* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Developmental and functional studies of the SLC12 gene family
Endomembrane system wikipedia , lookup
Cell culture wikipedia , lookup
Cell encapsulation wikipedia , lookup
Organ-on-a-chip wikipedia , lookup
Signal transduction wikipedia , lookup
Magnesium transporter wikipedia , lookup
Hedgehog signaling pathway wikipedia , lookup
Articles in PresS. Am J Physiol Cell Physiol (October 14, 2009). doi:10.1152/ajpcell.00376.2009 1 Developmental and functional studies of the SLC12 gene family 2 members from Drosophila melanogaster 3 Qifei Sun1, E Tian2, R. James Turner1 and Kelly G. Ten Hagen2 4 5 6 1 Membrane Biology Section, Molecular Physiology and Therapeutics Branch, and 7 2 Developmental Glycobiology Unit, Laboratory of Cell and Developmental Biology, National 8 Institute of Dental and Craniofacial Research, National Institutes of Health, DHHS, Bethesda, 9 Maryland 20892-1190, USA 10 11 12 Running title: SLC12 gene family of Drosophila melanogaster 13 14 15 16 Corresponding authors: Dr R. James Turner, Bldg. 10, Rm. 1A01, 10 Center Drive MSC 1190, 17 National Institutes of Health, Bethesda MD 20892-1190. Tel. (301) 402-1060, FAX (301) 402- 18 1228, e-mail [email protected] and Dr. Kelly G. Ten Hagen, Bldg. 30, Rm. 426, 30 Convent Dr 19 MSC 4370, National Institutes of Health, Bethesda MD 20892-4370. Tel. (301) 301 451-6318, 20 FAX (301) 402-0897, e-mail [email protected] 21 22 23 Copyright © 2009 by the American Physiological Society. 2 24 ABSTRACT 25 The electroneutral cation-chloride cotransporter gene family, SLC12, contains nine members in 26 vertebrates. These include seven sodium and/or potassium-coupled chloride transporters and two 27 membrane proteins of unknown function. Although SLC12 family members have been identified 28 in a number of lower species, the functional properties of these proteins are unknown. There are 29 five SLC12 homologues in Drosophila melanogaster including at least one member on each of 30 the four main branches of the vertebrate phylogenetic tree. We have employed in situ 31 hybridization to study the expression patterns of the Drosophila SLC12 proteins during 32 embryonic development. Our studies indicate that all five members of this family are expressed 33 during early embryogenesis (stages 1-6) but that spatial and temporal expression patterns become 34 more refined as development proceeds. Expression during late embryogenesis was seen 35 predominantly in the ventral nerve cord, salivary gland, gut and anal pad. In parallel studies we 36 have carried out transport assays on each of the five Drosophila homologues expressed as 37 recombinant proteins in the cultured insect cell line High Five. Under our experimental conditions 38 we found that only one of these proteins, CG4357, transported the potassium congener 86Rb. 39 Additional experiments established that rubidium transport via CG4357 was saturable (Km = 40 0.29+0.05 mM), sodium-dependent (K1/2 = 53+11 mM), chloride-dependent (K1/2 = 48+5 mM) 41 and potently inhibited by bumetanide (KI = 1.17+0.08 μM), a specific inhibitor of Na+-K+-2Cl- 42 cotransporters. Taken together our results provide strong evidence that CG4357 is an insect 43 orthologue of the vertebrate Na+-K+-2Cl- cotransporters. 44 45 46 Key words: Drosophila embryogenesis, in situ hybridization, Na+-K+-2Cl- cotransport, cation- 47 chloride cotransport, chloride transport 48 49 3 50 51 INTRODUCTION SLC12 is a small gene family of integral membrane proteins. To date all of the SLC12 52 family members that have been successfully functionally characterized have proven to be 53 electroneutral cation-chloride cotransporters (2; 4). The existence and physiological significance 54 of a number of these transporters was established in functional studies that began to appear in the 55 early 1980s (13), long before it was realized that they were genetically related proteins. The first 56 of the SLC12 proteins to be identified at the molecular level was the Na+-K+-2Cl- cotransporter 57 (NKCC1) of the shark rectal gland which was cloned in 1994 (18). It is now known that there are 58 nine SLC12 family members in vertebrates (2; 4); two Na+-K+-2Cl- cotransporters (NKCC1 and 59 NKCC2), a Na+-Cl- cotransporter (NCC), four K+-Cl- cotransporters (KCC1, KCC2, KCC3 and 60 KCC4), and two additional proteins, commonly referred to as CIP and CCC9, whose function 61 remains uncertain. In addition, SLC12 sequences have been identified in a number of lower 62 species including crustaceans, insects, worms, plants, fungi and some bacteria. 63 In vertebrates SLC12 family members are known to play important roles in numerous 64 physiological processes including exocrine fluid secretion, renal salt and water absorption, 65 hearing, olfaction, spermatogenesis, pain perception, visual processing and other neuronal 66 functions (2; 4; 5; 8). However, little is known about the properties or significance of the SLC12 67 proteins in lower species. There are five SLC12 homologues in the model organism Drosophila 68 melanogaster including at least one member on each of the four main branches of the vertebrate 69 phylogenetic tree. Our purpose here is to begin to characterize these Drosophila SLC12 proteins 70 in order to understand their significance in Drosophila as well as to eventually better understand 71 the properties of their vertebrate orthologues. We have used in situ hybridization to study the 72 expression patterns of the Drosophila SLC12 family members during embryonic development. In 73 addition we have explored their functional properties when they are expressed in the cultured 74 insect cell line High Five. Interestingly one of these proteins, CG4357, was found to have the 4 75 functional properties of a Na+-K+-2Cl- cotransporter with kinetic properties very similar to 76 vertebrate NKCCs. 77 5 78 MATERIALS AND METHODS 79 Molecular Biology 80 Molecular biological procedures employed standard methods. Ligations of PCR products 81 were carried out using restriction sites incorporated into the PCR primers. The correctness of all 82 clones used in the paper was confirmed by direct sequencing. 