* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Ch. 13 – Biotechnology
Comparative genomic hybridization wikipedia , lookup
Maurice Wilkins wikipedia , lookup
Genome evolution wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Genetic engineering wikipedia , lookup
Non-coding DNA wikipedia , lookup
DNA vaccination wikipedia , lookup
Restriction enzyme wikipedia , lookup
Genomic library wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
DNA supercoil wikipedia , lookup
Synthetic biology wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Molecular evolution wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Molecular cloning wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Ch. 13 – Biotechnology AP Biology Salt-tolerant Tomato Plants AP Biology Transgenic β-carotene Rich Rice AP Biology 3 Key Tools § Restriction enzymes - cut DNA into fragments § Gel electrophoresis - analysis and purification of DNA fragments § DNA ligase - joins DNA fragments together in new combinations AP Biology Restriction Enzymes AP Biology Restriction Enzymes § restriction endonucleases § discovered in 1960s § evolved in bacteria to cut up foreign DNA § “restrict” action of attacking organisms (viruses and other bacteria) § How do bacteria protect their own DNA? § Methylation AP Biology Restriction Enzymes § cut at specific recognition sequences § “sticky ends” § Sticky ends can bind complementary sequences on other DNA molecules. AP Biology Gel Electrophoresis § separates DNA fragments cut Animated Tutorial 13.1 – Gel Electrophoresis AP Biology by enzymes § provides information on: - number of fragments - sizes of fragments - relative abundance of fragments (intensity of band) § A specific DNA sequence can be found with a singlestranded probe. § DNA fragment is removed and used to make recombinant DNA. Check Your Understanding 1999 Exam AP Biology How to Get Recomb DNA into Cells? § chemicals - make membrane more § § § § AP Biology permeable Electroporation - electric shock creates temporary pores in membranes Viruses and bacteria - carry recombinant DNA into cells Transgenic animals Gene guns - shoot the host cells with particles of DNA Bacteria Bacterial Fission AP Biology Bacterial Genome - single circular chromosome - haploid - “naked” DNA - ~ 4 million base pairs - ~ 4300 genes - 1/1000 DNA in eukaryote AP Biology Transformation § Bacteria pick up naked foreign DNA § import bits of chromosomes from other bacteria and incorporate into their own à express new genes (transformed) AP Biology Plasmids - small supplemental circles of DNA (5000-20,000 bp) - 2-30 genes - self-replicating - many have genes for antibiotic resistance (selectable markers) - can be exchanged between bacteria (bacterial sex) - rapid evolution - can be imported from environment AP Biology Plasmids AP Biology Sticky ends help glue genes together cut sites gene you want cut sites TTGTAACGAATTCTACGAATGGTTACATCGCCGAATTCACGCTT ! AACATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGTGCGAA ! sticky ends AATTCTACGAATGGTTACATCGCCG ! GATGCTTACCAATGTAGCGGCTTAA ! cut sites isolated gene chromosome want to add gene to AATGGTTACTTGTAACG AATTCTACGATCGCCGATTCAACGCTT ! TTACCAATGAACATTGCTTAA GATGCTAGCGGCTAAGTTGCGAA ! DNA ligase joins the strands sticky ends stick together Recombinant DNA molecule chromosome with new gene added TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC ! AP Biology The Code Is Universal § Since all living organisms… - use the same DNA, same code book - read their genes the same way AP Biology Copy (& Read) DNA § Transformation - insert recombinant plasmid into bacteria - grow recombinant bacteria in agar cultures - bacteria make lots of copies of plasmid – “cloning” the plasmid - production of many copies of inserted gene AP Biology AP Biology AP Biology pGLO Bacterial Transformation § Selectable markers - antibiotic (ampicillin) resistance § Reporter gene - jelly fish AP Biology Check Your Understanding 2012 Practice AP Biology Uses of Genetic Engineering § Genetically modified organisms (GMO) - enable plants to produce new proteins - protect crops from insects (BT corn) - extend growing season: “fishberries” - golden rice containing βcarotene AP Biology