Download Unconventional initiator tRNAs sustain Escherichia coli

Unconventional initiator tRNAs sustain Escherichia coli
Laasya Samhitaa, Sunil Shettya, and Umesh Varshneya,b,1
a
Department of Microbiology and Cell Biology, Indian Institute of Science, Bangalore 560012, India; and bJawaharlal Nehru Centre for Advanced Scientific
Research, Bangalore 560064, India
Of all tRNAs, initiator tRNA is unique in its ability to start protein
synthesis by directly binding the ribosomal P-site. This ability is
believed to derive from the almost universal presence of three
consecutive G-C base (3G-C) pairs in the anticodon stem of initiator
tRNA. Consistent with the hypothesis, a plasmid-borne initiator
tRNA with one, two, or all 3G-C pairs mutated displays negligible
initiation activity when tested in a WT Escherichia coli cell. Given
this, the occurrence of unconventional initiator tRNAs lacking the
3G-C pairs, as in some species of Mycoplasma and Rhizobium, is
puzzling. We resolve the puzzle by showing that the poor activity
of unconventional initiator tRNAs in E. coli is because of competition from a large pool of the endogenous WT initiator tRNA (possessing the 3G-C pairs). We show that E. coli can be sustained
on an initiator tRNA lacking the first and third G-C pairs; thereby
reducing the 3G-C rule to a mere middle G-C requirement. Two
general inferences following from our findings, that the activity
of a mutant gene product may depend on its abundance in the cell
relative to that of the WT, and that promiscuous initiation with
elongator tRNAs has the potential to enhance phenotypic diversity
without affecting genomic integrity, have been discussed.
fidelity of initiation
| ribosome | phenotypic plasticity
t
RNAs play a central role in protein synthesis. All tRNAs share
the same clover leaf-like structure but belong to two distinct
categories: initiator tRNA (of which there is a single representative) and elongator tRNAs (of which there are many representatives). As the name indicates, initiator tRNA acts at the first step
of protein synthesis, initiation. It is distinct from elongator tRNAs
both in the details of its sequence and in its ability to bind the
P-site of the ribosome directly. In contrast, elongator tRNAs first
bind the A-site of the ribosome and then get translocated to the
P-site. Two special features that have evolved to promote initiator
tRNA binding to the P-site in eubacteria are (i) formylation of the
methionine amino acid that it carries and (ii) the occurrence of
three consecutive G-C base (3G-C) pairs in its anticodon stem at
positions 29–41, 30–40, and 31–39 (Fig. 1). Although formylation
is not found in archaea and eukaryotes, the 3G-C pairs remain
universal; they are conserved across all domains of life. They have
been shown to be essential for the P-site targeting of initiator
tRNA (1, 2). More recently, it was shown by mutational analysis
that the first two G-C base pairs (positions 29–41 and 30–40) of
the initiator tRNA are contacted by G1338 and A1339 of 16S
rRNA (3), thereby establishing a direct contact to facilitate P-site
binding in the 30S subunit of the ribosome (4, 5).
In Escherichia coli, initiator tRNAs are encoded by four genes.
Of these, metZ, metW, and metV are present at 63.5′ and the
fourth gene, metY, is present at 71.5′ (6). In E. coli B strains, all
four genes encode identical tRNAfMet1, whereas in E. coli K
strains, the metY gene encodes tRNAfMet2. tRNAfMet1 carries an A
at position 46, whereas tRNAfMet2 has N7-methyl G at this position with no apparent functional differences (7). Either of these
two loci can be dispensed with in E. coli (8, 9), but strains lacking
all four initiator tRNA genes are not viable. Further, mutations in
the 3G-C pairs abolish the activity of mutant tRNAs in initiation
in vitro and in vivo (1, 10). This has led to the belief that the intact
3G-C pairs of initiator tRNA are an essential feature of living
systems. The only known exceptions are in some species of Mycoplasma and Rhizobium, where the single initiator tRNA gene
www.pnas.org/cgi/doi/10.1073/pnas.1207868109
produces tRNAs having the first and/or last G-C pair represented
by A-U and G-U, respectively (11). Understanding how initiation
occurs in these species has therefore been a major puzzle in
the field of translation. Studies on these aspects have remained
challenging because of the lack of an appropriate model for
genetic analyses.
Recently, using an in vivo assay system, we reported that
a plasmid-borne mutant initiator tRNA lacking the 3G-C pairs
(3G-C mutant) showed negligible initiation activity in E. coli.
However, we observed a considerable increase in its initiation
activity when the abundance of the chromosomally encoded WT
initiator tRNA was reduced by knocking out three (metZ, metW,
and metV) of the four initiator tRNA genes in the E. coli genome
(12). This observation raised the intriguing possibility that the
unique partitioning of work among the initiator and elongator
tRNAs may be maintained as much by their relative intracellular
abundance as by their distinct structural features. Further, it
motivated the hypothesis that a mutant initiator tRNA molecule
may sustain the growth of the cell in the absence of any canonical
initiator tRNA. The aim of the present study is to test this
hypothesis. Is it possible to break down the specialization of
initiator tRNA and sustain an E. coli cell on initiator tRNAs
previously judged to be inadequate because they lacked the
hallmark 3G-C pairs?