83 Preparation of Drosophila SLC12 RNA probes 84 Full length cDNA clones of the 5 Drosophila SLC12 proteins CG4357 (clone GH27027), 85 CG31547-PB (clone GH09711), CG12773 (clone LD15480), CG10413 (clone GH08340) and 86 CG5594-PB (clone GH09271) were purchased from the Drosophila Genomics Resource Center 87 (DGRC). The complete coding sequences of CG4357, CG12773 and CG10413 were amplified by 88 PCR and ligated into pBlueScript SK+ (Stratagene) between EcoRI and NotI, EcoRI and NotI, 89 and XhoI and NotI, respectively. The nucleotide sequences corresponding to amino acids 93-1068 90 of CG31547-PB and amino acids 31-898 of CG5594-PB were amplified by PCR and ligated into 91 pBlueScript SK+ between EcoRI and NotI, and XhoI and NotI, respectively; these regions of 92 CG31547 and CG5594 were common to all alternatively spliced versions of their respective 93 genes. Riboprobes were synthesized using the DIG RNA labeling kit (Roche). To generate sense 94 probes, plasmids were linearized with NotI and transcribed with T7 RNA polymerase, and to 95 generate antisense probes plasmids were linearized with EcoRI or XhoI, as appropriate, and 96 transcribed with T3 RNA polymerase. 97 Whole mount in situ hybridization 98 99 Embryos were collected at 6 and 18 hours after egg lay on grape juice agar plates then dechorionated and fixed according to Tautz and Pfeifle (14). Briefly, embryos were 100 dechorionated in 100% bleach for 1-3 min and then fixed in 2.5 ml 4% formaldehyde, 160 mM 101 KCl, 40 mM NaCl, 4 mM EGTA and 30 mM Pipes. To this mixture, 2.5 ml heptane was added 102 and the embryos were vortexed vigorously. The lower aqueous phase was removed and methanol 103 was added. Fixed embryos were stored in methanol at -20oC or used immediately for in situ 6 104 hybridization. For in situ hybridization embryos were treated with formaldehyde/PBT (PBS with 105 0.1% Tween 20), followed by 3 µg/mL Proteinase K for 3-5 min and then fixed again with 4% 106 formaldehyde/PBT. Hybridization was performed at 58oC overnight using 0.1 µg/ml DIG-labeled 107 antisense or sense probes as described previously (16). Washing was performed using serial 108 dilutions of the hybridization buffer in PBT. Embryos were then incubated with anti-DIG-AP 109 antibody (Roche) (1:2000 in PBT) overnight at 4oC. Wash and color development were 110 performed using PBT and BM Purple AP substrate (Roche). Embryos were equilibrated in 70% 111 glycerol/PBT and stored at 4oC. Embryo staging was performed according to Hartenstein (6). 112 Drosophila strains and crosses 113 Crosses were performed using the following Drosophila melanogaster stocks obtained 114 from the Bloomington Stock Center (Indiana University): #20377 (y1, w67c23; 115 P{wHy}Ncc69DG04311) which contains a P-element transposon insertion in the 5’UTR of the 116 CG4357 gene; and #5492 (w*; Df(3L)eygC1/TM3, P{ftz/lacC}SC1, ryRK Sb1 Ser1), which deletes 117 the 69A4-69D6 region of chromosome 3L. The wild type strain used was Oregon R. All 118 Drosophila crosses were performed at 25oC on MM media (KD Medical, Inc.). 119 Quantitative PCR 120 Parents and progeny from the Drosophila crosses were collected to quantitate CG4357 121 gene expression using quantitative PCR (QPCR). DNase-free RNA and cDNA were prepared 122 from five adult females of each genotype using the FastRNA Pro Green kit (Q-BIOgene) with 123 DNase removal treatment (Ambion) and reverse transcription (Bio-Rad), according to the 124 manufacturers’ instructions. Primers for quantitative PCR were designed using Beacon Designer 125 software (Bio-Rad). Primer sequences used to detect CG4357 gene expression are: 126 TACTCCCGCAGCCGCAAATACC (antisense), ACCAGCAGCAGGGCAACTCTC (sense). 127 Quantitative PCR was performed for 40 cycles (95 °C for 10 seconds and 62 °C for 30 seconds) 128 using SYBR-GREEN PCR Master Mix, 1 ng of each cDNA sample and a My IQ real time PCR 7 129 thermocycler (Bio-Rad). Gene expression was normalized to 18S rRNA. Reactions were run in 130 triplicate, and each experiment was repeated three times. 131 Insect expression vectors for Drosophila SLC12 proteins 132 The complete coding sequences, including their native stop codons, of CG4357, 133 CG31547-PB, CG12773, CG10413, and CG5594-PB were amplified by PCR and ligated into the 134 insect expression vector pIB/V5-His (Invitrogen) between HindIII and NotI (CG4357, CG31547- 135 PB, CG10413 and CG5594-PB) or SacI and NotI (CG12773). A CG4357 clone without its native 136 stop codon and in frame with the V5 C-terminal tag of the pIB/V5-His vector was also 137 constructed. All clones included an upstream Kozak consensus sequence. pIB/V5-His-CAT, a 138 control vector expressing V5-tagged chloramphenicol acetyltransferase (CAT) was used as a 139 control in some experiments. 140 Anti-CG4357 antibody production 141 The nucleotide sequence corresponding to amino acids 899-1171 of CG4357 was 142 amplified by PCR and ligated into the bacterial expression vector pQE30 (Qiagen) between 143 BamHI and HindIII in frame with a 6xHis N-terminal tag. The resulting 6xHis fusion protein was 144 expressed in E. coli and purified on Ni-NTA Agarose (Qiagen) following the manufacturer’s 145 instructions. Anti-CG4357 antibody was raised in rabbits against this recombinant protein by 146 Sigma-Genosys. The ability of the antibody to detect the CG4357 protein expressed in the insect 147 cell line High Five was confirmed by Western blotting (see below). 148 High Five cell culture, transfection and preparation of crude membranes 149 The High Five insect cell line was grown in Express Five SFM medium supplemented 150 with 25 µg/mL Gentamycin Sulfate and 2mM glutamine at 27oC (the High Five cells and all 151 media were from Invitrogen). Cells were grown and maintained in 6 cm culture dishes and 152 vigorously pipetted into suspension for splitting. High Five cells growing in 6 cm culture dishes 153 were transfected with the plasmids indicated using Cellfection (Invitrogen) according to the 8 154 manufacturer's instructions. Crude membranes were prepared from High Five cells transiently 155 transfected with the plasmids indicated as previously described (9). 