Download Isolation of insertion elements from Gram

ELSEVIER
FEMS Microbiology
Letters 126 (1995) I-6
Isolation of insertion elements from Gram-positive
Brevibacterium, Corynebacterium and Rhodococcus strains using
the Bacillus subtilis sacB gene as a positive selection marker
Wolfgang JZger, Andreas Schgfer, Jijrn Kalinowski
*,
Alfred Piihler
Departmentof Genetics,Universityof Bielefeld,Postfach 100131, 33501 Bielefeld,Germany
Received 21 October 1994; accepted
17 November
1994
Abstract
The sacB gene of Bacillus subtilis was successfully applied in various Arthrobacter, Brevibacterium, Corynebacterium
and Rhodococcus strains for the isolation of transposable elements. Three different insertion sequence (IS) elements
entrapped in sacB were isolated. The IS elements IS-B1 and IS-Cg isolated from Brevibacterium lactofermentum and
Corynebacterium glutamicum, respectively, were found to be similar in size (1.45 kb) and generated target duplications of 8
bp. Their inverted repeats showed homology. In contrast, the IS element IS-Rf isolated from Rhodococcus fascians was
only 1.3 kb long and generated a 3-bp target duplication. IS-Cg and IS-Rf were not restricted to their original host strains,
and we also found strains harbouring more than one element.
Keywords: Arthrobacter; Brevibacterium; Corynebacterium; Rhodococcus; sacB; Insertion sequence element
1. Introduction
The Bacillus subtilis sacB gene encodes levan
sucrase, a secreted exoenzyme, which synthesizes
levan by hydrolysation
of sucrose and polymerization of the resulting fructose residues [l]. Expression
of the sacB gene in Escherichia
coli and other
Gram-negative
bacteria is known to be lethal in the
presence of sucrose [2]. Therefore, the gene enables
a direct selection for marker inactivation, and it has
been widely used for the isolation of IS elements
Corresponding
author.
( + 49-521) 106 5626
l
Tel.:
(+49-521)
0378-1097/95/$09.50
0 1995 Federation
SSDI 0378-1097(94)00513-3
106
5606;
of European
Fax:
Microbiological
entrapped in sacB by selecting for sucrose-resistant
colonies [3].
In a previous paper, we published the expression
of the Bacillus subtilis sacB gene in Corynebacterium glutamicum ATCC 13032, which leads, as in
Gram-negative
bacteria, to sucrose sensitivity [4].
Moreover, insertions in sacB within the size of
typical IS elements were found. With regard to this
observation, we stated that the sacB gene could act
as the first conditionally
lethal marker for the isolation of IS elements from C. glutamicum.
In the meantime, we continued to work on IS
elements from C. glutamicum and other corynebacterial species. The Arthrobacter,
Brevibacterium,
Corynebacterium
and Rhodococcus
strains used in
Societies.
All rights reserved
2
W. Jiiger et al. /FEMS Microbiology Letters 126 (1995) 1-6
this study are Gram-positive soil bacteria with a GC
content of more than 51 mol% [5,6]. Several
corynebacteria and brevibacteria are of great industrial importance. They are mainly used for the fermentative production of amino acids like L-glutamic
acid, L-lysine, or L-aspartate [7].
Mobile genetic elements are powerful tools to
achieve strain improvement. However, so far only
one IS element, IS31831 from C. glutamicum ATCC
31831, has been published [8], and the DNA sequence of an IS3 related element from C. glutamicum B115 was entered into the GenBank database
[9]. The aim of this study was to survey the occurrence and the dissemination of IS elements in industrially important Arthrobucter,
Breuibacterium,
Corynebacterium and Rhodococcus strains.
2. Materials and methods
2.1. Bacterial strains, plasmids
and growth media
Bacterial strains used in this study are listed in
Table 1. Plasmid pECM2 as well as pWJ5 carrying
sacB were described previously [4]. The mobilizing
donor strain for conjugal transfer was E. coli S17-1
[lo]. Cloning experiments were done in E. coli
DH5a [ll] using the vector pKl8mob [12].