Results
Generation of Mutations in the Anticodon Stem of tRNAfMet. To in-
vestigate if E. coli can sustain life with an initiator tRNA lacking
the characteristic 3G-C pairs in its anticodon stem, we carried
out site-directed mutagenesis of the plasmid-borne metY gene
encoding tRNAfMet2 (Fig. 1). The mutagenesis targeted one, two,
or all 3G-C pairs to generate A29-U41, C30-G40, G31-U39,
A29-U41/G31-U39, C30-G40/A31-U39, and U29-A41/C30-G40/
A31-U39 (abbreviated as A-U, C-G, G-U, A-U/G-U, C-G/A-U,
and 3G-C, respectively) mutant tRNAs.
Sustenance of E. coli in the Absence of Chromosomally Encoded
Initiator tRNA. To test the ability of the above mutant initiator
tRNAs to support the growth of E. coli, we deleted all four
chromosomally encoded initiator tRNA genes and replaced them
with various mutant tRNA genes on a plasmid. The strategy
involved transduction-mediated sequential deletion of the metY
and metZWV loci in E. coli KL16 using P1 phage raised on the
ΔmetY::cm (also indicated as ΔmetY) and ΔmetZWV::kan (also
indicated as ΔmetZWV) strains. The genomic metY locus was
knocked out before introduction of the different plasmid-borne
mutant tRNAs (derived from metY) into the strain to avoid
complications arising from any event of possible recombination
between the chromosomal and plasmid-borne genes. Despite the
fact that the substitution of the 3G-C pairs with other pairs in
Author contributions: L.S. and U.V. designed research; L.S. and S.S. performed research;
L.S., S.S., and U.V. analyzed data; and L.S. and U.V. wrote the paper.
The authors declare no conflict of interest.
This article is a PNAS Direct Submission.
1
To whom correspondence should be addressed. E-mail: [email protected].
This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.
1073/pnas.1207868109/-/DCSupplemental.
PNAS Early Edition | 1 of 6
GENETICS
Edited by Dieter Söll, Yale University, New Haven, CT, and approved July 4, 2012 (received for review May 9, 2012)
fMet
A
C
C
E.
M.
M.
M.
M.
R.
29G
- C41
- C40
31G - C39
30G
WT
A
G-C
G-C
G-C
A-U
U
coli
synoviae
mobile
pulmonis
pneumoniae
leguminosarum
G-C
G-C
G-C
G-U
A
U
30
1
40
76
CGCGG-----GGGCTCATAACCC-----CAACCA
CGCGG-----GGGCTCATAACCC-----CAACCA
CGCGG-----AGGCTCATAACCT-----CAACCA
CGCGG-----GGGCTCATAATCC-----CAACCA
CGCGG-----AGGCTCATAATCT-----CAACCA
CGCGG-----AGGCTCATAACCT-----CAACCA
G-C
G-C
G-C
U
U
A-U/G-U
C
G-C
G-C
G-C
C-G
G C
A
G-C
G-C
G-C
C-G/A-U
the anticodon stem of the initiator tRNA does not affect their
aminoacylation and formylation (10), true KOs for both of the
loci were obtained only in strains supported by the A-U, G-U,
and A-U/G-U mutants (Fig. 2 A and B).
To verify that the cell is indeed sustaining life on the mutant
tRNAs, we subjected total tRNA preparations from the WT,
single KO, and final KO strains to Northern blot analyses. The
two species of initiator tRNA, tRNAfMet1(encoded by metZWV)
and tRNAfMet2 (encoded by metY), can be separated by native
gel electrophoresis (13). As is seen from Fig. 2C, the WT strain
(with intact metZWV and metY loci) shows two bands corresponding to tRNAfMet1 and tRNAfMet2. Because the mutant
tRNAs were derived from the metY gene, we were able to
monitor the disappearance of the original tRNAfMet2 band in the
ΔmetY strain, and then the appearance of a band corresponding
to the mutant tRNA on introduction of the plasmid bearing the
gene for the mutant tRNA, without affecting the tRNAfMet1
band. It may be mentioned that the G-U and A-U/G-U mutant
U G-C
G C G-C
U A G-C
3G-C
A
G
U
Fig. 1. Generation of the 3G-C mutants. Mutations
were generated in the 3G-C pairs in the anticodon
stem of initiator tRNA using pmetY as a template.