156 Western Blotting and Confocal Microscopy 157 SDS-polyacrylamide gel electrophoresis and Western blotting were carried out as 158 previously described (12). The primary antibodies used were anti-CG4357 (dilution 1:5000) or an 159 anti-V5 monoclonal (Invitrogen; dilution 1:1000). Horseradish peroxidase-conjugated secondary 160 antibodies (Pierce) were used at a dilution of 1:10000 and detection was carried out using the 161 ECL kit from Amersham Biosciences. 162 For the confocal studies High Five cells transiently transfected with the plasmids 163 indicated were re-plated onto glass coverslips. Immunostaining was carried out as previously 164 described (10) using anti-CG4357 (dilution 1:600) or the anti-V5 monoclonal (dilution 1:100) as 165 primary antibodies. The secondary antibodies (diluted 1:200) were Alexa Flour® 594 donkey 166 anti-rabbit IgG (H+L) and Alexa Flour® 488 goat anti-mouse IgG (H+L), respectively (both from 167 Invitrogen). 168 86 Rb Flux Assay 169 The following media were used in the flux experiments. "Preincubation medium" 170 contained 50 mM NaCl, 4 mM CaCl2, 11 mM MgCl2, 15 mM Na-HEPES (pH 7.3 with NaOH), 5 171 mM glucose and 170 mM sucrose. Unless indicated otherwise "uptake medium" was 172 preincubation medium containing in addition 20 µM RbCl and ~0.3 µCi/mL 86Rb (Perkin Elmer). 173 "Termination medium" was preincubation medium containing in addition 5 mM RbCl, and 250 174 µM bumetanide. All media are ~340 mOs. 175 The procedure for the 86Rb flux assays was similar to the one previously described from 176 our laboratory for HEK-293 cells (1) with some modifications. High Five cells growing in 6 cm 177 culture dishes were transfected with the plasmids indicated. The next day the plasmid was 178 removed and the cells were re-plated into 24 well dishes in fresh culture medium. The flux assay 179 was then carried out the following day as described below (variations in the flux protocol, if any, 9 180 are noted in the figure legends). A row of four wells was used for each experimental point, three 181 wells were used to measure 86Rb flux (i.e. fluxes were carried out in triplicate) and the fourth well 182 was used to determine the protein/well using the BCA protein assay kit (Pierce). All of the wells 183 were treated identically with the exception that 86Rb was omitted from the uptake medium in the 184 fourth well. For each row of wells, the culture medium was removed, the wells were washed twice 185 in preincubation medium (in every case, additions to the wells were 0.5 ml), and then incubated in 186 preincubation medium for 40 min at room temperature (20 °C, all steps hereafter were carried out 187 at room temperature). 86Rb uptake was initiated by replacing the preincubation medium with 188 uptake medium. After 7 min of incubation, the uptake medium was removed and the well was 189 washed 3 times with termination medium. Finally, a 0.5-ml aliquot of 1% Triton X-100 was 190 added to each well, and samples were taken for liquid scintillation counting and protein 191 determination. In control experiments (data not shown) we have verified that 86Rb uptake is linear 192 with time for at least 7 min under the experimental conditions described here. 193 Data Presentation 194 All quantitative results are expressed as means ± S.E. for three or more independent 195 experiments. Theoretical fits to the data were carried out by non-linear least squares regression 196 using the program SigmaPlot. 197 10 198 RESULTS 199 Phylogenetic Analysis of the SLC12 Gene Family 200 Blast searches of the Drosophila melanogaster genome reveal five members of the 201 SLC12 gene family: CG4357 (also called Ncc69), CG31547 (occurring in two alternatively 202 spliced versions, CG31547-PA and CG31547-PB), CG12773, CG10413, and CG5594 (occurring 203 in four alternatively spliced versions, CG5594-PA, CG5594-PB, CG5594-PC, and CG5594-PD). 204 Fig. 1 shows a phylogenetic tree of SLC12 family members from human (shaded in gray), 205 Drosophila melanogaster (in bold), C. elegans (C el 1 through 6) and several other representative 206 species (see Figure caption for further details). It can be seen that the vertebrate (human) family 207 members lie on 4 main branches: one containing the sodium-dependent transporters NKCC1, 208 NKCC2 and NCC; one containing the potassium-dependent transporters KCC1, KCC2, KCC3 209 and KCC4; and two other branches, one containing CIP and the other CCC9, both of whose 210 function is presently unknown. There is at least one Drosophila orthologue and one C. elegans 211 orthologue on each of these four branches. 212 Expression patterns of the SLC12 family during Drosophila embryogenesis 213 To determine the temporal and spatial expression pattern of members of the SLC12 gene 214 family during Drosophila development, we performed whole mount in situ hybridization using 215 non-radioactive DIG-labeled RNA probes. In general, members of the SLC12 gene family 216 exhibited unique expression patterns during Drosophila embryonic development, suggesting 217 distinct biological roles for the membrane proteins they encode. 218 Expression of CG4357 was first detectable during early embryonic stages 1-3 (Fig. 2). 219 Expression at these stages usually represents maternal RNA contributed to the oocyte by the 220 mother. CG4357 expression was then detected at the cellular blastoderm stages (stages 4-6), 221 when individual cells surround the central yolk sac and zygotic expression is first observed (Fig. 222 2). As development proceeds, three germ layers are generated during gastrulation (stages 6-8), 223 followed by germ band elongation at stages 9-11 and germ band retraction at stages 12-13. 