Download Nuclear mitotic apparatus protein (NuMA): spindle association

1389
Journal of Cell Science 107, 1389-1402 (1994)
Printed in Great Britain © The Company of Biologists Limited 1994
Nuclear mitotic apparatus protein (NuMA): spindle association, nuclear
targeting and differential subcellular localization of various NuMA isoforms
Tang K. Tang*, Chieh-ju C. Tang, Yu-Jane Chao and Cheng-Wen Wu
Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan 115, Republic of China
*Author for correspondence
SUMMARY
We have recently shown that the nuclear mitotic apparatus
protein (NuMA) is composed of at least three isoforms that
differ mainly at the carboxy terminus, and are generated
by alternative splicing of a common mRNA precursor from
a single NuMA gene (J. Cell Sci. (1993) 104, 249-260).
Transient expression of human NuMA-l isoform
(T33/p230) in Chinese hamster ovary polyoma (CHOP)
cells showed that NuMA-l was present in interphase nuclei
and was concentrated at the polar regions of the spindle
apparatus in mitotic cells. However, expression of two
other isoforms (NuMA-m and -s) revealed a distinct subcellular localization. NuMA-m (U4/p195) and NuMA-s
(U6/p194) were present in the interphase cytosol and
appeared to be mainly located at the centrosomal region.
When cells entered into mitosis, however, NuMA-m and -s
moved to the mitotic spindle pole. Analysis of a series of
linker scanning-mutants and NuMA/β-galactosidase
chimeric proteins showed that residues 1972-2007 of
NuMA-l constitute a novel nuclear localization signal
(NLS) and residues 1538-2115 are necessary and sufficient
for spindle association. Further analysis of the NLS by sitespecific mutagenesis indicated that Lys1988 is essential for
nuclear targeting, whereas Arg1984 is not. These results
have allowed us tentatively to assign specific biological
activities to distinct structural domains of the NuMA
polypeptide.
INTRODUCTION
lamins, intermediate filaments and other coiled-coil proteins.
This observation suggests that NuMA belongs to the large
coiled-coil protein family.
On the basis of microinjection and cell-cycle-dependent
localization experiments, several laboratories have proposed
that NuMA may play a role in maintaining or establishing
nuclear structure, possibly as a structural component of the
nuclear matrix (Lyderson and Pettijohn, 1980; Price and
Pettijohn, 1986; Kallajoki et al., 1991; Compton et al., 1992;
Yang and Snyder, 1992). Recently, Compton and Cleveland
(1993) have shown that expression of human NuMA lacking
its globular head or tail domains may induce cells to become
micronucleated. Moreover, expression of wild-type human
NuMA in tsBN2 cells, in which the endogenous NuMA protein
is normally degraded, resulting in micronuclei at a restrictive
temperature, was sufficient to suppress the micronucleation
phenotype. These results lead them to suggest that NuMA is
required for the proper terminal phases of chromosome separation and/or nuclear reassembly during mitosis. In addition,
microinjection of anti-NuMA antibodies into early mitotic or
metaphase cells prevents the formation or causes the collapse
of the mitotic spindle apparatus (Yang and Snyder, 1992), suggesting that NuMA may play an important role during mitosis.
We have recently isolated a series of overlapping cDNA
clones that cover the entire coding region of NuMA (Tang et
al., 1993b). Analysis of various cDNA clones revealed that
The nuclear mitotic apparatus protein (NuMA) was first
described by Lyderson and Pettijohn (1980) as a predominantly
nuclear protein that is present in the interphase nucleus and is
concentrated in the spindle pole of mitotic cells. Recently,
several nuclear proteins with an immunofluorescence staining
pattern similar to that of NuMA have been defined. These
proteins, including centrophilin (Tousson et al., 1991), SPN
(Kallajoki et al., 1991), SP-H (Maekawa et al., 1991), 1H1/1F1
(Compton et al., 1991) and W1 (Tang et al., 1993b), have been
defined by various monoclonal antibodies or autoimmune sera.
According to the amino acid or nucleotide sequences obtained,
NuMA (Compton et al., 1992; Yang et al., 1992), SPN
(Kallajoki et al., 1993), SP-H (Maekawa and Kuriyama, 1993),
1H1/1F1 (Compton et al., 1992) and W1 (Tang et al., 1993b)
represent different names for the same protein.
Recently, cDNA clones that cover the entire coding region
of human NuMA have been isolated and sequenced (Compton
et al., 1992; Yang et al., 1992; Tang et al., 1993b; Maekawa
and Kuriyama, 1993). Secondary structure predictions reveal
that NuMA is composed of a long α-helical central core
flanked by two globular domains (Compton et al., 1992; Yang
et al., 1992; Tang et al., 1993b; Maekewa and Kuriyama,
1993). Interestingly, the central α-helical region of NuMA
shares a high degree of sequence similarity with myosin,
Key words: nuclear protein, NuMA, centrosome, spindle pole,
nuclear localization signal
1390 T. K. Tang and others
their sequences were identical, except for six sequence blocks
(75 bp, 42 bp, 45 bp, 576 bp, 1012 bp and 212 bp), which were
either inserted or deleted in individual cDNA clones. Among
these, two sequence blocks (75 bp and 42 bp), which encode
a 25 and a 14 amino acid peptide, respectively, are located at
the middle portion of the NuMA cDNA. In contrast, the other
four blocks (45 bp, 576 bp, 1012 bp, 212 bp), some of which
carry a translation termination codon, are located at the 3′ end
of the NuMA transcript (Tang et al., 1993b).
Interestingly, combinatorial splicing of four sequence blocks
located at the 3′ end of the transcript may generate at least three
different NuMA isoforms that differ at their carboxy termini.
These isoforms are generated from a single RNA precursor by
alternative splicing (Tang et al., 1993b). The T33 form of
NuMA mRNA codes for 2115 amino acids, corresponding to
the longest polypeptide of ~230 kDa (p230). Two other NuMA
isoforms, which use different translation termination codons
located in different 3′ sequence blocks, would produce
polypeptides of lower molecular masses. The U4 form of the
mRNA would code for 1776 amino acids, corresponding to
p195, and the U6 form would code for 1763 amino acids, corresponding to p194. For convenience in describing these
different isoforms, the T33/p230 form is now renamed NuMAl (large), the U4/p195 form NuMA-m (medium), and the
U6/p194 form NuMA-s (small). All the isoforms described
here contain both the 75 and 42 bp sequence blocks (Tang et
al., 1993b) that encode 25 and a 14 amino acid (aa) peptides,
respectively. For the isoform that lacks the 14 amino acid
peptide, the name of NuMA-x (-14 aa) may be used, where x
represents large (l), medium (m), or small (s). According to
this principle, the NuMA-x (-14 aa) represents an isoform that
lacks the 14 amino acid peptide, and so on.