Sequence comparisons (of the relevant regions)
in the box show exceptions to the 3G-C rule in
Rhizobium leguminosarum and some species of
Mycoplasma, in comparison to the E. coli initiator
tRNA sequence. The regions corresponding to the
3G-C base pairs are colored gray. M. synoviae, Mycoplasma synoviae; M. mobile, Mycoplasma mobile;
M. pulmonis, Mycoplasma pulmonis; M. pneumoniae, Mycoplasma pneumoniae.
tRNAs migrate differently from the A-U mutant and, in fact,
migrate slower than even the tRNAfMet1. Deletion of the metZWV
locus (ΔmetZWV) finally leaves the cell with only the tRNA from
the plasmid, confirming that the only source of initiator tRNA
the KO strain has is the plasmid-borne mutant tRNA. In addition, probing of the same blot for tRNATyr (Fig. 2C, Upper)
allowed relative quantification of initiator tRNAs (Fig. 2C,
Lower). The analysis showed that the relative cellular level of the
A-U/G-U mutant is three- to fourfold lower than that of the A-U
or G-U mutant (compare lane 8 with lanes 4 and 6).
To verify further that the strains are dependent for their survival on these tRNAs, we repeated the KO experiment with
mutant tRNA genes subcloned into the plasmid pAM34, whose
replication is dependent on the addition of isopropyl-β-D-thiogalactopyranoside (IPTG). We found that the transductants were
all dependent on IPTG for their growth, indicating that the cell is
indeed sustained on these mutant tRNAs (Fig. 3). Interestingly,
these are also the same three natural variants found in myco-
Fig. 2. (A) Schematic of the gene KOs and the
expected sizes of the PCR amplicons. (B) PCR analysis shows the KOs of metY in the strain KL16 (i)
followed by the KO of metZWV in strains supported
by the A-U, G-U, and A-U/G-U mutants (ii–iv).
Amplicons of ∼1.1 kb and ∼1.5 kb show the KOs
for metY (ΔmetY or ΔmetY::cm) and metZWV
(ΔmetZWV or ΔmetZWV::kan), respectively. Amplicons corresponding to the WT and KOs are indicated. Intense bands in the marker (M) lane
correspond to the sizes of 0.5 kb and 1.0 kb. Size
increments up to 1.0 kb are 0.1 kb; thereafter, the
sizes are 1.2, 1.5, 1.8, and 3.0 kb, respectively. (C)
Analysis of tRNAfMet1 and tRNAfMet2 from the parent strain and from strains at each stage of KO
generation. Total tRNA preparations were separated on a 15% polyacrylamide gel, transferred
onto a Nytran membrane, and analyzed by Northern blotting using a probe specific to initiator tRNA.
Subsequently, the same blot was hybridized to
tRNATyr probe for loading control. The positions of
tRNA species are as indicated. The blots were
quantified using a BioImageAnalyzer (FLA5000;
Fuji). Cellular abundances (Rel. Ratios) of the initiator tRNAs in the strains were calculated relative to
tRNAfMet (tRNAfMet1 and tRNAfMet2) after normalization of the total of the pixel values corresponding to the tRNAfMet bands by dividing them by the corresponding pixel values of the tRNATyr bands. Rel.
Ratios, relative ratios. Note: As the probe used for Northern analysis (see Materials and Methods) carries a mismatch at position 29 of the A-U and A-U/G-U
mutant tRNAs, the relative ratios indicated for these tRNAs are an under-estimate.
A
B
C
2 of 6 | www.pnas.org/cgi/doi/10.1073/pnas.1207868109
Samhita et al.
+ IPTG
- IPTG
2
2
1
3
6
4
1
3
(i) A-U
Sectors:
1: KL16 ΔmetY/pAM(A-U)
4
6
5
2- 6: KL16ΔmetYΔmetZWV/pAM(A-U)
5
- IPTG
1
2
1
3
3
(ii) G-U
4
6
6
5
+ IPTG
2
- IPTG
2
1
3
1
1: KL16ΔmetY/pAM(G-U)
2- 6: KL16ΔmetYΔmetZWV/pAM(G-U)
4
5
Sectors:
3
(iii) A-U/G-U
Sectors:
1: KL16ΔmetY/pAM(A-U/G-U)
4
6
4
6
5
2- 6: KL16ΔmetYΔmetZWV/pAM(A-U/G-U)
5
plasmas, indicating that these specific mutations allow the 3G-C
rule to be bypassed when the amount of competing chromosomally encoded tRNAfMet is decreased. It should also be said that
because the C-G mutation at positions 30–40 (by itself or
in combination) fails to support E. coli growth, the presence of
the middle G-C pair is most crucial for the function of the
initiator tRNA.