11 224 CG4357 expression was seen in the developing gut and nervous system during germ band 225 elongation and retraction stages (stages 9-13; Fig. 2). During stages 14-15, which represents the 226 completion of a number of different morphogenic movements, CG4357 expression is detected 227 predominantly in the foregut and anterior region of the developing embryo. The expression 228 pattern of CG4357 persists through stages 16-17, during which organ system differentiation is 229 completed just prior to the onset of larval development. 230 CG12773 showed patterns of expression similar to those of CG4357 during 231 embryogenesis (Fig. 3). CG12773 was expressed broadly during stages 1-6, followed by 232 expression in the developing gut and nervous system throughout most of the later stages of 233 embryonic development (stages 9-17). 234 CG5594 displayed maternal expression at stages 1-3, followed by expression during 235 cellular blastoderm (stages 4-6) (Fig. 4). 236 hindgut, anal pads and the ventral nerve cord were seen during stages 12-13. Expression in the 237 hindgut, anal pads and nervous system continued throughout stages 14-17. Expression in the anterior and posterior midgut, 238 CG31547 was expressed during stages 1-6 (Fig. 5). At stages 9-11, expression was seen 239 in the developing anterior and posterior midgut and the hindgut. At stages 12-13, expression of 240 CG31547 was seen in the nervous system and gut, with very intense expression in the anal pads 241 (Fig. 4). At later stages (14-17), expression was most intense in the salivary glands and the anal 242 pads. 243 Finally, expression of CG10413 was distinct from that seen for other family members. 244 Maternally contributed CG10413 transcripts were seen during stages 1-3, followed by expression 245 during cellular blastoderm (stages 4-6) (Fig. 6). Thereafter, specific expression of CG10413 246 during later stages of embryogenesis was not detected. 247 Functional activity 248 249 We tested for functional activity of the five Drosophila SLC12 family members by measuring the uptake of 86Rb into High Five cells transiently transfected with CG4357, 12 250 CG31547-PB, CG12773, CG10413, and CG5594-PB, each cloned into the insect expression 251 vector pIB/V5-His (see Methods). Rubidium is a potassium congener that is known to substitute 252 for potassium on a number of biological membrane transporters, including the vertebrate KCCs 253 and NKCCs. For this reason we felt that 86Rb transport was an appropriate first functional test of 254 the Drosophila SLC12 family. As shown in Fig. 7, under our experimental conditions only the 255 protein CG4357 was found to exhibit 86Rb transport levels significantly above those seen with the 256 empty vector pIB/V5-His. 257 Characterization of CG4357 expression in High Five cells 258 In order to further characterize the CG4357 protein we first examined its expression and 259 localization in the High Five cells. In Western blots anti-CG4357, an antibody raised against the 260 C-terminal 273 residues of CG4357 (see Methods), showed no reaction with membranes prepared 261 from High Five cells transfected with the empty vector pIB/V5-His, but recognized a single 262 protein of molecular weight ~130 kD in membranes prepared from High Five cells transfected 263 with either CG4357 or CG4357 tagged with the V5 epitope (Fig. 8A; the predicted molecular 264 weight of CG4357 is 129 kDa). A protein of the same molecular weight was recognized by an 265 anti-V5 antibody in cells transfected with V5-tagged CG4357 (Fig. 8A), confirming the 266 specificity of the anti-CG4357 antibody. 267 Fig. 8B shows confocal micrographs of High Five cells transfected with the empty vector 268 pIB/V5-His (panel a), pIB/V5-His-CAT, a control vector expressing the cytosolic protein V5- 269 tagged chloramphenicol acetyltransferase (panel b), CG4357 (panel c), and V5-tagged CG4357 270 (panel d). All cells were simultaneously probed with both anti-V5 (green) and anti-CG4357 (red) 271 antibodies. It is clear from panels c and d that both CG4357 and V5-tagged CG4357 are localized 272 at or very near the plasma membrane of the High Five cells (the yellow staining in panel d is 273 presumably due to the labeling of V5-tagged CG4357 by both anti-CG4357 and anti-V5 274 antibodies). In Fig. 8C we examined the transport of 86Rb in High Five cells transiently 275 transfected as in Fig. 8B. Interestingly, although both CG4357 and V5-tagged CG4357 appear to 13 276 be trafficked to the plasma membrane of the High Five cells (Fig. 8B), only cells expressing the 277 untagged protein exhibit CG4357-dependent 86Rb transport activity. 278 Characterization of transport via CG4357 in High Five cells 279 We next examined the properties of 86Rb flux via CG4357. Because the High Five cells 280 exhibit significant endogenous rubidium transport we always measured 86Rb uptake in both cells 281 transfected with empty vector (pIB/V5-His) and cells transfected with CG4357 on the same day 282 and under the same experimental conditions. Specific fluxes via CG4357 could then be 283 determined by subtracting the fluxes observed from cells transfected with empty vector. In Fig. 284 9A we illustrate the rubidium concentration dependence of 86Rb uptake into High Five cells 285 transfected with empty vector. This endogenous flux is clearly saturable and analysis of these 286 data via non-linear least squares regression reveals an excellent fit to the Michaelis-Menten 287 equation indicating the presence of a single endogenous rubidium transport system in the High 288 Five cells with Km = 2.56+0.15 mM (see Fig. 9 caption). The flux induced by expression of 289 CG4357 is likewise saturable and also conforms well to Michaelis-Menten kinetics with Km = 290 0.29+0.05 mM (Fig. 9 caption). 291 In Fig. 10 we show the sodium concentration dependence of 86Rb uptake into High Five 292 cells transfected with empty vector (panel A) and CG4357 (panel B). No significant sodium 293 dependence is seen for the endogenous High Five rubidium transport system (panel A) but the 294 flux via CG4357 is clearly sodium-dependent (panel B) and conforms well to the Michaelis- 295 Menten equation with K1/2 = 53+11 mM (Fig. 10 caption). 