To find out whether any particular isoform shows a subcellular localization identical to that reported for the original
NuMA, we have now expressed these three different isoforms
of NuMA in cultured cells. Expression of the largest isoform
(NuMA-l) showed a cell-cycle-dependent distribution indistinguishable from that of the original NuMA in human cells,
i.e. present throughout the interphase nuclei but concentrated
at the spindle poles during mitosis. To our surprise, expression
of NuMA-m and -s revealed a distinct subcellular localization.
NuMA-m and -s were distributed in the cytoplasm of transfected cells and appeared to be present mainly at the centrosomal region. In this study, we have also mapped both the
nuclear localization signal (NLS) and the spindle association
domain of human NuMA-l protein. A model for both the structural and functional domains of human NuMA-l is presented.
MATERIALS AND METHODS
Cell culture
The Chinese hamster ovary cell line that expresses polyoma large T
antigen (CHOP) was kindly provided by Dr James W. Dennis,
Toronto, Canada. CHOP cells were propagated and maintained in
αMEM containing 10% fetal calf serum (FCS) and 200 µg/ml of
G418 (Gibco) as described previously (Heffernan and Dennis, 1991).
Construction of deletion and chimeric expression
plasmids
Full-length human NuMA cDNAs were assembled and constructed
from overlapping cDNA fragments (Tang et al., 1993b) by standard
cloning methods (Ausubel et al., 1989; Sambrook et al., 1989). The
3′ end DNA fragments of NuMA-l, -m and -s were derived from T33,
U4 and U6 cDNA clones, respectively (Tang et al., 1993b). The
EcoRI fragments containing the entire coding sequence for NuMA-l,
-m or -s were then inserted into the unique EcoRI site of a eukaryotic
expression vector, pSG5 (Strategene), which contains an SV40 early
promoter, intron II of the rabbit β-globin gene, and the SV40
polyadenylation signal. These constructs were renamed SV/NuMA-l,
-m and -s, respectively (see Fig. 1A). All cDNA constructs contained
both the 75 bp and 42 bp sequence blocks (Tang et al., 1993b) in their
coding sequences. A series of truncated linker scaning mutants (see
Fig. 6A) were generated by partial digestion of SV/NuMA-l cDNA
with NarI (L1), XhoI (L12) or StyI (L24, L36, L42), filling the 3′
recessed termini with the Klenow fragment of Escherichia coli DNA
polymerase I in the presence of the appropriate dNTPs and ligated
with a phosphorylated XbaI linker (Stratagene). The linker is a short
oligonucleotide (CTAGTCTAGACTAG) that contains an XbaI
restriction site and stop codons in all three reading frames. This construction allowed us to generate a series of truncated mutants.
For generation of NuMA/β-galactosidase expression plasmids,
various lengths of NuMA-l DNA fragments were PCR-amplified from
the tail region of NuMA-l cDNA by several primer sets. The primers
selected for generation of a series of pc NuMA/β-galactosidase constructs (see Figs 7 and 9) were as follows: pc11 (4611-4629/64976517), pc6 (4611-4629/5906-5925), pc18 (5514-5533/6268-6287),
pc20 (5913-5932/6268-6287), pc21 (5913-5932/6160-6179), pc23
(6087-6106/6160-6179), pc24 (5913-5932/6004-6023), pc25 (60036022/6085-6104), pc30 (5940-5960/5964-5983) and pc31 (59405960/6004-6023). The numbers in parenthesis indicate the nucleotide
positions of NuMA according to the numbering system of Yang et al.
(1992). The PCR amplified fragments were first subcloned into the
PCR II vector (Invitrogen) for the convenience of direct cloning and
restriction site exchange. The PCR-amplified products in PCR II were
then released by EcoRI digestion followed by ligation into the unique
EcoRI site located downstream of the carboxy terminus of the lacZ
gene in pCH110 vector. Because the primers for PCR amplification
of NuMA-l cDNA were specifically selected, the final PCR amplified
products would be cloned in-frame with the lacZ gene. For generation of the pc7 construct, which encodes a short polypeptide (seven
amino acids) of NuMA-l, two oligonucleotides (N3: 5′-GCGAATTCCAGCAGCGCAAACGGGTCTCCGAATTCCA-3′; and N4:
5′-CGCTTAAGGTCGTCGCGTTTGCCCAGAGGCTTAAGGT-3′),
which each carried an EcoRI recognition site at each end and were
complementary to each other, were synthesized. Equal amounts of
complementary oligonucleotides were then annealed, followed by
EcoRI digestion. The EcoRI-released fragment was then subcloned
into the unique EcoRI site of the lacZ gene in the pCH110 vector. For
construction of site-directed mutagenesis vectors, pc24 was selected
as a construction backbone for generation of both pc24N1 and
pc24N2 mutant constructs. The primers selected for generation of
these vectors were as follows: pc24N1 (5′-CATCACCACCGGGCAGCAGCG-3′); pc24N2 (GCAGCAGCGCGAACGGGTCTC).
The site-directed mutagenesis clones were generated by using the
altered sites in the in vitro mutagenesis system as described by the
manufacturer (Promega). The same mutagenesis primer as described
for pc24N1 was used to produce two other constructs, pc30 and pc31,
which carry a single amino acid substitution at residue 1984 of
NuMA-l. The cDNA sequences in all the constructed mutants were
confirmed by DNA sequencing.
Cell transfection and immunochemical analysis
CHOP cells growing on glass coverslips were transiently transfected
using Lipofectin (Gibco-BRL) reagent as described by the manufacturer. (Lipofectin reagent is a 1:1 (w/w) liposome formulation of the
cationic lipid N-[1-(2,3-dioleoyloxy)-propyl]-N,N,N-trimethylammonium chloride (DOTMA), and dioleoyl phosphatidylethanolamine
(DOPE).) Briefly, 2 µg of plasmid DNA diluted in serum-free medium
Nuclear mitotic apparatus protein 1391
was mixed with 7 µl of Lipofectin reagent and incubated at room temperature for 10-15 minutes. The solution containing Lipofectin reagentDNA complexes was layered over cells at 60% confluency and
incubated for 6 hours at 37°C. The cells were then washed with PBS
(phosphate buffered saline), and grown in complete medium containing 10% FCS for 18-20 hours. The transfected cells were then fixed in
methanol/acetone (1:1, v/v) at −20°C for 5 minutes. Monoclonal
antibody W1 (Tang et al., 1993b) was applied to the cells and incubated
for 60 minutes at 37°C in a humidified chamber. Coverslips were
washed in PBST (PBS containing 0.1% Tween-20) and the bound antibodies were detected with fluorescein-conjugated rabbit anti-mouse
antibodies (Cappel Laboratories). DNA was detected with propidium
iodide (2.7 µg/ml; Sigma Chemical Co.). For double-labeling experiments, transfected cells were fixed and stained with mAb W1 and antitubulin antibody as described (Tang et al., 1993b). Coverslips were
mounted and observed with a laser scanning confocal microscope
(MRC600 model; Bio-Rad Laboratories; for all immunofluorescence
photos described in this paper, except Fig. 8A) or with a Zeiss Axiophot
microscope equipped with epifluorescence (for Fig. 8A only).