Arthrobacter,
Breuibacterium, Corynebacterium,
Rhodococcus strains and E. coli were grown on
LBG (1.0% tryptone, 0.5% yeast extract, 0.5% NaCl,
0.2% glucose) at 30°C and 37°C respectively. Plasmid carrying strains were selected on LBG supplemented with kanamycin to a final concentration of
25 pg ml-’ for Arthrobacter,
Brevibacterium,
Corynebacterium,
Rhodococcus, and 50 pug ml-’
for E. coli. Transconjugants were selected on LBG
containing 50 pg ml-’ nalidixic acid. Sensitivity to
sucrose was tested on 10% sucrose added to selective medium.
2.2. DNA isolation, transfer and manipulation
Plasmid DNA was prepared by using the QIAGEN Plasmid Mini Kit (QIAGEN Inc., Chatsworth,
CA), with an additional incubation step for 2 h at
37°C for Arthrobacter, Brevibacterium, Corynebacterium and Rhodococcus after resuspension in buffer
Pl containing 20 mg ml-’ lysozyme. Chromosomal
DNA was isolated as described by Altenbuchner and
Cullum [13]. Vectors pWJ5 and pECM2 were transferred to Arthrobacter, Brevibacterium, Corynebac-
Table 1
Strain
Sucrose-resistant
colonies by
insertions in sacB a
Identification of
insertions in
sacB as IS elements b
Hybridization of IS
element probes
to chromosomal DNA ’
Arthrobacter albidus DSM 20128
Brevibacterium divaricatum DSM 20297
Brevibacterium frnvum DSM 20411
Brevibacterium lactofermentum ATCC 13869
Brevibacterium stationis DSM 20302
Corynebacterium acetoacidophilum ATCC 13870
Coryebacterium
ammoniagenes DSM 20305
Corynebacterium callunae DSM 20147
Corynebacterium glutamicum AS019
Corynebacterium glutamicum ATCC 13032
Cotynebocterium glutamicum ATCC 13058
Corynebacterium herculis DSM 20301
Corynebacterium lilium DSM 20137
Corynebacterium melassecola ATCC 17965
Rhodococcus fascians DSM 20131
-
n.a.
n.a.
n.t.
IS-B1
n.a.
n.a.
n.a.
n.a.
n.t.
IS-cg
n.a.
n.t.
n.a.
n.a.
IS-Rf
n.t.
n.t.
IS-Q
IS-BI, IS-Q, IS-Rf
nt.
n.t.
n.t.
wt.
IS-cg
IS-cg
n.t.
IS-Q, IS-Rf
n.t.
n.t.
IS-Q, IS-Rf
+
+
+
+
+
+
a Insertions were identified by enlargement of sacB of plasmid pWJ5. ’ Insertions were analysed by sequencing, results are presented in
Fig. 1. IS-Bl, IS-Cg and IS-R?, IS elements first found in B. lactofermentum, C. glutumicum and R. fascians, respectively. n.a., not
applicable; n.t., not tested. ’ DNA probes of IS-Bl, IS-Cg and IS-Rf were used in Southern hybridization experiments, results are shown in
Fig. 2.
W. Jiiger et al. / FEMS Microbiology Letters 126 (I 995) l-6
3
Boehringer
(Mannheim,
Germany),
following
the
manufacturers’ instructions. Stringency washes were
done at 68°C with washing buffer containing 0.1%
ssc.
terium and Rhodococcus strains by conjugation [14]
using 1 X 10’ cells of donor and recipient strains. E.
coli was transformed by the CaCl, method [ll]. In
vitro analysis of plasmid and chromosomal
DNA
was carried out by standard procedures [l-51. Hybridization experiments were performed according to
Southern [16] using Hybond-N
nylon membranes
purchased
from Amersham
(Braunschweig,
Germany), the vacuum blotter VacuGene LKB2016 from
Pharmacia (Freiburg, Germany) and the DNA Labeling and Detection
Kit Nonradioactive
from
2.3. DNA sequencing
DNA sequences were determined by the chain
termination method [17] using the T7 Sequencing Kit
(Pharmacia,
Freiburg, Germany).