Rescue of the Cold-Sensitive Phenotype of a Strain Deficient in
Initiator tRNA. It is known that strains deleted for metZWV locus
(or having severe deficiency of tRNAfMet) exhibit cold sensitivity
(8, 12). This observation provides a useful qualitative screen for
assessing the extent of activity of a tRNAfMet mutant. Thus, as an
additional assay of their functionality and a means to test if the
other mutants also possessed some degree of functionality, we
introduced each of our mutant tRNA plasmids into E. coli KL16
ΔmetZWV and monitored the resulting transformants for growth
at 22 °C. Again, of all the mutants tested, the same three mutants
(A-U, G-U, and A-U/G-U) rescued the cold-sensitive phenotype
of the ΔmetZWV strain (Fig. 4). None of the other mutants
(C-G, C-G/A-U, and 3G-C) showed even a partial rescue of
the cold-sensitive phenotype at 22 °C. However, at the permissive temperature of 37 °C, all transformants showed growth as
expected (Fig. 4).
22 oC
37 oC
5
4
6
3
7
3
2
Samhita et al.
8
1
2
1
Growth Analysis of the Strains. In E. coli KL16ΔmetYΔmetZWV
strains supported solely by the plasmid-borne mutant tRNAs
[pmetY(A-U), pmetY(G-U), and pmetY(A-U/G-U)], the growth
of the strains in LB (Fig. 5) was marginally to moderately compromised with respect to the positive control supported on the
native initiator tRNA (pmetY), suggesting that the mutant tRNAs
sustained efficient initiation of protein synthesis, at least in a
rich medium.
Rate of Initiation of Protein Synthesis in E. coli Sustained on the A-U,
G-U, and A-U/G-U Mutant tRNAs. To assess the initiation efficiency
of the mutant tRNAs, we carried out β-galactosidase time course
assays with growing cells in early log phase. The rate of enzyme
induction serves as an indicator of the rates of protein synthesis
by the mutant tRNAs. When broken down into initiation (represented by the slope of the rise in β-galactosidase activity) and
elongation (represented by the lag corresponding to translation
of the first full-length protein before the rise in β-galactosidase
activity) components (14), an in vivo assessment of the protein
synthesis rates shows that the A-U/G-U mutant has a significantly lower rate of initiation, whereas the A-U and G-U mutants show only a moderate compromise compared with the WT
tRNA (Fig. 6), which is in agreement with the growth rate
assessments. The lower rate of initiation by the A-U/G-U mutant
Sectors:
5
4
6
Fig. 3. Sustenance of E. coli in the absence of any
chromosomally encoded initiator tRNA. Growth of
E. coli KL16ΔmetY (sector 1) and E. coli KL16ΔmetYΔmetZWV (sectors 2–6) carrying plasmid-borne
copies of the mutant tRNA genes [(pAM(A-U), pAM
(G-U), or pAM(A-U/G-U)] after incubation for 12 h
at 37 °C. Isolated transductants were streaked on
LB-agar plates containing ampicillin (Amp) and
kanamycin (Kan), with or without IPTG.
8
E. coli KL16ΔmetZWV
+
1: Vector
2: pmetY
3: pmetY(A-U)
7
4: pmetY(G-U)
5: pmetY(A-U/G-U)
6: pmetY(C-G/A-U)
7: pmetY(3G-C)
8: pmetY(C-G)
Fig. 4. Rescue of the cold-sensitive phenotype of
a strain deficient in initiator tRNA. Growth of E. coli
KL16ΔmetZWV carrying various mutant tRNAs on
plasmid (as indicated) after incubation for 12 h at
22 °C or 37 °C. Single colonies were picked from
a plate of transformants and streaked on LB-agar
plates containing ampicillin.
PNAS Early Edition | 3 of 6
GENETICS
+ IPTG
2
1
2
3
4
1: pmetY
2: pmetY(G-U)
3: pmetY(A-U)
4: pmetY(A-U/G-U)
3G-C pairs was believed to be indispensable for initiation from
both in vitro and in vivo experiments (1, 10). Earlier studies in yeast
showed that although overproduction of initiator tRNA could
sustain a strain lacking all five elongator tRNAMet genes, a strain
lacking all its chromosomal copies of the initiator tRNAMet genes
could neither be sustained by overproduction of the elongator
tRNAMet nor by overproduction of initiator tRNAMet lacking the
3G-C pairs (18). The only known exceptions to the presence of
the 3G-C pairs are some species of Mycoplasma (which has the
smallest bacterial genomes and is most often parasitic) (11) and
Rhizobium (which lives in symbiotic association).
A living cell has only one species of initiator tRNA (which
reads AUG or a related start codon in mRNA) and several
Fig. 5. Growth analysis of the strains. Growth of E. coli strains was sustained on plasmid-borne mutant tRNAs (A-U, G-U, or A-U/G-U) as indicated.
Overnight cultures grown in LB-Amp were diluted 100-fold in ampicillin
(Amp) containing LB, and their growth was monitored using a Bioscreen C
growth reader.
could be attributed, in part, to its lower level in the cell (Fig. 2C,
Lower; compare lane 8 with lanes 4 and 6). Expectedly, the
elongation rates estimated from the lag time (indicated by an
arrow in Fig. 2C, Lower) are nearly the same in all the strains
(∼12 amino acids per second).