For immunoblot analysis, CHOP cells were transfected with Transfectam reagent (Promega), since the transfection efficiency for Transfectam in CHOP cells was much higher than that observed for Lipofectin. Transfection efficiency was determined by analysis of 500
CHOP cells that had been transfected with SV/NuMA-l cDNA and
detected by mAb W1. In general, 10-20% of the inoculated CHOP
cells were positively stained by mAb W1 when the Transfectam
reagent was used, whereas only 2-5% positive cells were observed
using the Lipofectin reagent. However, CHOP cells transfected with
the Transfectam reagent were not suitable for immunofluorescence
analysis, because the precipitated DNA on the coverslip increased the
background staining when we counterstained the nuclear DNA with
propidium iodide.
For immunoblot experiments, 1×106 cells were plated onto 100 mm
Petri dishes. After overnight culture, the medium was aspirated and
the solution containing transfectam reagent-DNA complex was
overlayed on the cells as described by the manufacturer. After 24
hours of exposure, the cells were trypsinzied, washed with PBS and
then lysed in 60 µl EBC buffer (Tang et al., 1993b). The cell lysates
Fig. 1. (A) Schematic representation of various NuMA polypeptides derived from SV/NuMA expression vectors. The numbering system refers
to amino acid residues on various NuMA isoforms. The carboxy-terminal 391, 52 and 39 residues are distinct for the NuMA-l, NuMA-m and
NuMA-s proteins, respectively. The full-length human NuMA cDNAs that span the entire coding region for NuMA-l, -m and -s were
subcloned into a pSG5 expression vector (see Materials and Methods for details). All cDNA constructs contain both the 75 bp and 42 bp
sequence blocks, which encode 25 and 14 amino acids (aa), respectively (black boxes). (B) Immunoblot analysis of various SV/NuMA
isoforms after transient transfection of CHOP cells. Lane 1, SV/NuMA-s transfected CHOP cells; lane 2, SV/NuMA-m; lane 3, SV/NuMA-l;
lane 4, mock-transfected CHOP cells. The low intensity band of ~194 kDa protein shown in lane 1 reflects the fact that the transfection
efficiency of SV/NuMA-s is ten times lower than that of SV/NuMA-m or SV/NuMA-l due to an unknown reason. (C) Subcellular localization
of human NuMA-l at various cell cycle stages of transfected CHOP cells. CHOP cells were transfected with SV/NuMA-I, fixed, and processed
for immunofluorescence with mAb W1 (a, b, c, d) and a DNA-specific dye, propidium iodide (a′, b′, c′, d′). Interphase (a, a′); metaphase (b, b′);
anaphase (c, c′); telophase (d, d′). Bar, 25 µm.
1392 T. K. Tang and others
were then clarified by centrifugation at 12,000 g for 15 minutes at
4°C. Cell lysates (30 µl) were then mixed with 5× SDS sample buffer
and analyzed by 7.5% SDS-PAGE. After electrophoresis, the proteins
were transferred to polyvinylidene difluoride (PVDF) membrane and
incubated with mAb W1 (Tang et al., 1993b). The immunoreactive
polypeptides were detected with the Western Exposure Chemiluminescent Detection System as described by the manufacturer
(Clontech). Briefly, the immunoreactive polypeptides were detected
by the addition of goat anti-mouse IgG-alkaline phosphatase
conjugate followed by incubation with chemiluminescent substrate
solution for 5 minutes at room temperature. The membranes were then
drained and placed in contact with X-ray film to expose the film.
RESULTS
Expression of SV/NuMA-l reveals a subcellular
localization pattern that is indistinguishable from
that of endogeneous NuMA in human cells
To define the subcellular localization of various NuMA
isoforms, we have developed a transient expression system.
Three plasmids (SV/NuMA-l, -m and -s) that carry the entire
coding sequences of human NuMA-l, -m and -s cDNAs,
respectively, were constructed and placed under the control of
the SV40 early promoter (Fig. 1A). Each plasmid was introduced via transient transfection into CHOP cells, which were
then subjected to immunoblotting and confocal fluorescence
microscopic analyses. The basis for detecting the expressed
product corresponding to each of the constructs is a monoclonal antibody (mAb W1) originally derived from mice
immunized with the nuclear residue from small cells of the
bovine esophageal epithelial (BEE) basal layer (Tang et al.,
1993a,b, 1994). This monoclonal antibody recognizes a
specific epitope of NuMA from human, bovine and murine
cells (Tang et al., 1993b), but fails to recognize NuMA proteins
of hamster (CHOP) cells on the basis of both immunoblot (Fig.
1B, lane 4) and immunofluorescence analyses (compare Fig.
1C-a with 1C-a′).
Fig. 1B shows that transfected human NuMA-l in CHOP
Fig. 2. Subcellular localization of human NuMA-m at various cell cycle stages of transfected CHOP cells. The SV/NuMA-m transfected cells
were double-stained with mAb W1 (left, green) and propidium iodide (center, red). The composite photographs are shown on the right. (a-c)
Interphase; (d-f) metaphase; (g-i) telophase. Bar, 25 µm.
Fig. 3. Subcellular
localization of
human NuMA-s at
various cell cycle
stages of transfected
CHOP cells. CHOP
cells were
transfected with
SV/NuMA-s. Cells
were fixed and
processed for
immunofluorescence
with mAb W1 (left,
green) and
propidium iodide
(center, red). The
composite
photographs of mAb
W1 and propidium
iodide are shown on
the right.
(a-c) Interphase;
(d-f) metaphase;
(g-i) telophase. Bar,
25 µm.
Nuclear mitotic apparatus protein 1393
Fig. 4. Phenotype of transfected CHOP cells that expressed various amounts of NuMA-s.
CHOP cells were transfected with SV/NuMA-s and double-labeled with mAb W1 (left,
green) and anti-tubulin antibody (center, red). The composite photographs of mAb W1 and
anti-tubulin antibody are shown on the right. (a-c) Low-level expression of NuMA-s; (d-f)
medium-level expression; (g-i) high-level expression. Bar, 10 µm.
1394 T. K. Tang and others
Nuclear mitotic apparatus protein 1395
cells (lane 3) produced a protein with Mr ~230,000 (p230),
which migrated according to the predicted size of the endogeneous human NuMA (~230,000). The band observed in Fig.