296 The effect of chloride concentration is illustrated in Fig. 11. The endogenous High Five 297 transport system shows a saturable dependence on chloride (panel A) which can be modeled by 298 the Michaelis-Menten equation with K1/2 = 80+13 mM (see figure caption). In contrast the 299 dependence of rubidium transport via CG4357 on chloride concentration is clearly sigmoidal 300 (panel B) indicating the involvement of more than one chloride ion in the rubidium transport 14 301 event. These latter data conform well to the Hill equation with K1/2 = 48+5 mM and n = 2.6+0.3 302 (see Fig. 11 caption), where n is a measure of the Cl:Rb stoichiometry (17). 303 Effects of SLC12 inhibitors 304 In Fig. 12 we examine the effects of the SLC12 inhibitors bumetanide (white bars), a 305 specific inhibitor of NKCCs, furosemide (dark gray bars), an inhibitor of NKCCs and KCCs, and 306 metolazone (light gray bars), a specific inhibitor of NCCs; in each case fluxes have been 307 normalized to that observed in the absence of inhibitors (black bars). All three of the compounds 308 tested are employed clinically as diuretics in humans. These data indicate that metolazone has no 309 significant inhibitory effect on either endogenous High Five 86Rb transport (panel A) or on 86Rb 310 transport via GC4357 (panel B). On the other hand, furosemide and bumetanide inhibit both 311 transporters with bumetanide appearing to be somewhat more effective on the endogenous system 312 and dramatically more effective on CG4357. The bumetanide dose response for inhibition of 313 CG4357 is shown in Fig. 13. These data indicate that the KI for bumetanide inhibition of CG4357 314 is 1.17+0.08 μM (see figure caption), a value very similar to that found for vertebrate NKCC1s 315 (1; 7). 316 Loss of CG4357 gene expression does not affect viability 317 To further investigate the role of the SLC12 family member CG4357 during Drosophila 318 development, we generated flies deficient in CG4357 expression by crossing a Drosophila strain 319 that contains a P-element transposon insertion mutation in the 5’UTR of CG4357 320 (P{wHy}Ncc69DG04311) and a strain that contains a chromosomal deletion that encompasses 321 CG4357 (Df(3L)). Progeny from this cross that were heterozygous for either the transposon 322 (P{wHy}Ncc69DG04311/+) or the deletion (Df(3L)/+) were viable and had an approximately 50% 323 reduction in the level of CG4357 expression relative to wild type as determined by QPCR (Fig. 324 14). This indicates that both the transposon and the deletion decrease CG4357 expression. 325 Progeny from this cross that contained both the transposon insertion and the chromosomal 326 deletion together (P{wHy}Ncc69DG04311/Df(3L)) had greatly reduced CG4357 expression relative 15 327 to wild type (Fig. 14). However, no significant decrease in viability relative to their heterozygous 328 siblings was observed (data not shown). 329 16 330 331 DISCUSSION The long-term goal of our studies is to understand the developmental and functional roles 332 of the cation-chloride-coupled cotransporter gene family SLC12 in the model organism 333 Drosophila melanogaster. We anticipate that this information will not only lead to a better 334 appreciation of the significance of these proteins in Drosophila but also to increased 335 understanding of their vertebrate orthologues. Here we employed in situ hybridization to study 336 the expression patterns of the five Drosophila SLC12 family members CG4357, CG12773, 337 CG5594, CG31547, and CG10413 during embryonic development (Figs. 2-6). We found that all 338 five members of this family are expressed during early embryogenesis (stages 1-6). Specific 339 expression of CG10413 during later stages of embryogenesis was not detected. Expression of the 340 remaining family members during late embryogenesis varied but was seen predominantly in the 341 ventral nerve cord, salivary gland, gut and anal pad. In parallel studies we carried out functional 342 assays on each of the five Drosophila homologues by measuring the uptake of 86Rb into 343 transiently transfected High Five cells. Rubidium is known to be able to substitute for potassium 344 on a number of vertebrate SLC12 transporters, but under our experimental conditions we found 345 that only one of the Drosophila SLC12 proteins, CG4357, exhibited significant 86Rb transport 346 activity (Fig. 7). 347 In confocal micrographs we found that CG4357 was expressed primarily in, or very close 348 to, the plasma membrane of the High Five cells (Fig. 8B). In additional experiments we found 349 that 86Rb transport via CG4357 was saturable with Km = 0.29+0.05 mM (Fig. 9B). 86Rb flux via 350 CG4357 was also sodium- and chloride-dependent. A plot of 86Rb uptake vs. sodium 351 concentration conformed well to the Michaelis-Menten equation with K1/2 = 53+11 mM (Fig. 352 10B) indicating a Na:Rb stoichiometry of 1:1 (17). In contrast, a plot of 86Rb flux via CG4357 vs. 353 chloride concentration was sigmoidal indicating the involvement of more than one chloride ion in 354 the Rb transport event (Fig. 11B). A fit of these data to the Hill equation yielded K1/2 = 48+5 mM 355 and n = 2.6+0.3 suggesting a Cl:Rb stoichiometry of > 2:1. 86Rb flux via CG4357 was also 17 356 inhibited by bumetanide (KI = 1.17+0.08 μM; Figs. 12 and 13), a potent and specific inhibitor of 357 vertebrate Na+-K+-2Cl- cotransporters. In previous studies from our laboratory carried out on rat 358 NKCC1 expressed in the human embryonic kidney cell line HEK-293 (1) we found Km = 1.85 359 mM+0.26 mM for rubidium, K1/2 = 60.8+4.0 mM for sodium, K1/2 = 48.1+4.7 mM with n = 360 2.47+0.45 for chloride, and K1/2 = 2.4+0.7 μM for bumetanide. Thus the kinetic parameters for 361 CG4357 and rat NKCC1 are quite similar, the most notable difference being the higher affinity of 362 CG4357 for rubidium. Taken together these results provide strong evidence that CG4357 is an 363 insect orthologue of the vertebrate Na+-K+-2Cl- cotransporters. 