Download model 3 - Instructure

Bio200 F2013– Translation
MODEL 3:
= "codon"
= "anticodon"
Critical Thinking Questions
1. Label as many components of the cartoon as you can.
2. Label the 5' and 3' sides of each codon and anticodon.
3. a. How many nucleotides are there in a codon? __________ in an anticodon? __________
b. Do codons overlap? __________
c. Which molecule contains codons? ___________ Which contains anticodons? __________
d. How many amino acids does each tRNA carry? ______
4. a. Define the term "codon" in one grammatically correct sentence:
b. Define the term "anticodon" in one grammatically correct sentence:
5. Translation ALWAYS begins with a tRNA carrying the amino acid Met.
a. What is the sequence of the "Start Codon"? Label with 5' and 3'.
_________________
b. In which direction must the ribosome move ("translocate") along the mRNA? _________
(From 5' to 3' or from 3' to 5'?)
Exercise developed by A. Schivell (UW Biology) 1
Bio200 F2013– Translation
Crowe
MODEL 4:
Initiation of translation (from Freeman, 4e)
6. a. Circle the ribosome binding site (RBS) in the mRNA.
b. Is the RBS closer to the 5' or 3' end of the mRNA? _____
b. Which are more prevalent in the RBS, pyrimidines or purines? __________________
c. What types of bonds hold the mRNA and small ribosomal subunit together? __________
7. a. Does the first tRNA bind before or after the ribosome is complete? _____________
b. What is the name of the sequence that the first tRNA binds to? ______________
8. a. How many nucleotides are there between...
... the RBS and the start codon? _______
... the 5' end of the mRNA's and the start codon? ______
b. Are either of your answers in "a" multiples of 3? _______
c. What must establish the "frame" of triplet codons for translation? ___________________
9. In the mRNA sequence below, circle and label the RBS and the start codon.
5' UCUUAAGAAGGAUCUGUAAUGUCUGUAUGUCUGUAGUGUAUGUCUUGUAUCG 3'
Exercise developed by A. Schivell (UW Biology) 2
Bio200 F2013– Translation
Crowe
MODEL 5:
The reaction catalyzed by the
ribosome is shown to the right.
10. Label an arrow pointing to...
... an "Amino-acyl tRNA"
... the "Peptidyl tRNA"
... the "Empty tRNA"
11. Use the letters E, P, and A
(as they correspond to the
tRNAs in question 10) to label
the three tRNA binding sites in
Model 3.
12. The drawing to the right
shows a short protein of 8 amino
acids that is complete, but is still
in the ribosome.
a. Label the amino terminus and
the soon-to-be-carboxyl terminus
of the protein.
b. Draw a square around a peptide bond.
Exercise developed by A. Schivell (UW Biology) 3
amino acid
tRNA with the
nucleotide at one end
shown much larger
than the rest of the
molecule
Bio200 F2013– Translation
Crowe
MODEL 6:
Termination of translation (from Freeman, 4e)
"release
factor"
13. List two things that are different between the release factor and a tRNA:
________________________
________________________
14. List two things that happen after release factor binds to the ribosome:
i. _____________________________________________________________________
ii. _____________________________________________________________________
15. What is the sequence of the codon that indicates the end of this protein? ___________
(This is called a "stop codon".)
16. Is release factor an enzyme? _____ What is your reasoning for your answer?
17. Should there be tRNAs in the cell that can base pair with a stop codon? Why or why not?
Exercise developed by A. Schivell (UW Biology) 4
Bio200 F2013– Translation
Crowe
On your own:
1. This is the sequence of a complete mRNA from a bacterial cell:
5' UCAAGGAGGCGUUAGCAUGAAAUUUAUGGGGCGGGUAUAGCUAGCAUUUCAAG 3'
a. Write the protein sequence that is translated from this mRNA on the line below, and label
the amino (N) and carboxyl (C) termini of the protein.
b. How many tRNAs will bind to the ribosome to make this protein? _________
c. Which of the following sequences within the mRNA most likely contains the ribosome
binding site? (Circle ONE)
5'UAGCUAGCA3'
5'UUAAUGG3'
5'AAGGAGGC3'
2. For each different mutant cell
described below, assume that ONE
specific molecule or part of a molecule
is mutated in that cell so that the
molecule’s function has changed.
Name as many molecules that could
result in the description (but remember
that for the mutant phenotype, you are
considering each mutation by itself).
Cell 1: In many different types of
proteins, there is the amino
acid Thr (threonine) where an
Ala (alanine) should be.
________________________
Cell 2: Many different types of
proteins are much shorter than
in a normal cell, but have the correct sequence up to that
point. tRNA levels are normal in the cell.
________________________
AT THE END OF THIS ACTIVITY YOU
SHOULD UNDERSTAND...
... how the process of translation works
Terms you should be able to define:
- ribosome (including rRNA, small subunit,
large subunit)
- mRNA
- tRNA
- E, P, and A sites within the ribosome
- ribosome binding site
- codon/anti-codon
Exercise developed by A. Schivell (UW Biology) 5
- start codon/stop codon
- release factor
- translocation (of the ribosome with respect
to the mRNA)
- amino-acyl tRNA synthetase