1B (lane 3) with a molecular mass lower than p230 was
probably due to degradation; this band was not detected in
extracts derived from mock-transfected CHOP cells (lane 4).
Similarly, the predicted polypeptides corresponding to p194
and p195 were also observed when CHOP cells were transfected with SV/NuMA-s (lane 1) or SV/NuMA-m (lane 2),
respectively.
The subcellular localization of human NuMA isoforms
expressed in CHOP cells was further analyzed by fluorescence
confocal microscopy using mAb W1. For cells at interphase,
NuMA-l, like NuMA in human U251 cells (Tang et al., 1993b),
accumulated in the nucleus of transfected CHOP cells but was
excluded from the nucleoli (Fig. 1C-a). Note that several
untransfected CHOP cells seen by staining with a DNAspecific dye (propidium iodide) (Fig. 1C-a′) did not react with
mAb W1 (Fig. 1C-a). When cells entered metaphase, NuMAl concentrated in the polar regions of the spindle apparatus,
forming a characteristic crescent shape (Fig. 1C-b). From
metaphase to anaphase (Fig. 1C-c), the crescent staining of
human NuMA-l diminished gradually but still remained at the
spindle poles. Finally, in telophase cells, the human NuMA-l
protein associated with the re-forming nucleus and was subsequently redistributed throughout the nucleus again (Fig. 1C-d).
Similar results have been observed by Compton and Cleveland
(1993). Taken together, the cell-cycle-dependent distribution
of human NuMA-l in transfected CHOP cells is indistinguishable from that in human cells.
NuMA-m and NuMA-s are present in the interphase
cytosol, mainly clustered at the centrosomal region
and move into the polar regions of the mitotic
apparatus
When we transfected SV/NuMA-m and SV/NuMA-s into
CHOP cells, a quite distinct subcellular localization was
observed in interphase cells. In contrast to NuMA-l, which was
concentrated exclusively in the interphase nuclei, NuMA-m
and NuMA-s were unevenly distributed in the cytosol. In the
positive-staining interphase cells, NuMA-m and NuMA-s were
present in the cytoplasm, but were prominently labeled as a
small round dot (Fig. 2a, NuMA-m; Fig. 3a, NuMA-s). These
dots were most frequently seen in the perinuclear region, and
sometimes they were observed above or below the nucleus
(data not shown).
When the cells entered metaphase, both NuMA-m (Fig. 2d)
and NuMA-s (Fig. 3d) concentrated in the polar regions of the
spindle apparatus, a staining pattern similar to that observed
for NuMA-l (Fig. 1C-b). However, unlike the prominent
crescent staining observed for NuMA-l, staining in the shape
of a round dot was commonly found in NuMA-m and NuMAs transfected cells. These results are illustrated in Fig. 2d-f
(NuMA-m) and Fig. 3d-f (NuMA-s), which represent double
fluorescence analyses using mAb W1 (Figs 2d, 3d) and the
DNA-specific dye, propidium iodide (Figs 2e, 3e). Composite,
double-colored micrographs are shown in Figs 2f and 3f. As
the cells progress through metaphase to telophase, the
separated daughter chromosomes arrive at the poles and each
group of chromosomes starts to form two daughter interphase
nuclei. The prominent labeling of the small round dot remained
Fig. 5. Low-level expression of human NuMA-m in transiently
transfected CHOP cells. CHOP cells were transfected with
SV/NuMA-m and double-labeled with mAb W1 (A) and anti-tubulin
antibody (B). The composite photograph is shown in (C). Bar, 25
µm.
in the perinuclear position; the most likely interpretation of
these observations is therefore that the labeled dot-like structures correspond to the centrosomal region.
1396 T. K. Tang and others
The phenomenon of NuMA-s association with the centrosomal region is best illustrated by a comparison of a series of
photographs that represent a simultaneous analysis of the
staining patterns of transfected CHOP cells that expressed
various amounts of NuMA-s, after staining with mAbW1 (Fig.
4, left) and anti-tubulin antibody (Fig. 4, center). Fig. 4a shows
that in transfected cells that express low levels of NuMA-s
many dot-like structures appear to be concentrated at the interphase centrosome (microtubule organization center) (Fig. 4ac). However, in medium-level expression cells, the dot-like
staining gradually aggregated and finally clustered at the region
around the centrosome (Fig. 4d-f). Interestingly, in high-level
expression cells, NuMA-s appears to be assembled into a large
sheetlike aggregate within the cells (Fig. 4g). The large blurred
staining pattern detected by anti-tubulin antibody (4e and 4h)
that was superimposed upon the staining of mAb W1 (4d and
4g) could be a cross-reactive signal caused by overproduction
of NuMA-s within the cells, since this signal was not detected
in low-level expression cells (Fig. 4b). In general, about 5-10%
of transfected cells expressing NuMA-s showed a fluorescence
staining pattern (a small dot-like structure) similar to that in
Fig. 3a. Of the remaining cells expressing NuMA-s, ~10%
showed a low-level expression pattern (as in Fig. 4a-c), ~50%
showed a medium-level pattern (as in Fig. 4d-f), and ~30%
showed a high-level pattern (as in Fig. 4g-h). A similar staining
pattern was also observed when we transfected SV/NuMA-m
into CHOP cells that expressed NuMA-m (Fig. 5).
The carboxy terminus of NuMA-l contains the signal
necessary for nuclear localization and spindle
association
The finding that NuMA-l is targeted correctly to interphase
nuclei, whereas NuMA-m and -s are not, suggests that the
carboxy terminus of NuMA-l contains the signal necessary for
nuclear targeting. The NuMA-l tail containing the nuclear
targeting domain has also been observed by Compton and
Cleveland (1993). In an attempt to map the peptide region
involved in nuclear localization, a series of linkers that contain
stop codons in all three reading frames was introduced into the
3′ end of SV/NuMA-l cDNA (Fig. 6A). The expression of the
Fig. 6. Expression of human NuMA-l carboxy-terminal deletion mutants in CHOP cells. CHOP cells were transfected with various linker
scaning mutant cDNAs (A). The cells were fixed and processed for immunofluorescence with mAb W1. (B) Transfected cells at the interphase
stage; (C) transfected cells at the metaphase stage. Bar, 25 µm.
Nuclear mitotic apparatus protein 1397
truncated linker scaning mutants in CHOP cells was analyzed
with mAb W1 by confocal fluorescence microscopy.
Fig. 6 shows the subcellular localization of a series of
carboxy-terminal deletion mutants of NuMA-l. Linker 12
(L12) and linker 1 (L1) mutants both targeted correctly to interphase nuclei (Fig. 6B) and mitotic spindle poles (Fig. 6C).
However, when the carboxy-terminal end was removed up to
or after linker 24 position, the nuclear staining disappeared.
Instead, a prominent cytosolic localization was noticed (Fig.