364 The functional properties of the remaining four Drosophila SLC12 proteins have yet to 365 be determined. We note, however, that the endogenous 86Rb transport system that we observe in 366 the High Five cells is saturable (Fig. 9A), sodium-independent (Fig. 10A), chloride-dependent 367 (Fig. 11A) and furosemide-dependent (Fig. 12A), and thus appears to be a K+-Cl- cotransporter. It 368 is possible that corresponding Drosophila protein (possibly CG5594 which lies closest to the 369 vertebrate KCCs phylogenetically – see Fig. 1) is inactive in the High Five cells under our 370 experimental conditions or that an SLC12 homologue is found in the High Five cells (derived 371 from the cabbage looper, Trichoplusia ni) that is not found in Drosophila. Further studies to 372 explore these questions were beyond the scope of the present paper. 373 Expression of CG4357, the one SLC12 family member for which transporter activity was 374 detected, was seen to change throughout Drosophila development, indicating dynamic temporal 375 regulation of this gene (Fig. 2). Upon organ formation, CG4357 expression was found 376 predominantly in the gut and nervous system, suggesting a role for this transporter in the ionic 377 homeostasis of these developing organ systems. Indeed, the gut, anal pads and malpighian 378 tubules are intimately involved in maintaining the proper ionic balance in insects, suggesting that 379 expression of transporters in these tissues may be crucial for both development and homeostasis. 380 Support for this is seen when examining the expression patterns of other members of the SLC12 381 family. Three additional family members (CG31547, CG12773 and CG5594) are also expressed 18 382 in the gut and two of these (CG31547 and CG5594) have very intense expression in the anal pad, 383 a structure present at the posterior end of the hindgut that is involved in regulating salt and water 384 balance. Multiple family members are also expressed in the developing nervous system. Taken 385 together, our data suggest that members of this transporter family are likely to be involved in the 386 ion transport and osmoregulation that occurs in the digestive system of the insect as well as in 387 nervous system function. Finally, the expression of multiple family members in the gut and 388 nervous system also suggests that there may be functional redundancy built into these organ 389 systems. The potential for functional redundancy within this family is supported by our genetic 390 experiments examining mutations in CG4357. Flies that are homozygous mutants for CG4357 391 were viable and fertile. While these data suggest that CG4357 is not required for viability, it 392 remains possible that subtle defects in ionic concentrations, digestion or nervous system function 393 may still be present. Interestingly, Filippov et al. (3) also found that disruption of another family 394 member, CG10413, did not produce an obvious phenotype or affect viability. Future studies will 395 be required to examine the effects of mutations in multiple co-expressed family members to 396 address the issue of redundancy. 397 19 398 REFERENCES 399 400 401 Reference List 1. Dehaye JP, Nagy A, Premkumar A and Turner RJ. Identification of a 402 functionally important conformation-sensitive region of the secretory Na+-K+-2Cl- 403 cotransporter (NKCC1). J Biol Chem 278: 11811-11817, 2003. 404 405 406 2. Delpire E and Mount DB. Human and murine phenotypes associated with defects in cation-chloride cotransport. Annu Rev Physiol 64: 803-843, 2002. 3. Filippov V, Aimanova K and Gill SS. Expression of an Aedes aegypti cation- 407 chloride cotransporter and its Drosophila homologues. Insect Mol Biol 12: 319-331, 408 2003. 409 410 4. Gamba G. Molecular physiology and pathophysiology of electroneutral cationchloride cotransporters. Physiol Rev 85: 423-493, 2005. 411 5. Gavrikov KE, Nilson JE, Dmitriev AV, Zucker CL and Mangel SC. Dendritic 412 compartmentalization of chloride cotransporters underlies directional responses of 413 starburst amacrine cells in retina. Proc Natl Acad Sci U S A 103: 18793-18798, 414 2006. 415 416 6. Hartenstein V.In: Atlas of Drosophila Development, New York: Cold Spring Harbour Laboratory Press, 1993, p. 2-52. 20 417 7. Isenring P, Jacoby SC, Payne JA and Forbush B, III. Comparison of Na-K-Cl 418 cotransporters. NKCC1, NKCC2, and the HEK cell Na- L-Cl cotransporter. J Biol 419 Chem 273: 11295-11301, 1998. 420 421 8. Kaneko H, Putzier I, Frings S, Kaupp UB and Gensch T. Chloride accumulation in mammalian olfactory sensory neurons. J Neurosci 24: 7931-7938, 2004. 422 9. Moore-Hoon ML and Turner RJ. The structural unit of the secretory Na+-K+- 423 2Cl- cotransporter (NKCC1) is a homodimer. Biochemistry 39: 3718-3724, 2000. 424 10. Nezu A, Parvin MN and Turner RJ. A conserved hydrophobic tetrad near the C 425 terminus of the secretory Na+-K+-2Cl- cotransporter (NKCC1) is required for its 426 correct intracellular processing. J Biol Chem 284: 6869-6876, 2009. 427 428 429 11. Page RD. TreeView: an application to display phylogenetic trees on personal computers. Comput Appl Biosci 12: 357-358, 1996. 12. Parvin MN, Gerelsaikhan T and Turner RJ. Regions in the cytosolic C-terminus 430 of the secretory Na(+)-K(+)-2Cl(-) cotransporter NKCC1 are required for its 431 homodimerization. Biochemistry 46: 9630-9637, 2007. 432 433 13. Russell JM. Sodium-potassium-chloride cotransport. Physiol Rev 80: 211-276, 2000. 21 434 14. Tautz D and Pfeifle C. A non-radioactive in situ hybridization method for the 435 localization of specific RNAs in Drosophila embryos reveals translational control of 436 the segmentation gene hunchback. Chromosoma 98: 81-85, 1989. 437 15. Thompson JD, Higgins DG and Gibson TJ. CLUSTAL W: improving the 438 sensitivity of progressive multiple sequence alignment through sequence weighting, 439 position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 440 4673-4680, 1994. 441 16. Tian E and Ten Hagen KG. Expression of the UDP-GalNAc: polypeptide N- 442 acetylgalactosaminyltransferase family is spatially and temporally regulated during 443 Drosophila development. Glycobiology 16: 83-95, 2006. 