Direct Assay of the in Vivo Initiation Activity of the Mutant tRNAs.
We have previously established a chloramphenicol acetyltransferase (CAT) reporter assay for assessing in vivo activity of
the initiator tRNA mutants (15). The assay exploits initiation
from a UAG initiation codon of the CATam1 reporter mRNA
with a tRNA mutant possessing a complementary CUA anticodon (U35A36 mutation). To assess the initiation activity of the
tRNA mutants, we changed their anticodons from CAU to CUA
and introduced them into E. coli strains having four, three, two,
or one copy of the genomic tRNAfMet genes. In these assays
(Fig. 7), in the strain lacking three of four tRNAfMet genes
(ΔmetZWV), although the A-U, and G-U mutants showed nearly
as good activity as the positive control (tRNAfMet with CUA
anticodon), the A-U/G-U mutant showed about half of the activity. These activities are consistent with the growth of the
strains sustaining on these tRNAs. Interestingly, as the number
of genomic copies of the tRNAfMet genes increases to four, initiation activities of the A-U, G-U, and A-U/G-U mutants decrease. In fact, as observed in our earlier studies (11), the activity
of the A-U/G-U mutant in WT E. coli strain harboring all four
tRNAfMet genes, is negligible. These observations are further
supported by plate assays (Fig. S1).
Discussion
We have shown that the three consecutive G-C base pairs in
initiator tRNA are not indispensable for E. coli survival. We
generated various mutations in the anticodon stem to change the
3G-C pairs to other base pair combinations and found that some
of the changes do, in fact, sustain E. coli in the absence of WT
initiator tRNA.
Two hallmarks of eubacterial initiator tRNA are formylation of
the amino acid it carries and the presence of the 3G-C pairs in the
anticodon stem. Although both features are required for initiator
tRNA function, the 3G-C pairs appear to be the more important of
the two. Formylation does not take place in archaea and eukaryotes, whereas the 3G-C pairs are found across all life forms. Even
within eubacteria, formylation is not essential, although its deficiency results in a growth compromise (16). In Pseudomonas, efficient initiation occurs with unformylated tRNA with only a
moderate growth defect (17). To date, however, the feature of the
4 of 6 | www.pnas.org/cgi/doi/10.1073/pnas.1207868109
Fig. 6. Rate of initiation of protein synthesis in E. coli sustained on the A-U,
G-U, and A-U/G-U mutants. E. coli KL16ΔmetYΔmetZWV sustained on A-U
[pmetY(A-U)], G-U [pmetY(G-U)], and A-U/G-U [pmetY(A-U/G-U)] mutant
tRNAs (i, ii, and iii, respectively), along with a control sustained on WT
tRNA (pmetY), were grown overnight in LB-ampicillin (Amp) and subcultured in Amp containing M9 minimal medium with 2% (vol/vol) glycerol.
β-Galactosidase activity was calculated by measuring the OD420. The square
root of the absorbance value (defined as “Miller units”) was plotted against
time (Materials and Methods). Data for the control strain sustained on
pmetY were reproduced in each panel for comparison. Arrows indicate the
points at which an increase in OD420 was first detected.
Samhita et al.
KL16 ∆metZW
KL16
Bars:
1, 5, 9 and 13: pCATam1metYCUA(A-U)
2, 6, 10 and 14: pCATam1metYCUA(G-U)
3, 7, 11 and 15: pCATam1metYCUA(A-U/G-U)
4, 8, 12 and 16: pCATam1metYCUA
Fig. 7. Direct assay of the in vivo initiation activity of the mutant tRNAs.
Biochemical assays to determine initiation rates of mutant initiator tRNAs in
the strains harboring different numbers of the WT initiator tRNA genes were
performed. Three independent colonies were grown to midlog phase and
used to make cell-free extracts. Means with SEs have been plotted. As indicated, bars 1–4, 5–8, 9–12, and 13–16 correspond to E. coli KL16, ΔmetY,
ΔmetZW, and ΔmetZWV strains, respectively, carrying pCATam1metYCUA(A-U)
(bars 1, 5, 9, and 13), pCATam1metYCUA(G-U) (bars 2, 6, 10, and 14), pCATam1metYCUA(A-U/G-U) (bars 3, 7, 11, and 15), or the positive control pCATam1metYCUA (bars 4, 8, 12, and 16). Cell-free extracts of E. coli KL16 harboring
pCATam1metYCUA produced ∼4,700 pmol of acetylchloramphenicol (Ac-Cm)
per microgram of total protein used (100%). This serves as the positive control, and all other values are plotted relative to this.
species of elongators (which read all the other codons, including
internal AUG codons). Precisely where the divergence occurred
has not been resolved by tRNA phylogenies, but it seems
reasonable to assume that the specialized methionine carrying
initiator was “frozen” later in time. The initiator tRNA population in E. coli is estimated to contribute ∼3% to the total
cellular pool of tRNA. A decrease in the amount of WT initiator
tRNA permits initiation to take place with mutant initiator
tRNAs that are normally rejected at the P-site. In fact, as Fig. 7
shows, the initiation activity of the mutants increases with a decrease in the cellular pools of the WT initiator tRNA.