6B, L24). Some bright spots distributed in the cytosol were
also observed in L42-transfected cells (Fig. 6B). Interestingly,
the spindle association gradually diminished in L36 mutants
(Fig. 6C) and was completely lost in L42 mutants (Fig. 6C)
and in other mutants after linker 36 (data not shown). These
results suggest that the 279 amino acid peptide located between
L1 and L24 is necessary for nuclear targeting, whereas the
peptide domain (residues 1516-1667) located between L42 and
L36 appears to be necessary for spindle association.
Subcellular localization of the carboxy terminus of
NuMA-l/β-galactosidase chimeric proteins
To define more precisely the carboxy terminus of NuMA-l
involved in nuclear localization and spindle association, a
series of NuMA-l/β-galactosidase expression vectors were
constructed (Fig. 7). β-Galactosidase (β-gal), a protein
encoded by the lacZ gene of E. coli was chosen as a cytosol
localization marker. The expression of chimeric proteins that
encode various carboxy-terminal proteins of NuMA-l fused to
β-gal in CHOP cells was analyzed with a monoclonal antibody
specifically against β-gal. Consistent with earlier reports, wildtype β-gal was detected predominantly in the cytoplasm with
no nuclear expression and no spindle association (data not
shown). However, pc11 chimeric protein (NuMA15382115/β-gal), consisting of the entire carboxy-terminal region
of NuMA-l (Fig. 7), was expressed primarily in the nucleus but
not in the nucleoli (Fig. 8A-a), a pattern similar to that
observed in NuMA of human cells (Tang et al., 1993b).
Analysis of pc6 chimeric protein (NuMA1538-1975/β-gal)
displayed a mostly cytoplasmic expression pattern (Fig. 8A-b).
Interestingly, pc11 chimeric protein was targeted to the spindle
pole in mitotic cells (Fig. 8B-i). However, spindle-pole association was not observed in cells transfected with pc6 (Fig. 8Bj), pc20 or pc25 chimeric proteins (data not shown). Taken
together, these results suggest that residues between 1975 and
2115 of NuMA-l contain a functional signal for nuclear localization, whereas the entire tail region (1538-2115) of NuMAl is necessary and sufficient for spindle association (Fig. 7).
To narrow down further the region involved in nuclear localization, we then transfected several expression vectors (Fig. 7,
pc18, 20, 21, 23, 24, and 25) that each encoded a smaller
peptide of the NuMA-l tail fused to β-gal in CHOP cells.
Chimeric proteins consisting of residues 1839-2095 (Fig. 7,
pc18; Fig. 8A-c), 1972-2095 (Fig. 7, pc20; Fig. 8A-d), or 19722059 (Fig. 7, pc21; Fig. 8A-e) of the NuMA-l tail revealed a
predominantly nuclear pattern of localizaion. In contrast,
chimeric proteins containing either residues 2030-2059 (Fig. 7,
pc23; Fig. 8A-f) or 2002-2034 (Fig. 7, pc25; Fig. 8A-g) fused
to β-gal displayed a mostly cytoplasmic expression pattern.
These results suggest that residues 1972-2007 of NuMA-l constitute a functional NLS. Indeed, when we transfected pc24,
which contains only 36 amino acid residues (1972-2007) of the
ATG
EcoRI
gpt trps
Lac Z
SV40 ori/
early promoter
NuMA-l
P
1
(25 aa)
P
NuMA-l
alpha-helical coiled-coil domain (14 aa)
2115
C
N
Cellular
Spindle
Localization Association
N
pc11
2115
1538
C
pc6
1975
1538
N
pc18
1839
2095
N
pc20
1972
2095
1972
2059
pc21
N
C
pc23
2030
pc25
2002
pc24
2034
2059
C
N
1972
2007
Fig. 7. Summary of the chimeric NuMA/β-gal expression vectors
and the expression phenotypes of these chimeric polypeptides. The
pc expression vectors were constructed by ligating a series of PCR
fragments amplified from NuMA-l cDNA, into the lacZ gene of
pCH110 expression vector (see Materials and Methods for details).
P, selected primer sets for PCR amplification. The SV40 early
promoter of pCH110 directs the high-level expression of a hybrid
protein composed of 40 residues of gpt including the ATG
translation initiation site and 28 residues of trp S that were fused to
the lacZ gene-encoded β-gal protein (Pharmacia). The amino acid
residues of NuMA-l encoded by these chimeric expression vectors
are indicated by numbers below the black boxes, which represent the
coding region of NuMA-l protein. N, nuclear localization; C, cytosol
localization.
NuMA-l tail fused to β-gal, into CHOP cells, we did observe
prominent nuclear staining (Fig. 8A-h).
Site-specific mutational analysis of the nuclear
localization signal
The 36 amino acid peptide (residues 1972-2007) of the NuMAl protein contains four basic residues clustered within positions
1984 to 1989 (Fig. 9A), a feature similar to other known NLS.
One mutation with the (K)Lys1988 of NuMA-l substituted by
glutamic acid (E) in pc24N2 clone (Fig. 9A) did abolish
nuclear localization (Fig. 9B-b). However, another mutation
(pc24N1), which has (R)Arg1984 replaced by glycine (G), did
not prevent accumulation of the chimeric protein in the nucleus
(Fig. 9B-a). These results suggest that Lys1988 is essential for
nuclear targeting, whereas Arg1984 is not. To our surprise, the
pc7 chimeric protein (NuMA1985-1991/β-gal) consisting of
only seven amino acid residues (QQRKRVS) that cover all
three basic residues (RKR), located at amino acid positions
1987-1989 (Fig. 9A), was mostly expressed in the cytoplasm
(Fig. 9B-c). However, when we transfected with two other constructs (pc30 and pc31), which encode residues 1981-1994 or
1981-2007 of NuMA-l, respectively, fused to β-gal, these two
chimeric proteins were homogeneous and distributed equally
1398 T. K. Tang and others
Fig. 8. (A) Subcellular localization of chimeric NuMA/β-gal proteins expressed in CHOP cells. CHOP cells were transfected with pc11 (a, a′),
pc6 (b, b′), pc18 (c, c′), pc20 (d, d′), pc21 (e, e′), pc23 (f, f′), pc25 (g, g′) or pc24 (h, h′). (B) Localization of chimeric NuMA/β-gal proteins
relative to the mitotic spindle in metaphase cells. CHOP cells were transfected with either pc11 (i, i′) or pc6 (j, j′) plasmids. The expression of
chimeric proteins in transfected cells was detected by mouse monoclonal anti-β-galactosidase antibody (a to j) and propidium iodide (a′ to j′).