444 445 446 17. Turner RJ. Stoichiometry of coupled transport systems in vesicles. Methods Enzymol 191: 479-494, 1990. 18. Xu JC, Lytle C, Zhu TT, Payne JA, Benz E Jr and Forbush B, III. Molecular 447 cloning and functional expression of the bumetanide-sensitive Na-K-Cl 448 cotransporter. Proc Natl Acad Sci U S A 91: 2201-2205, 1994. 449 450 22 451 FIGURE LEGENDS 452 Fig. 1. Phylogenetic tree of representative members of the SLC12 family. Amino acid sequences 453 were aligned using the program AlignX (a component of the Vector NTI Advance package from 454 Invitrogen) which uses the Clustal W algorithm (15). The tree was displayed using the program 455 Treeview (11). Human sequences are shaded in gray and indicate the 4 main branches of the 456 vertebrate phylogenetic tree. Drosophila SLC12 family members are shown in bold. In addition 457 to the Drosophila proteins, the SLC12 amino acid sequences included are Crab (Callinectes 458 sapidus; AF190129), C el 1 (Caenorhabditis elegans; T22488), C el 2 (Caenorhabditis elegans; 459 NP_501141), C el 3 (Caenorhabditis elegans; H16O14), C el 4 (Caenorhabditis elegans; 460 NP_495469), C el 5 (Caenorhabditis elegans; P34261), C el 6 (Caenorhabditis elegans; 461 NP_495555), C el 7 (Caenorhabditis elegans; NP_493773), Cyanobacterium (Trichodesmium 462 erythraeum; ZP_00074455), CCC9 (human; AAO49174), CIP (human; AAK21008), KCC1 463 (human; NP_005063), KCC2 (human; NP_065759), KCC3 (human; AAF24986), KCC4 (human; 464 AAD39741), NCC (human; NP_000330), NKCC1 (human; NP_001037), NKCC2 (human; 465 AAB07364), Archaea (Methanosarcina acetivorans; NP_619366), Rice (Oryza sativa; 466 BAB20646), and Yeast (Saccharomyces cerevisiae; NP_009794). 467 Fig. 2. CG4357 gene expression during Drosophila embryogenesis by whole mount in situ 468 hybridization. Expression patterns using antisense riboprobes and sense riboprobes are shown. 469 Orientation of the embryo is anterior to the left, posterior to the right. Dorsal is up in lateral 470 images. amg, anterior midgut rudiment; fg, foregut; pmg, posterior midgut rudiment; vne, ventral 471 neurogenic region; vnc, ventral nerve cord. 472 Fig. 3. CG12773 gene expression during Drosophila embryogenesis by whole mount in situ 473 hybridization. Expression patterns using antisense riboprobes and sense riboprobes are shown. 474 Orientation of the embryo is anterior to the left, posterior to the right. Dorsal is up in lateral 475 images. amg, anterior midgut rudiment; pmg, posterior midgut rudiment; hg, hindgut; vne, ventral 476 neurogenic region; vnc, ventral nerve cord. 23 477 Fig. 4. CG5594 gene expression during Drosophila embryogenesis by whole mount in situ 478 hybridization. Expression patterns using antisense riboprobes and sense riboprobes are shown. 479 Orientation of the embryo is anterior to the left, posterior to the right. Dorsal is up in lateral 480 images. amg, anterior midgut rudiment; pmg, posterior midgut rudiment; hg, hindgut; ap, anal 481 pads; vnc, ventral nerve cord. 482 Fig. 5. CG31547 gene expression during Drosophila embryogenesis by whole mount in situ 483 hybridization. Expression patterns using antisense riboprobes and sense riboprobes are shown. 484 Orientation of the embryo is anterior to the left, posterior to the right. Dorsal is up in lateral 485 images. amg, anterior midgut rudiment; pmg, posterior midgut rudiment; hg, hindgut; ap, anal 486 pads; sg, salivary glands; vnc, ventral nerve cord. 487 Fig. 6. CG10413 gene expression during Drosophila embryogenesis by whole mount in situ 488 hybridization. Expression patterns using antisense riboprobes and sense riboprobes are shown. 489 Orientation of the embryo is anterior to the left, posterior to the right. Dorsal is up in lateral 490 images. 491 Fig. 7. Uptake of 86Rb into High Five cells transiently transfected with the Drosophila SLC12 492 proteins indicated. The Drosophila SLC12 proteins were cloned into the insect expression vector 493 pIB/V5-His and transfected into the High Five cells as described in Methods. All clones included 494 their native stop codons so that the C-terminal V5-His tag of the pIB/V5-His vector was not 495 appended to the proteins. 86Rb uptake was measured as described in Methods except that 20 µM 496 unlabeled RbCl was omitted from the uptake medium so that only tracer 86Rb was present. The 497 results of 3 independent experiments were averaged to produce the figure. In each experiment 498 fluxes were normalized to that observed in cells transfected with the empty vector pIB/V5-His 499 (empty). 500 Fig. 8. Expression, location and function of CG4357 and V5-tagged CG4357 in the cultured 501 insect cell line High Five. A. Western blots of membranes prepared from High Five cells 502 transiently transfected with the empty vector pIB/V5-His (empty), CG4357, or V5-tagged 24 503 CG4357, as indicated. The left-hand-panel was probed with the anti-CG4357 antibody and the 504 right-hand-panel with anti-V5 antibody (see Methods for details). B. Confocal images of High 505 Five cells transiently transfected with the empty vector pIB/V5-His (panel a), pIB/V5-His-CAT 506 (panel b), CG4357 (panel c), and V5-tagged CG4357 (panel d). All cells were prepared as 507 described in Methods and simultaneously probed with both anti-V5 (green) and anti-CG4357 508 (red) antibodies. C. 86Rb fluxes measured in High Five cells transiently transfected with the same 509 plasmids used in panel B. Fluxes, measured as described in Methods, have been normalized to 510 that observed in cells transfected with the empty vector pIB/V5-His. The results of 3 independent 511 experiments were averaged to produce the figure. 512 Fig. 9. Rubidium concentration dependence of 86Rb fluxes via the endogenous High Five cell 513 transport system and via CG4357. 86Rb fluxes were measured as a function of rubidium 514 concentration in High Five cells transiently transfected with the empty vector pIB/V5-His (panel 515 A) or with CG4357 (panel B) as indicated. Other experimental details are as described in 516 Methods. Each data point represents the average + S.E. for 3 or more independent determinations. 