The initiator tRNA participates in translation via the formation of an initiation complex on the 30S ribosomal subunit, together with the initiation factors and mRNA. Current models of
30S initiation complex formation, based largely on in vitro data,
are divided between a random and sequential binding order of
mRNA and initiator tRNA (19–22). In the latter model, the
debate is about which binds first, mRNA or initiator tRNA. Our
in vivo observation (Fig. 7) of continuous increase in the activity
of the mutant initiator tRNA as the WT complement is decreased is more simplistically interpreted by the hypothesis that
initiator tRNA is prebound to the ribosome following competition of varying degrees from other tRNAs. Increased binding of
the mutant initiator tRNA (expected from decreased chromosomally encoded WT initiator tRNA) would, in turn, facilitate increased mRNA selection by cognate codon anticodon pairing, and
therefore more translation of the CAT reporter in our assays. On
the other hand, if the mRNA was prebound, it would facilitate
Samhita et al.
PNAS Early Edition | 5 of 6
GENETICS
KL16 metZWV
KL16 ∆metY
selection of only the initiator tRNAs capable of decoding UAG
initiation codon at the P-site. Because the abundance of mutant
initiator tRNAs capable of decoding UAG is relatively unchanged
in our assays, the increase in initiation activity we see (i.e., on deletion of chromosomally encoded AUG reading initiator tRNAs)
would be hard to explain. Our interpretation that the initiator
tRNA binds first to the 30S subunit is also consistent with earlier
in vivo observations in which initiation with UAG, GUC, and AUC
codons in the same CAT reporter was studied (23).
The first two G-C pairs (at positions 29–41 and 30–40) of the
three present in the anticodon stem were suggested to be important for selection of the initiator tRNA in the P-site by Aminor interactions (3). However, subsequent structural studies
showed that A1339 makes a suboptimal interaction, with the
distance between the N1 of A1339 and the 2′-OH of G (at position 29) being too long for a hydrogen bond. This observation
also suggests a more important role for the middle G-C (at
positions 30–40) in selection of the initiator tRNA in the P-site
(4). Our present observations and the earlier observation (3) are
thus fully consistent with such an interpretation and demonstrate
the critical nature of the middle G-C. Why then should most
organisms evolve with initiator tRNAs having 3G-C pairs? As
suggested, even though the interaction of A1339 with the first
G-C is not clearly seen, it could be that during initiation, conformational changes could allow this interaction to occur, supporting its role at a later stage in initiation. Whereas the role of
the third G-C (at positions 31–39) has remained unclear (3), we
note that in the native gel, although the A-U mutant migrates
at the same position as the WT initiator, both the G-U and the
A-U/G-U mutants migrate slower (Fig. 2), strongly suggesting
a conformational change in these mutants. Thus, the third G-C is
likely to maintain structural integrity by locking the anticodon
loop. Such a function is likely to limit the nonproductive conformations the loop may adopt, making it more efficient for the
ribosome to sample the correct one(s). It may be mentioned that
the proposed function of the third G-C pair in maintaining structural integrity of the anticodon loop does not negate an earlier
proposal that the ribosomal residues (1338/1339) may contact it at
a later stage in initiation (3). Thus, an initiator tRNA with 3G-C
pairs may offer a fitness advantage to the cell over those lacking
one or more of the G-C pairs.
Nevertheless, minimization of the highly conserved feature of
the 3G-C pairs to a mere single G-C pair (at positions 30–40) has
essentially reduced it to a feature that is no longer unique to the
initiator tRNA. In fact, several elongator tRNAs even possess
the first two G-C pairs (e.g., tRNAPhe, tRNACys). How then do
cells possessing an initiator tRNA with a single G-C pair ensure
fidelity of P-site binding? As evidenced (12), there is competition
for P-site binding by different tRNAs. At least in eubacteria,
cellular abundance of the initiator tRNA may be a critical criterion to ensure fidelity of its binding to the P-site. A recent report
of an enterotoxin, VapC, in Shigella and Salmonella serovars, is
of particular relevance because VapC specifically targets initiator
tRNA, resulting in its low abundance in the cell with respect to the
elongator tRNAs (24). This leads to the interesting hypothesis that
promiscuous initiation by elongator tRNAs (12) may be a potential strategy that cells use occasionally to achieve phenotypic diversity during stressful conditions that result in relative depletion
of the initiator tRNA (8, 24, 25). Such a strategy would have the
added advantage of enhancing phenotypic plasticity without disturbing the integrity of the genome as, for instance, a mutational
event would do.