Sequencing
gels
were prepared as described by Garoff and Ansorge
IS-Bl
IS-cg
IS-Rf
(I.45 kb) (1.45
kb) (1.3kb)
a)
ClaI
Clal
....
pWJ5
b)
sacB
tgattgagctaaac)gatgatta$iGCCCm
IS-Q
ATGCACTCTAAAACAGGAAGAGC~atgatt+acactgaaaaaag
tatgtttctaatltctttaa+GCTCTTCCGTGTTTAGAGTGCATTG
IS-B1
CAATGCACTCTAAAAACGGAAGAGCClm$ggcccatacaa
tggatcttgatcctaacgatgta*GACC-GACCCCGATATGG
IS-Rf
CCAAATGGGGGTCAGGTCCmttacttactcacacttcgctgtac
Fig. 1. Localization and terminal sequences of three IS elements entrapped in the sacB gene. (a) The insertions are shown of IS elements
isolated from B. lactofemaentum ATCC 13869, C. glutamicum ATCC 13032 and R. faxinns DSM 20131, named IS-B& IS-Cg, and IS-Rf,
respectively, into the sacB coding region of plasmid pWJ5. The sizes of the IS elements are given in brackets. (b) The terminal sequences
of the IS elements (capital letters) and the adjacent sacB sequences (lower case letters) are presented. Arrows indicate inverse repetitive
ends (bold face was used for matches). Boxed italic letters show duplicated sequences at the target sites.
4
W. Jiiger et al. / FEMS Microbiology Letters 126 (1995) l-6
[18]. We searched for homologies in EMBL and
GenBank databases by means of the FASTA [19]
E-mail Server (EMBL, Heidelberg, Germany) or the
BLAST [20] Server (NCBI, Bethesda, MD).
3. Results and discussion
The positive selection system used in this study is
based on the Bacillus subtilis sacB gene which
causes sucrose sensitivity in many Gram-negative
bacteria and in the Gram-positive
Corynebacterium
glutamicum ATCC 13032 [3,4]. To enlarge the list of
Gram-positive bacterial species we analysed the sacB
selection system in several Arthrobacter, Breuibacterium, Corynebacterium and Rhodococcus strains
(Table 1). For this purpose, the sacB vector pWJ5 as
well as plasmid pECM2 [4] lacking the sacB gene
were introduced into these bacteria via conjugation.
The effect of sacB expression in the resulting clones
was analysed by investigating
their growth in the
presence of sucrose. Transconjugants
were plated in
parallel on selective LBG medium with and without
10% sucrose, and were incubated for 24 h at 30°C.
When plasmid pWJ5 was present, all bacterial strains
kb
123456
123456
probe:
tested were unable to grow on sucrose medium,
whereas no growth inhibition occurred in the absence of sucrose, nor in cells harbouring vector
pECM2. The sucrose sensitive phenotype is consistent with the previously described lethal effect for C.
glutamicum ATCC 13032 on sucrose medium caused
by expression of sacB [4]. Nevertheless, our results
demonstrate that the sacB system is functional in the
other Gram-positive
organisms used in this study,
and is not restricted to C. glutamicum.
The observed lethal effect caused by sacB in the
presence of sucrose provided the basis for the isolation
of IS elements
from
Brevibacterium,
Corynebacterium and Rhodococcus strains by selecting for sucrose-resistant
colonies and analysing the
sacB gene for insertional inactivation. The strains
harbouring plasmid pWJ5 were spread onto selective
LBG agar plates containing 10% sucrose, in a density of lo8 cells per plate. After an incubation for
48-72 h at 30°C sucrose-resistant
colonies arose
from every strain. Restriction analysis of vector pWJ5
isolated from these clones, revealed in some cases
the presence of DNA insertions in sacB (Table 1). In
some strains, however, no insertions in sacB were
found. For some of these sucrose-resistant mutants it
IS-B/
123456
IS-cg
Fig. 2. Distribution of the IS elements IS-B& IS-Cg and IS-Rf in six different Breuibacterium, Coryebucterium
and Rhodococcus strains.
Southern hybridizations to &I-restricted
chromosomal DNAs from B. flauum DSM 20411 (lanes 11, B. luctofermentum ATCC 13869
(lanes 21, C. glutumicum ATCC 13032 (lanes 31, C. glutamicum AS019 (lanes 4), C. herculis DSM 20301 (lanes 5) and R. fascians
DM200-2 (lanes 6) were performed using the subcloned IS-H, IS-Cg and IS-Rf elements as probes. The size of the molecular mass marker
is given in kb.