Bar, 25 µm.
between nucleus and cytoplasm (pc30, Fig. 9B-d; pc31, data
not shown). Taken together, these results suggest that residues
1972-2007 (Fig. 9A, pc24), located at the carboxy-terminal
domain of NuMA-l, are necessary and sufficient for nuclear
Nuclear mitotic apparatus protein 1399
B
targeting, whereas residues 1985-1991 (pc7) alone are not sufficient.
DISCUSSION
NUMA is composed of multiple isoforms
heterogeneous in size and subcellular localization
NuMA was originally reported as an intranuclear protein that
is concentrated at the spindle pole during mitosis (Lyderson
and Pettijohn, 1980). More recently, however, we have shown
that NuMA consists of multiple isoforms of various sizes and
amounts in a specific cell type (Tang et al., 1993b). The major
difference is located at the carboxy terminus. NuMA-l, -m and
-s contain 391, 52 and 39 amino acids, respectively (Fig. 1A),
attached to a common polypeptide backbone at the position of
amino acid residue 1724 (numbering system of Yang et al.,
1992). This finding raises questions concerning the subcellular localization and function of each specific isoform. In this
report, we have developed a transient expression system in
which only transfected human NuMAs, but not endogeneous
hamster NuMA, can be detected by the monoclonal antibody
(mAb W1) that we use. Our results show that the localization
of the largest isoform, NuMA-l (~230 kDa), mimics that of the
endogenous human NuMA (Lyderson and Pettijohn, 1980;
Tousson et al., 1991; Kallajoki et al., 1991; Compton et al.,
Fig. 9. (A) Summary of
the expression phenotypes
of site-directed
mutagenesis vectors. The
pc expression vectors
were constructed as
described for Fig. 7 and in
Materials and Methods.
The one-letter amino acid
code is used. (B) Sitespecific mutations or short
basic residues affecting
nuclear localization of
NuMA/β-gal proteins.
CHOP cells were
transfected with pc24N1
(1984 RtG) (a, a′),
pc24N2 (1988 KrE) (b,
b′), pc7 (c, c′) or pc30 (d,
d′). The
immunofluorescence
analysis was as described
in Fig. 8B.
1991; Yang et al., 1992; Tang et al., 1993b). In contrast, two
other isoforms (NuMA-m and NuMA-s) with lower molecular
masses reveal a distinct subcellular distribution. They appear
to be located in the interphase cytosol, mainly clustered at the
centrosomal region, but move to the mitotic spindle pole
during mitosis.
If NuMA-m and NuMA-s are present in the interphase centrosomal region, why was their presence not observed in
previous fluorescence studies? One possible explanation is that
the shorter forms of NuMA (p195 and p194) may exist as antigenically inactive precursors or homologues, which were
barely detected by earlier reported antibodies. The other possibility is that NuMA-m and NuMA-s isoforms are expressed
at a level too low to be detected by the immunofluorescence
studies. Indeed, overexpression of these two isoforms in CHOP
cells has permitted easy analysis of their subcellular localization.
The carboxy terminus of NuMA-l contains a peptide
domain for spindle association
Analysis of a series of NuMA-l deletion mutants (Fig. 6)
revealed that the tail region of NuMA-l (residues 1516-1667)
must possess a signal necessary for spindle association.
However, when we transfected the pc6 construct that encodes
residues 1538-1975 of NuMA-l (including the 42 bp encoded
peptide) fused to β-gal, or transfected pc20 (NuMA1972-
1400 T. K. Tang and others
2095/β-gal) into CHOP cells (Fig. 7), no spindle association
was observed. From these results, it is reasonable to speculate
that the spindle-association signal is located between residues
1516 and 1538. Unfortunately, this appears not to be the case,
since Compton and Cleveland (1993) have shown that a tailless
human NuMA protein (CMV/NuMA1-1545), consisting of
residues from 1 to 1559 based on our and Yang’s numbering
system (Yang et al., 1992), is not targetted to the spindle pole.
(The Compton construct, CMV/NuMA1-1545, lacks the 42 bp
encoded peptide, therefore residue 1545 is equivalent to 1559,
based on our and Yang’s numbering system.) Their observation excludes the possibility that residues 1516-1538 of
NuMA-l contain the signal for spindle association. To our
surprise, if we transfected the pc11 construct (Fig. 7) encoding
the entire tail region of NuMA-l (residues 1538-2115) fused to
β-gal, it did reveal a spindle association in mitotic cells (Fig.
8B-i), although the intensity of the signal was weaker than that
observed in wild-type SV/NuMA-l (Fig. 1C-b). Altogether,
these results suggest that the pc11 chimeric protein contains a
peptide domain that is necessary and sufficient for spindle
association, whereas other sequences shorter than this region
are insufficient for spindle targeting.
It is interesting to note that both NuMA-m and -s also target
to the mitotic spindle. By comparison of the sequences of the
spindle association domain (residues 1538-2115) defined in
NuMA-l with the entire coding region of NuMA-m (residues
1-1776) and -s (residues 1-1763), a short segment located at
residues 1538-1725 is identical in all three NuMA isoforms.
However, the pc6 chimeric protein (NuMA1538-1975/β-gal)
that includes this region is insufficient to drive the chimeric
protein into the spindle (Fig. 7, pc6). These results suggest that
a particular amino acid sequence may not be directly involved
in targeting of NuMA-m and -s to the mitotic spindle pole.
Instead, the overall protein tertiary structure or post-translational modification of some specific residues in NuMA
polypeptides may play a role. In addition, the presence of a
negative regulatory sequence located within residues 15381975, which inhibits the spindle association, cannot be
excluded.
Furthermore, we have shown that the truncated L36 (1-1667)
and L24 (1-1766) polypeptides of NuMA-l isoform are present
at the spindle pole, but not at the interphase centrosomal region.
In contrast, both NuMA-m and NuMA-s isoforms are localized
to the centrosomal region in interphase and mitotic cells. This
observed differential subcellular localization might be partially
due to the presence of the unique polypeptide located at the
carboxy termini of NuMA-m and NuMA-s.
globular
domain
alpha-helical coiled-coil domain
(25 aa)
Possible roles for shorter NuMA isoforms (NuMA-m
and NuMA-s) during mitosis
The targeting of NuMA-m and -s to the interphase centrosomal region is rather unexpected, since NuMA (renamed as
NuMA-l) was originally reported to be present in the interphase nuclei, not the centrosomal region. It is interesting to
note that all three isoforms contain a common long α-helical
coiled-coil domain (Tang et al., 1993b) that has been predicted
to serve a function in the dimerization of two NuMA molecules
through hydrophobic interactions. Therefore, it is possible that
pre-existing NuMA-m and -s at the interphase centrosomal
region might act as a seed for NuMA-l assembly at a later
mitotic stage. In addition, we have shown that the NuMA-l tail
possesses the peptide signal necessary for spindle association.