Our present observations also emphasize the importance
of intracellular competition in estimating the functionality of
mutant molecules. As demonstrated, initiation activities of mutant
tRNAs can differ tremendously in a WT cell vs. a cell whose stock
of WT initiator tRNA is depleted. More broadly, it suggests the
need for caution in dismissing mutants as “nonfunctional,” and
a reexamination of some cases is perhaps warranted, taking into
account competition from the WT molecule.
using 32P end-labeled DNA oligomers, 5′ GAGCCCGACGAGCTACCAGGCTGCTCCACC 3′ or 5′ GCAGATTTACAGTCTGCTCCCTTTGGCCGCTCGGGAACCCCAC 3′, specific to tRNAfMet and tRNATyr, respectively.
Materials and Methods
Strains and Plasmids. The strains and plasmids used have been listed in Table
S1. E. coli KL16 (26) or its derivatives were used for most experiments. Bacteria were grown in LB or LB-agar plates containing 1.8% (wt/vol) bactoagar
(Difco). Unless indicated otherwise, media were supplemented with ampicillin (Amp, 100 μg/mL), chloramphenicol (30 μg/mL), kanamycin (25 μg/mL),
or IPTG (1 mM) as required.
Growth Curves. Growth curves were carried out using at least three replicates
of each culture. Overnight cultures were diluted 100-fold in LB with antibiotics as indicated. Aliquots (200 μL) of the diluted culture were taken in
honeycomb plates and shaken in an automated Bioscreen C growth reader
(Oy Growth) maintained at 37 °C. The OD600 was measured at 1-h intervals,
and data were plotted showing the mean values with SEs.
Site-Directed Mutagenesis. The plasmid pmetY, carrying the metY gene
encoding tRNAfMet2, was used as a template for mutagenesis by inverse PCR
utilizing a complementary set of DNA oligomers with the desired mutations.
Details of the PCR conditions and DNA oligomers used are provided in
SI Materials and Methods.
Determination of Initiation Rates from β-Galactosidase Induction Time Course
Assay. To assess relative initiation rates in the strains carrying mutant initiator tRNAs, a modified version of the original β-galactosidase assay (14,
29–31) was used. Details of the method are provided in SI Materials
and Methods.
Generation of ΔmetY::cm and ΔmetZWV::kan Strains. Methodologies to knock
out metY and metZWV in E. coli DY330 (27) and mobilization of KO alleles
are described in SI Materials and Methods.
Subcloning of metY Mutants into pAM34 Vector. The mutant tRNA genes were
mobilized from pmetY into pAM34 carrying an IPTG-inducible origin of replication (28) using EcoRI and PstI, which release metY as a 500-bp size fragment.
Preparation of Cell-Free Extracts and CAT Assays. E. coli cells grown in 2 mL of
LB containing Amp to midlog phase and processed to prepare cell-free
extracts by gentle lysis were used for CAT assays (32). Details are given in SI
Materials and Methods.
Isolation of tRNAs and Northern Blot Analysis. Total tRNA preparations from
various strains were fractionated on native 15% polyacrylamide gels, electroblotted onto Nytran membrane and analyzed by Northern blotting (13)
ACKNOWLEDGMENTS. We thank our laboratory colleagues for their
suggestions on the manuscript. This work was supported by grants from
the Department of Science and Technology and the Department
of Biotechnology, New Delhi. S.S. is supported by a Shyama Prasad
Mukherjee fellowship of the Council of Scientific and Industrial Research,
New Delhi.
1. Seong BL, RajBhandary UL (1987) Escherichia coli formylmethionine tRNA: Mutations
in GGGCCC sequence conserved in anticodon stem of initiator tRNAs affect initiation
of protein synthesis and conformation of anticodon loop. Proc Natl Acad Sci USA 84:
334–338.
2. Varshney U, Lee CP, RajBhandary UL (1993) From elongator tRNA to initiator tRNA.
Proc Natl Acad Sci USA 90:2305–2309.
3. Lancaster L, Noller HF (2005) Involvement of 16S rRNA nucleotides G1338 and A1339
in discrimination of initiator tRNA. Mol Cell 20:623–632.
4. Selmer M, et al. (2006) Structure of the 70S ribosome complexed with mRNA and
tRNA. Science 313:1935–1942.
5. Yusupov MM, et al. (2001) Crystal structure of the ribosome at 5.5 A resolution. Science
292:883–896.
6. Kenri T, Imamoto F, Kano Y (1994) Three tandemly repeated structural genes encoding tRNA(f1Met) in the metZ operon of Escherichia coli K-12. Gene 138:261–262.
7. Mandal N, RajBhandary UL (1992) Escherichia coli B lacks one of the two initiator
tRNA species present in E. coli K-12. J Bacteriol 174:7827–7830.
8. Kenri T, Kohno K, Goshima N, Imamoto F, Kano Y (1991) Construction and characterization of an Escherichia coli mutant with a deletion of the metZ gene encoding
tRNA (f1Met). Gene 103:31–36.
