlick, J.A. and Staehelin, L.A. (2000)
Redistribution of Golgi stacks and other organelles during
mitosis and cytokinesis in plant cells. Plant Physiol. 124, 135±
151.
NebenfuÈhr, A., Gallagher, L.A., Dunahay, T.G., Frohlick, J.A.,
Mazurkiewicz, A.M., Meehl, J.B. and Staehelin, L.A. (1999)
678
Claude M. Saint-Jore et al.
Stop-and-go movements of plant Golgi stacks are mediated by
the acto-myosin system. Plant Physiol. 121, 1127±1141.
NebenfuÈhr, A. and Staehelin, L.A. (2001) Mobile factories: Golgi
dynamics in plant cells. Trends Plant Sci. 6, 160±167.
Peyroche, A., Antonny, B., Robineau, S., Acker, J., Cher®ls, J. and
Jackson, C.L. (1999) Brefeldin A acts to stabilize an abrortive
ARF-GDP-sec7 domain protein complex: Involvement of
speci®c residues of the sec7 domain. Mol Cell. 3, 275±285.
Pimpl, P., Movafeghi, A., Coughlan, S., Denecke, J., Hillmer, S.
and Robinson, D.G. (2000) In situ localization and in vitro
induction of plant COPI-coated vesicles. Plant Cell 12, 2219±
2236.
Quader, H. (1990) Formation and disintegration of cisternae of the
endoplasmic reticulum visualized in live cells by conventional
¯uorescence and confocal laser scanning microscopy: evidence
for the involvement of calcium and the cytoskeleton.
Protoplasma 155, 166±175.
Ritzenthaler, C., NebenfuÈr, A., Movafeghi, A., Stussi-Garaud, C.,
Behnia, L., Pimpl, P., Staehelin, L.A. and Robinson, D.G. (2002)
Reevaluation of the effects of brefeldin A on plant cells using
tobacco bright yellow 2 cells expressing Golgi-targeted green
¯uorescent protein and COPI antisera. Plant Cell 14, 237±261.
Robineau, S., Chabre, M. and Antonny, B. (2000) Binding site of
brefeldin A at the interface between the small G protein ADPribosylation factor 1 (ARF1) and the nucleotide-exchange factor
Sec 7 domain. Proc. Natl Acad. Sci. USA 97, 9913±9918.
Roghi, C. and Allan, V.J. (1999) Dynamic association of
cytoplasmic dynein heavy chain 1a with the Golgi apparatus
and intermediate compartment. J. Cell Sci. 112, 4673±4685.
Rutten, T.L.M. and Knuiman, B. (1993) Brefeldin A effects on
tobacco pollen tubes. Eur. J. Cell Biol. 61, 247±255.
Sata, M., Donaldson, J.G., Moss, J. and Vaughan, M. (1998)
Brefeldin A-inhibited guanine nucleotide-exchange activity of
Sec7 domain from yeast Sec7 with yeast and mammalian ADP
ribosylation factors. Proc. Natl Acad. Sci. USA 95, 4204±4208.
Satiat-Jeunemaitre, B., Cole, L., Bourett, T., Howard, R. and
Hawes, C. (1996) Brefeldin A effects in plant and fungal cells:
Something new about vesicle traf®cking? J. Microsc. 181, 162±
117.
Satiat-Jeunemaitre, B. and Hawes, C. (1992) redistribution of a
Golgi glycoprotein in plant cells treated with Brefeldin A. J. Cell
Sci. 103, 1153±1166.
Seeman, J., Jokitalo, E., Pypaert, M. and Warren, G. (2000) Matrix
proteins can generate the higher order architecture of the Golgi
apparatus. Nature 407, 1022±1026.
Staehelin, L.A. and Driouich, A. (1997) Brefeldin A effects in
plants. Plant Physiol. 114, 410±403.
Takeuchi, M., Ueda, T., Sato, K., Abe, H., Nagata, T. and Nakano,
A. (2000) A dominant negative mutant of Sar1 GTPase inhibits
protein transport from the endoplasmic reticulum to the Golgi
apparatus in tobacco and Arabidopsis cultured cells. Plant J. 23,
517±525.
Thyberg, J. and Moskalewski, S. (1999) Role of microtubules in
the organisation of the Golgi complex. Exp. Cell Res. 246, 263±
279.
Wee, E.-G., Sherrier, D.J., Prime, T. and Dupree, P. (1998)
Targeting of active sialyltransferase to the plant Golgi
apparatus. Plant Cell 10, 1759±1768.
Yasuhara, H., Sonobe, S. and Shibaoka, H. (1995) Effects of
Brefeldin-a on the formation of the cell plate in tobacco BY-2
cells. Europ, J. Cell Biol. 66, 274±281.
Zaal, K.J.M., Smith, C.L., Polishchuk, R.S., Altan, N., Cole, N.B.,
Ellenberg, J., Hirschberg, K., Preseley, J.F., Roberts, T.H.,
Siggia, E., Phair, R.D. and Lippincott-Schwartz, J. (1999) Golgi
membranes are absorbed into and reemerge from the ER
during mitosis. Cell 99, 599±601.
ã Blackwell Science Ltd, The Plant Journal, (2002), 29, 661±678