Therefore, NuMA-l might be first brought to the spindle pole
region by its spindle association domain and then become associated with two other NuMA isoforms (NuMA-m and -s)
through a common long α-helical coiled-coil dimerization
domain (Fig. 10). The observations that NuMA-l associates
with the centrosome immediately after it is released from the
nucleus upon nuclear envelope breakdown (Lyderson and
Pettijohn, 1980; Tousson et al., 1991; Compton et al., 1992;
Yang et al., 1992) and that all three isoforms are present in the
mitotic spindle at a later mitotic stage (this report) are consistent with this hypothesis. Furthermore, the primary sequence
of NuMA contains five hypothetical leucine zipper repeats
located in both the N-terminal and the long α-helical central
domains (Fig. 10; Tang et al., 1993b; Maekawa and Kuriyama,
1993). Although the various NuMA isoforms might form a
homo- or hetero-dimer along its large central coiled-coil
domain, other proteins with similar leucine zipper repeats
might also interact with NuMAs through the leucine residues
of the zipper motif.
Recently, several centrosomal components have been identified and classified into four categories on the basis of their
distribution during the cell cycle (reviewed by Kalt and
Schliwa, 1993). Among these proteins, p34cdc2 has drawn
much attention, due to its partial association with the centrosome (Bailly et al., 1989) and its mitotic kinase activity
(Draetta and Beach, 1988; Labbe et al., 1988). Interestingly,
four cdc2 kinase recognition sequence motifs (TPRD, TPKK,
SPRI and TPRA at positions 2015-2018, 2055-2058, 20872090 and 2106-2109) and one such motif (TPRD at position
1732-1735) (Shenoy et al., 1989) have been identified at the
carboxy terminus of NuMA-l (Yang et al., 1992; Tang et al.,
1993b) and NuMA-m (Tang et al., 1993b), respectively. These
findings, and the presence of all these isoforms at the inter-
globular
domain
(14 aa)
N
C
2115
1
L LL
L
L
1700
216
"dimerization domain"
2115
1538
spindle association domain
1972
2007
nuclear localization signal
Fig. 10. Schematic representation of the
structural (upper) and functional (lower)
domains of human NuMA-l. The wavy-line box
represents the α-helical coiled-coil domain. The
cross-hatched box (25aa and 14aa) represents
an alternative-spliced sequence block. L,
leucine zipper motif.
Nuclear mitotic apparatus protein 1401
phase centrosomal region (cdc2 and NuMA-m) and the mitotic
spindle pole region (cdc2, NuMA-l and NuMA-m) suggest that
some NuMA isoforms could potentially be phosphorylated and
regulated by p34cdc2 kinase. In addition, γ-tubulin has been
reported to be a centrosomal protein (Zheng et al., 1991;
Stearns et al., 1991) required for cell-cycle-dependent microtubule nucleation (Joshi et al., 1992). The coexistence of the
γ-tubulin with shorter NuMA isoforms (NuMA-m and -s) in
the interphase centrosomal region and the mitotic spindle pole
suggests a possible connection between these proteins. Further
analysis of the protein-protein interactions among various centrosome-associated proteins may shed some light on their
functions.
NuMA-l tail contains a novel nuclear localization
signal
Our results show that residues 1972-2007 of NuMA-l (pc24)
contain a signal that is sufficient for nuclear targeting. When
we analyzed this 36 amino acid peptide sequence using the
GCG computer program MOTIFS described by Dr Amos
Bairoch (University of Geneva), no specific peptide motifs
were identified. However, a short basic peptide sequence
(RQQRKR, residues 1984-1989) containing a high proportion
of positively charged amino acids (lysine and arginine) was
noted within this region, which has been described to be one
of the important characters for NLS (reviewed by GarciaBustos et al., 1991; Whiteside and Goodbourn, 1993). Substitution of Lys1988 in this region (Fig. 9, pc24N2) with an acidic
glutamic acid residue did abolish nuclear localization, whereas
replacement of Arg1984 (Fig. 9, pc24N1) with a non-basic,
non-hydrophobic glycine residue did not. These results suggest
that three basic amino acids (RKR) located at residues 19871989 may be important for nuclear targeting. To our surprise,
the pc7 (NuMA1985-1991/β-gal) chimeric protein, which
comprises only seven residues (QQRKRVS) including RKR,
was found to have a mostly cytosolic staining pattern. These
results suggest that Lys1988 is essential. However, the basic
residues (RKR) alone are not sufficient for targeting the
chimeric protein into the nucleus.
Recently, it has been reported that the rate of nuclear translocation of SV40 large T antigen depends on the phosphorylation of the serine residue located at the casein kinase II site
near the NLS (Rihs et al., 1991). In yeast SW15 protein, phosphorylation of the serine residue located at the potential cdc2
kinase recognition sites within its NLS may also regulate the
intracellular localization of SW15 (Moll et al., 1991).
However, neither the potential cdc2 nor casein kinase II recognition sites are present within the 36 amino acid peptide in
NuMA-l. Moreover, no sequence similar to the bipartite
nuclear localization domain reported in nucleoplasmin
(Robbins et al., 1991) could be identified within this region.
Taken together, the above findings suggest that the 36 amino
acid peptide located at the middle portion of the carboxy
terminus (1972-2007) of NuMA-l constitutes a novel functional NLS. This nuclear localization signal is distinguished
from most previously described NLSs by its large size and its
absence of any known phosphorylation sites for cdc2 and
casein kinase II. In addition, its short basic peptide alone is
insufficient for nuclear targeting. Further analysis of nuclear
targeting by this novel NLS will be needed to elucidate the
general mechanism of nuclear protein translocation.
In summary, we have shown that NuMA is composed of
multiple isoforms heterogeneous in size and subcellular localization. In this report, we have also defined several functional
domains of NuMA-l, and presented a structural and functional
model for human NuMA-l (Fig. 10), which may provide some
important insights into our understanding of the function of
various NuMA isoforms.
This work was supported by program project grant NSC83-0203B001-102 from the National Science Council of the Republic of China
and a research grant from the Institute of Biomedical Sciences,
Academia Sinica. We are grateful to Dr John L. Wang for his thoughtful comments and suggestions. We thank Dr Cathy Fletcher for
reading this manuscript.
REFERENCES
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G.,
Smith, J. A. and Struhl, K. (1989). In Current Protocols in Molecular
Biology. John Wiley and Sons, Inc. New York.
Bailly, E., Doree, M., Nurse, P. and Bornens, M. (1989). p34cdc2 is located in
both nucleus and cytoplasm; part is centrosomally associated at G2/M and
enters vesicles at anaphase. EMBO J. 8, 3985-3995.
Compton, D. A., Yen, T. J. and Cleveland, D. W. (1991). Identification of
novel centromere/kinetochore-associated proteins using monoclonal
antibodies generated against human mitotic chromosome scaffolds. J. Cell
Biol. 112, 1083-1097.