W. JZiger et al. / FEMS Microbiology
was shown that they carry the unaffected vector
pWJ5. This was shown by introducing the plasmids
in question into E. coli and by testing for sucrose
sensitivity (data not shown). Therefore, besides mutation of the sacB gene, at least one other, so far
unknown resistance mechanism should exist. Since
in E. coli the lethal effect parallels with an active
levan sucrase in the periplasm [2], chromosomal
mutations preventing enzyme or substrate transport
may be responsible for resistance while the sacB
gene remains unaffected.
Three different insertions in the sacB gene originating from B. lactofermentum ATCC 13869, C.
glutumicum ATCC 13032 and R. fuscians DSM
20131, which were named IS-B& IS-Cg and IS-Rf
according to their host strains, were analysed in more
detail. The sizes of the insertions ranged from 1.3 to
1.45 kb (Fig. la) as calculated by restriction pattern
analysis (data not shown). The ClaI/HindIII
fragments of the sacB gene carrying the inserted IS-B1
or IS-Rf elements as well as the ClaI/SspI
fragment
harbouring
IS-Cg were isolated, blunt-ended
and
subcloned into the SmaI site of vector pK18mob
[12]. By sequencing the ends of the cloned fragments, the target sites within the sacB gene and the
terminal sequences of the insertions were determined
(Fig. lb). The sequence data displayed typical features of IS elements, including target site duplications of 8 bp for IS-B1 and IS-Cg, and 3 bp for
IS-Rf, as well as terminal inverted repeats (Fig. lb),
verifying that IS elements were isolated. Homology
searches revealed that the ends of IS-B1 are similar
to the recently published element IS32831 isolated
from C. glutumicum ATCC 31831 [S], while IS-Cg
ends are identical to this element. The terminal
sequences of IS-Rf showed 78% homology to an
insertion sequence isolated from C. glutumicum B115
[91.
The strains in which insertional inactivation
of
sacB was detected, were further analysed for the
presence of IS-Bl, IS-Cg and IS-Rf. Southern hybridizations to chromosomal DNAs were performed
using the IS elements as probes (Fig. 2). IS-Cg and
IS-Rf were not restricted to their original host strains
alone. The most disseminated one was IS-Cg, found
to be present in the six strains analysed, whereas
sequences
homologous
to IS-Rf existed in B.
lactofermentum,
C. herculis and R. fascians. IS-B1
Letters 126 (1995) I-6
5
only occurred in B. lactofermentum. Prolonged staining of the filters indicated weak homology between
IS-Cg and IS-B& whereas no cross-reaction
of the
IS-Rf probe to IS-Cg nor IS-B1 DNAs occurred. The
occurrence of identical IS elements in different strains
refers to a close relationship of these bacteria, or
indicates that gene transfer events must have happened. IS-Cg and IS-B1 probably have a common
ancestor, since both are similar in size, share homologous sequences and generate target site duplications
of 8 bp (Fig. lb).
In this study we extended the application range of
the sacB system that was shown so far to be functional in only one Gram-positive
organism, C. glutamicum ATCC 13032 [4], to several Arthrobacter,
Brevibacterium,
Corynebacterium
and Rhodococcus
strains. Additionally,
the application of the system
was demonstrated in a positive selection procedure,
which resulted in the isolation of three different IS
elements.
Acknowledgements
We thank Michaela Behrendt for technical assistance. W.J. and A.S. acknowledge
the receipt of
scholarships of the Deutsche Forschungs Gemeinschaft (Graduiertenkolleg)
and of the Studienstiftung
des deutschen Volkes, respectively. This work was
supported by the Bundesministerium
fur Forschung
und Technologie Grant 031925A and by the BRIDGE
BIOT CT91-0264 (RZJE) project of the Commission
of the European Communities.
References
[l] Dedonder, R. (1966) Levan sucrase from Bacillus subtilis.
Methods Enzymol. 8, 500-505.
[2] Steinmetz, M., Le Coq, D., Djemia, H.B. and Gay, P. (1983)
Analyse genetique de sacB, gene de structure d’une enzyme
secrttte, la ltvane-saccharase
de Bacillus subtilis Marburg.
Mol. Gen. Genet. 191, 138-144.