9. Kenri T, Imamoto F, Kano Y (1992) Construction and characterization of an Escherichia coli mutant deficient in the metY gene encoding tRNA(f2Met): Either tRNA
(f1Met) or tRNA(f2Met) is required for cell growth. Gene 114:109–114.
10. Mandal N, Mangroo D, Dalluge JJ, McCloskey JA, Rajbhandary UL (1996) Role of the
three consecutive G:C base pairs conserved in the anticodon stem of initiator tRNAs in
initiation of protein synthesis in Escherichia coli. RNA 2:473–482.
11. Das G, et al. (2008) Role of 16S ribosomal RNA methylations in translation initiation in
Escherichia coli. EMBO J 27:840–851.
12. Kapoor S, Das G, Varshney U (2011) Crucial contribution of the multiple copies of the
initiator tRNA genes in the fidelity of tRNA(fMet) selection on the ribosomal P-site in
Escherichia coli. Nucleic Acids Res 39:202–212.
13. Lee CP, Seong BL, RajBhandary UL (1991) Structural and sequence elements important
for recognition of Escherichia coli formylmethionine tRNA by methionyl-tRNA
transformylase are clustered in the acceptor stem. J Biol Chem 266:18012–18017.
14. Dalbow DG, Young R (1975) Synthesis time of beta-galactosidase in Escherichia coli
B/r as a function of growth rate. Biochem J 150:13–20.
15. Varshney U, RajBhandary UL (1990) Initiation of protein synthesis from a termination
codon. Proc Natl Acad Sci USA 87:1586–1590.
16. Guillon JM, Mechulam Y, Schmitter JM, Blanquet S, Fayat G (1992) Disruption of the
gene for Met-tRNA(fMet) formyltransferase severely impairs growth of Escherichia
coli. J Bacteriol 174:4294–4301.
17. Newton DT, Creuzenet C, Mangroo D (1999) Formylation is not essential for initiation
of protein synthesis in all eubacteria. J Biol Chem 274:22143–22146.
18. Aström SU, von Pawel-Rammingen U, Byström AS (1993) The yeast initiator tRNAMet
can act as an elongator tRNA(Met) in vivo. J Mol Biol 233:43–58.
19. Hartz D, McPheeters DS, Green L, Gold L (1991) Detection of Escherichia coli ribosome
binding at translation initiation sites in the absence of tRNA. J Mol Biol 218:99–105.
20. Gold L (1988) Posttranscriptional regulatory mechanisms in Escherichia coli. Annu Rev
Biochem 57:199–233.
21. Van Duin J, Overbeek GP, Backendorf C (1980) Functional recognition of phage RNA
by 30-S ribosomal subunits in the absence of initiator tRNA. Eur J Biochem 110:
593–597.
22. Gualerzi CO, Pon CL (1990) Initiation of mRNA translation in prokaryotes. Biochemistry 29:5881–5889.
23. Wu XQ, Iyengar P, RajBhandary UL (1996) Ribosome-initiator tRNA complex as an
intermediate in translation initiation in Escherichia coli revealed by use of mutant
initiator tRNAs and specialized ribosomes. EMBO J 15:4734–4739.
24. Winther KS, Gerdes K (2011) Enteric virulence associated protein VapC inhibits
translation by cleavage of initiator tRNA. Proc Natl Acad Sci USA 108:7403–7407.
25. Krin E, Laurent-Winter C, Bertin PN, Danchin A, Kolb A (2003) Transcription regulation coupling of the divergent argG and metY promoters in Escherichia coli K-12.
J Bacteriol 185:3139–3146.
26. Low B (1968) Formation of merodiploids in matings with a class of Rec- recipient
strains of Escherichia coli K12. Proc Natl Acad Sci USA 60:160–167.
27. Datsenko KA, Wanner BL (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA 97:6640–6645.
28. Gil D, Bouché JP (1991) ColE1-type vectors with fully repressible replication. Gene
105:17–22.
29. Dalbow DG, Bremer H (1975) Metabolic regulation of beta-galactosidase synthesis in
Escherichia coli. A test for constitutive ribosome synthesis. Biochem J 150:1–8.
30. Tobin C, Mandava CS, Ehrenberg M, Andersson DI, Sanyal S (2010) Ribosomes lacking
protein S20 are defective in mRNA binding and subunit association. J Mol Biol 397:
767–776.
31. Miller JH (1972) In Experiments in Molecular Genetics (Cold Spring Harbor Lab Press,
Cold Spring Harbor. NY).
32. Varshney U, Lee CP, Seong BL, RajBhandary UL (1991) Mutants of initiator tRNA that
function both as initiators and elongators. J Biol Chem 266:18018–18024.
6 of 6 | www.pnas.org/cgi/doi/10.1073/pnas.1207868109
Samhita et al.