Compton, D. A., Szilak, I. and Cleveland, D. W. (1992). Primary structure of
NuMA, an intracellular protein that defines a novel pathway for segregation
of proteins at mitosis. J. Cell Biol. 116, 1395-1408.
Compton, D. A. and Cleveland, D. W. (1993). NuMA is required for the
proper completion of mitosis. J. Cell Biol. 120, 947-957.
Draetta, G. and Beach, D. (1988). Activation of cdc2 protein kinase during
mitosis in human cells: Cell cycle-dependent phosphorylation and subunit
rearrangement. Cell 54, 17-26.
Garcia-Bustos, J., Heitman, J. and Hall, M. N. (1991). Nuclear protein
localization. Biochim. Biophy. Acta 1071, 83-101.
Heffernan, M. and Dennis, J. W. (1991). Polyoma and hamster papovavirus
large T antigen-mediated replication of expression shuttle vectors in Chinese
hamster ovary cells. Nucl. Acids Res. 19, 85-92.
Joshi, H. C., Palacios, M. J., McNamara, L. and Cleveland, D. W. (1992). γTubulin is a centrosomal protien required for cell cycle-dependent
microtubule nucleation. Nature 356, 80-83.
Kallajoki, M., Weber, K. and Osborn, M. (1991). A 210 kD nuclear matrix
protein is a functional part of the mitotic spindle; a microinjection study
using SPN monoclonal antibodies. EMBO J. 10, 3351-3362.
Kallajoki, M., Harborth, j., Weber, K. and Osborn, M. (1993).
Microinjection of a monoclonal antibody against SPN antigen, now
identified by peptide sequences as the NuMA protein, induces micronuclei in
PtK2 cells. J. Cell Sci. 104, 139-150.
Kalt, A. and Schliwa, M. (1993). Molecular components of the centrome.
Trends Cell Biol. 3, 118-128.
Labbe, J. C., Lee, M. G., Nurse, P., Picard, A. and Doree, M. (1988).
Activation at M-phase of a protein kinase encoded by a starfish homologue of
the cell cycle control gene cdc2+. Nature 335, 251-254.
Lyderson, B. and Pettijohn, D. (1980). Human-specific nuclear protein that
associates with the polar region of the mitotic apparatus: distribution in a
human/hamster hybrid cell. Cell 22, 489-499.
Maekawa, T. and Kuriyama, R. (1991). Differential pathways of recruitment
for centrosomal antigens to the mitotic poles during bipolar spindle
formation. J. Cell Sci. 100, 533-540.
Maekawa, T. and Kuriyama, R. (1993). Primary structure and microtubuleinteracting domain of the SP-H antigen: a mitotic map located at the spindle
pole and characterized as a homologous protein to NuMA. J. Cell Sci. 105,
589-600.
Moll, T., Tebb, G., Surana, U., Robitsch, H. and Nasmyth, K. (1991). The
role of phosphorylation and the CDC28 protein kinase in cell cycle-regulated
nuclear import of the S. cerevisiae transcription factor SE15. Cell, 66, 743758.
Price, C. M. and Pettijohn, D. E. (1986). Distribution of the nuclear mitotic
1402 T. K. Tang and others
apparatus protein (NuMA) during mitosis and nuclear assembly. Exp. Cell
Res. 166, 295-311.
Rihs, H-P., Jans, D. A., Fan, H. and Peters, R. (1991). The rate of nuclear
cytoplasmic protein transport is determined by the casein kinase II site
flanking the nuclear localization sequence of the SV40 T-antigen. EMBO J.
10, 633-639.
Robbins, J., Dilworth, S. M., Laskey, R. A. and Dingwall, C. (1991). Two
interdependent basic domains in nucleoplasmin nuclear targeting sequence:
Identification of a class of bipartite nuclear targeting sequence. Cell 64, 615623.
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
Shenoy, S., Bagrodia, S., Choi, J.-K., Copeland, T., Maller, J., and
Shalloway, D. (1989). Purified maturation promoting factor phosphorylates
pp60 c-src at the sites phosphorylated during frbroblast mitosis. Cell 57, 763774.
Stearns, T., Evans, L. and Kirschner, M. (1991). γ-Tubulin is a highly
conserved component of the centrosome. Cell 65, 825-836.
Tang, T. K., Hong, T.-M., Lin, C.-Y., Lai, M.-L., Liu, C. H. L., Lo, H.-J.,
Wang, M.-E., Chen, L. B., Chen, W.-T., Ip, W., Lin, D. C., Lin, J. J.-C.,
Lin, S., Sun, T.-T., Wang, E., Wang, J. L., Wu, R., Wu, C.-W. and Chien,
S. (1993a). Nuclear protein of the bovine esophageal epithelium. I.
Monoclonal antibody W2 specifically reacts with condensed nuclei of
differentiated superficial cells. J. Cell Sci. 104, 237-247.
Tang, T. K., Tang, C.-J. C., Chen, Y.-L. and Wu, C.-W. (1993b). Nuclear
proteins of the bovine esophageal epithelium. II. The NuMA gene gives rise
to multiple mRNAs and gene products reactive with monoclonal antibody
W1. J. Cell Sci. 104, 249-260.
Tang, T. K., Tang, C.-J. C., Tsou, T.-C., Hong, T.-M., Hong, R.-L., Chang,
C.-J., and Wu, C.-W. (1994). Study of nuclear proteins associated with cell
proliferation, differentiation, and mitosis by confocal fluorescence
microscopy. In Multidimensional Microscopy (ed. P. C. Cheng, T. H. Lin, W.
L. Wu, and J. L. Wu), pp. 305-319. Springer-Verlag Inc., New York.
Tousson, A., Zeng, C., Brinkley, B. R. and Valdiria, M. M. (1991).
Centrophilin: a novel mitotic spindle protein involved in microtubule
nucleation. J. Cell Biol. 112, 427-440.
Whiteside, S. T. and Goodbourn, S. (1993). Signal transduction and nuclear
targeting: regulation of transcription factor activity by subcellular
localisation. J. Cell Sci. 104, 949-955.
Yang, C. H., Lambie, E. J. and Snyder, M. (1992). NuMA: an unusually long
coiled-coil related protein in the mammalian nucleus. J. Cell Biol. 116, 13031317.
Yang, C. H. and Snyder, M. (1992). The nuclear-mitotic apparatus protein is
important in the establishment and maintenance of bipolar mitotic spindle
apparatus. Mol. Biol. Cell 3, 1259-1267.
Zheng, Y., Jung, M. K. and Oakley, B. R. (1991). γ-Tubulin is present in
Drosophila melanogaster and homo sapiens and is associated with the
centrosome. Cell 65, 817-823.
(Received 6 December 1993 - Accepted 2 February 1994)