517 Fluxes in panel B have been corrected for 86Rb transport via the endogenous High Five system 518 (panel A) by subtracting uptakes measured in cells transfected with empty vector from those 519 measured in cells transfected with CG4357 for each experimental condition (measurements were 520 carried out on the same cell passage on the same day). Fluxes were fit to the Michaelis-Menton 521 equation via non-linear least squares regression. The fit to the data in panel A yielded Km = 522 2.56+0.15 mM with r = 0.999 while that to the data in panel B yielded Km = 0.29+0.05 mM with r 523 = 0.990. The lines drawn through the data points correspond to these theoretical fits. 524 Fig. 10. Sodium concentration dependence of 86Rb fluxes via the endogenous High Five cell 525 transport system and via CG4357. 86Rb fluxes were measured as a function of sodium 526 concentration in High Five cells transiently transfected with the empty vector pIB/V5-His (panel 527 A) or with CG4357 (panel B) as indicated. In these experiments Na-HEPES (pH 7.3) was 528 replaced with N-methyl-D-glucamine-HEPES (pH 7.3) in all media. To obtain an uptake medium 25 529 containing 100 mM NaCl, 100 mM sucrose was replaced with an additional 50 mM NaCl (see 530 Methods for composition of uptake medium). The ionic strength of the uptake medium was then 531 held constant by replacing sodium with N-methyl-D-glucamine to obtain the various sodium 532 concentrations indicated. Other experimental details are as described in Methods. The fluxes in 533 panel B have been corrected for 86Rb transport via the endogenous High Five system (panel A) as 534 described in the caption to Fig. 9. The results of 3 independent experiments were averaged to 535 produce the figures. In each experiment fluxes were normalized to those observed at 100 mM 536 NaCl. The dashed line in panel A indicates a relative flux of 1.0 (i.e., no dependence on sodium 537 concentration). The data in panel B were fit to the Michaelis-Menton equation via non-linear least 538 squares regression yielding K1/2 = 53+11 mM with r = 0.998. The line drawn through the data in 539 panel B corresponds to this theoretical fit. 540 Fig. 11. Chloride concentration dependence of 86Rb fluxes via the endogenous High Five cell 541 transport system and via CG4357. 86Rb fluxes were measured as a function of chloride 542 concentration in High Five cells transiently transfected with the empty vector pIB/V5-His (panel 543 A) or with CG4357 (panel B) as indicated. To obtain the chloride concentrations indicated while 544 keeping the ionic strength of the uptake medium (normally 80 mM chloride; see Methods) 545 constant, chloride was replaced with gluconate. Other experimental details are as described in 546 Methods. The fluxes in panel B have been corrected for 86Rb transport via the endogenous High 547 Five system (panel A) as described in the caption to Fig. 9. In each data set fluxes were 548 normalized to those observed at 80 mM chloride. The results of 3 independent experiments were 549 averaged to produce the figures. The data in panel A were fit to the Michaelis-Menton equation 550 via non-linear least squares regression yielding K1/2 = 80+13 mM with r = 0.998. The data in 551 panel B were fit to the Hill equation yielding K1/2 = 48+5 mM and n = 2.6+0.3 with r = 0.998. 552 The lines drawn through the data points correspond to these theoretical fits. 553 Fig. 12. Effects of SLC12 inhibitors on 86Rb fluxes via the endogenous High Five cell transport 554 system and via CG4357. 86Rb fluxes were measured in the presence of bumetanide (white bars), 26 555 furosemide (dark gray bars) or metolazone (light gray bars), at the concentrations indicated, in 556 High Five cells transiently transfected with the empty vector pIB/V5-His (panel A) or with 557 CG4357 (panel B). Fluxes have been normalized to that observed in the absence of inhibitors 558 (black bars). Cells were incubated with the inhibitors in preincubation medium for 10 min before 559 the flux measurements; other experimental details are as described in Methods. The fluxes in 560 panel B have been corrected for 86Rb transport via the endogenous High Five system (panel A) as 561 described in the caption to Fig. 9. Each data point represents the average + S.E. for 3 independent 562 determinations. 563 Fig. 13. CG4357 bumetanide dose response. 86Rb fluxes were measured in High Five cells 564 transiently transfected with CG4357 in the presence of bumetanide at the concentrations indicated. 565 Experimental details are as in the caption of Fig. 12. Fluxes were corrected for 86Rb transport via 566 the endogenous High Five system as described in the caption to Fig. 9 and then normalized to that 567 observed in the absence of bumetanide. The data were fit to a model that assumes a single 568 inhibitory site for bumetanide. This fit yields KI = 1.17+0.08 μM for bumetanide with r = 0.995. 569 The line drawn through the data points corresponds to this theoretical fit. 570 Fig. 14. CG4357 gene expression in Drosophila lines containing mutations in CG4357. 571 Quantitative PCR analysis of CG4357 gene expression was performed using the primer pairs 572 described in Materials and Methods. CG4357 gene expression levels were determined for wild 573 type flies (WT), flies heterozygous for the transposon insertion mutation 574 (P{wHy}Ncc69DG04311/+), flies heterozygous for the chromosomal deletion encompassing 575 CG4357 (Df(3L)/+) and flies that were homozygous mutants for CG4357, containing both the 576 transposon insertion and the chromosomal deletion (P{wHy}Ncc69DG04311/Df(3L)). RNA levels 577 were normalized to 18S rRNA. Values shown are the average of one experiment performed in 578 triplicate + standard deviation. 579 27 580 ACKNOWLEDGEMENTS 581 We thank Drs. William D. Swaim, Marilyn Moore-Hoon and Most. Nahid Parvin for advice and 582 help with the confocal and flux studies. This research was supported by the Intramural Research 583 Program of the National Institute of Dental and Craniofacial Research, National Institutes of 584 Health, Bethesda MD.