[3] Gay, P., Le Coq, D., Steinmetz, M., Berkelmann, T. and
Kado, C.I. (1985) Positive selection procedure for entrapment of insertion sequence elements in gram-negative bacteria. J. Bacterial. 164, 918-921.
[4] Jager, W., Scfifer, A., Pihler, A., Labes, G. and Wohlleben,
W. (1992) Expression of the Bucilhs subtilis sacB gene
leads to sucrose sensitivity in the gram-positive
bacterium
Corynebacterium glutamicum but not in Streptomyces liuiduns. .I. Bacterial. 174, 5462-5465.
6
W. Jiiger et al. / FEMS Microbiology
[5] Jones, D. and Collins, M.D. (1986) Irregular, nonsporing
Gram-positive rods. In: Bergey’s Manual of Systematic Bacteriology (Sneath, P.H.A., Mair, N.S., Sharpe, M.E. and
Holt, J.G., Eds.), Vol. 2, pp. 1261-1434,
Williams and
Wilkins, Baltimore, MD.
[6] Goodfellow, M. (1986) Genus Rhodococcus Zopf 1891. In:
Bergey’s Manual of Systematic Bacteriology (Sneath, P.H.A.,
Mair, N.S., Sharpe, M.E. and Holt, J.G., Eds.), Vol. 2, pp.
1472-1481, Williams and Wilkins, Baltimore, MD.
[7] Kleemann, A., Leuchtenberger,
W., Hoppe, B. and Tanner,
H. (1985) Amino acids. In: Ullmans Encyclopedia of lndustrial Chemistry, 5th edn., Vol. A2, pp. 57-97, VCH publishers, Weinheim.
[8] VertZs, A.A., lnui, M., Kobayashi,
M., Kurusu, Y. and
Yukawa, H. (1994) Isolation and characterization of lS31831,
a transposable element from Corynebacterium glutumicum.
Mol. Micobiol. 11, 739-746.
[9] Bonamy, C.A.M. (1992) C. ghtamicum IS3 related insertion
element. Accession number X69104, GenBank database.
[lo] Simon, R., Priefer, U. and F’iihler, A. (1983) A broad host
range mobilization system for in vivo genetic engineering:
transposon
mutagenesis
in gram-negative
bacteria.
Bio/Technology
1, 784-794.
[ll] Hanahan, D. (1985) Techniques for transformation
of E.
coli. In: DNA Cloning (Glover, D.M., Ed.), Vol. 1, pp.
109-136. IRL press, Oxford.
[12] Schlfer, A., Tauch, A., Jgger, W., Kalinowski, J., Thierbach,
G. and Piihler, A. (1994) Small mobilizable multi-purpose
Letters 126 (1995) l-6
[13]
[14]
[15]
[16]
[17]
[18]
[19]
[20]
cloning vectors derived from the Escherichia coli plasmids
pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 14.5, 69-73.
Altenbuchner, J. and Cullum, J. (1984) DNA amplification
and an unstable arginine gene in Streptomyces liuidans 66.
Mol. Gen. Genet. 195, 134-138.
Schlfer, A., Kalinowski, J., Simon, R., Seep-Feldhaus, A.H.
and F’iihler, A. (1990) High-frequency
conjugal plasmid
transfer from gram-negative
Escherichia coli to various
gram-positive coryneform bacteria. J. Bacterial. 172, 16631666.
Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring
Harbor Laboratory, Cold Spring Harbor, NY.
Southern, E.M. (1975) Detection of specific sequences among
DNA fragments separated by gel electrophoresis.
J. Mol.
Biol. 98, 503-517.
Sanger, F., Nicklen, F. and Coulson, A.R. (1977) DNA
sequencing
with chain-terminating
inhibitors. Proc. Natl.
Acad. Sci. USA 74, 5463-5467.
Garoff, H. and Ansorge, W. (1981) Improvement of DNA
sequencing gels. Anal. Biochem. 115, 450-457.
Pearson, W.R. and Lipman, D.J. (1988) Improved tools for
biological sequence comparison. Proc. Natl. Acad. Sci. USA
85, 2444-2448.
Altschul, SF., Gish, W., Miller, W., Myers, E.W. and Lipman, D.J. (1990) Basic local alignment search tool. J. Mol.
Biol. 215, 403-410.