Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Microtubule wikipedia , lookup
Cellular differentiation wikipedia , lookup
List of types of proteins wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Genetic code wikipedia , lookup
Gene expression wikipedia , lookup
Epitranscriptome wikipedia , lookup
MOLECULAR AND CELLULAR BIOLOGY, Mar. 1988, p. 1224-1235 Vol. 8, No. 3 0270-7306/88/031224-12$02.00/0 Copyright © 1988, American Society for Microbiology Autoregulated Changes in Stability of Polyribosome-Bound 1-Tubulin mRNAs Are Specified by the First 13 Translated Nucleotides TIM J. YEN, DAVID A. GAY, JOEL S. PACHTER, AND DON W. CLEVELAND* Department of Biological Chemistry, The Johns Hopkins University School of Medicine, 725 North Wolfe Street, Baltimore, Maryland 21205 Received 16 October 1987/Accepted 15 December 1987 The expression of tubulin polypeptides in animal cells is controlled by an autoregulatory mechanism whereby increases in the tubulin subunit concentration result in rapid and specific degradation of tubulin mRNAs. We have now determined that the sequences that are necessary and sufficient to specify mouse I-tubulin mRNAs as substrates for this autoregulated instability reside within the first 13 translated nucleotides (which encode the first four 13-tubulin amino acids Met-Arg-Glu-Ile). This domain has been functionally conserved throughout evolution, inasmuch as sequences isolated from the analogous region of human, chicken, and yeast j-tubulin mRNAs also confer autoregulation. Further, for an RNA to be a substrate for regulation, not only must it carry the 13-nucleotide coding sequence, but it must also be ribosome bound and its translation must proceed 3' to codon 41. Microtubules are protein polymers which participate in a large spectrum of cellular functions, including formation of mitotic and meiotic spindles, transport of cellular components, establishment of cell shape during programmed differentiation such as neurite outgrowth and flagellar assembly, and, in concert with intermediate filaments and actin filaments, construction of the animal cell cytoskeleton. These structures are composed principally of heterodimers of a- and P-tubulin polypeptides for which (unlike most nonassembling cellular components) a rapid, dynamic equilibrium exists between the subunit and the polymeric form (21). A priori, the participation of microtubules in so many important cellular events suggests the need for a sensitive mechanism(s) for regulating the synthesis of both a and I8 tubulins. In fact, for animal cells we now know that the control of tubulin expression is exercised at two general levels. The first level is selective transcriptional activation during cell differentiation of one or more of the -6 to 7 functional genes that encode either subunit (7). The second level is establishment of the proper quantitative level of expression of the selected gene or genes. For this second regulatory aspect, beginning with the initial work of Ben Ze'ev et al. (1) and followed by subsequent efforts from this laboratory (8, 10, 11, 16, 24, 33, 35) and by Kirschner's group (5, 6), it has become clear that most animal cells rapidly and specifically depress the synthesis of both a- and P-tubulin polypeptides in response to increases in the intracellular pool of tubulin subunits. This decrease in synthesis (induced either by treatment with microtubule-destabilizing drugs such as colchicine and nocodazole or by direct microinjection of tubulin subunits) is the result of a posttranscriptional mechanism that alters the stability of cytoplasmic tubulin mRNAs after changes in the concentration of unpolymerized tubulin subunits. Most recently, we have used DNA transfection and inhibitors of protein synthesis (33) to demonstrate that only tubulin mRNAs which are attached to polyribosomes are autoregulated. * One obvious general question that remains to be answered is how tubulin RNAs are specifically targeted to be substrates for autoregulated changes in mRNA stability. By transfecting plasmid constructs which carry different regions of the chicken ,2-tubulin gene, we have previously localized a regulatory element to the 5' 106 nucleotides of exon 1 in chicken ,2 mRNA (16). In the present study, we have extended these findings to demonstrate unambiguously that sequences necessary and sufficient to confer autoregulation are contained within a 13-nucleotide segment that encodes the first four amino acids of 1B tubulin. Further, we show that for an RNA to be a substrate for regulation not only must it carry the 13-nucleotide sequence, but it must also be ribosome bound, and translation of the RNA must also proceed 3' to codon 41. MATERIALS AND METHODS Construction of hybrid genes containing amino-terminal 1-tubulin-coding sequences linked to tk. (i) MT-C16-tk. To construct the MT-C16-tk gene, we used a two-step process. A 1.8-kilobase metallothionein (MT) promoter fragment was recovered from clone pMTP,2A5' (16) by sequential digestion with EcoRI, mung bean nuclease (to create a blunt end), and HindIII. Herpes simplex virus (HSV) thymidine kinase (tk)-coding sequences were excised from plasmid pMK (3) by digestion with BgIII (which cleaves in the 5' untranslated region of tk) and EcoRI (which cleaves within the 3'-flanking sequences), gel isolation, and subcloning between the EcoRI and BamHI sites of pUC18. The tk segment was then excised with EcoRI and Hindlll, gel isolated, and cloned with the MT promoter fragment in a trimolecular ligation into pBR322 which had been digested with EcoRI and NdeI (blunted with mung bean nuclease). To obtain a restriction fragment carrying codons 1 to 16 of 132 tubulin, we again started from clone pMT132A5', a plasmid carrying a copy of the chicken 12 tubulin gene (29, 41) from which all tubulin sequences 5' to the ATG translation initiation were deleted by BAL 31 exonuclease digestion (16). By digesting the clone with HaeII (which cleaves within codon 17), treating it with mung bean nuclease to create a blunt end, and finally Corresponding author. 1224 VOL. 8, 1988 NUCLEOTIDES SPECIFYING 1-TUBULIN AUTOREGULATION digesting it with HindIlI (which cleaves 11 bases 5' to the P-tubulin ATG), we obtained a fragment carrying only the first 49 translated nucleotides of ,2 tubulin. To create MTC16-tk, this fragment was subcloned between the HindlIl and NruI sites of the MT promoter and HSV tk vector (which were cleaved within the MT 5' untranslated region [68 bases 3' to the major transcription initiation site] and at codon 97 of tk, respectively). The RNA transcript of MTC16-tk should be translated into a fusion protein consisting of 16 amino-terminal ,-tubulin residues and 278 amino acids of tk. The sequence of the P2/tk junction was verified by subcloning the relevant segment from the final plasmid into M13 followed by dideoxy sequencing (36). (ii) MT-M16-tk, MT-H18-tk, and MT-Y16-tk. Fusion genes whose RNAs encoded a fusion polypeptide consisting of 16 to 18 amino-terminal codons of fi tubulin linked to 278 amino acids of tk were constructed as follows. Mouse mP5 (26) and human H1l (encoded by gene M40; 25) tubulin sequences were obtained from mouse or human cDNA clones, subcloned into pUC9 after being isolated from Xgtll libraries (40; K. F. Sullivan and D. W. Cleveland, unpublished), and the Saccharomyces cerevisiae TUB2 sequence was derived from plasmid pJT179, which carries the unique (intronless) S. cerevisiae ,-tubulin gene (32). To remove the 5' untranslated sequences from each of these tubulin genes, we digested each plasmid with EcoRI, which cleaved each at -150 to 300 bases 5' to the translation initiation codon. Double-stranded deletions were produced by successive treatment with exonuclease III followed by mung bean nuclease digestion. The DNAs were subsequently digested with BglII, which cleaved each at a site within the tubulin coding region (between 200 and 250 nucleotides downstream of the initiating ATG), and subcloned into BamHIHincII-digested M13mpl8. The deletions were screened by DNA sequencing. Clones M13MPTUB, M13HITUB, and M13Y,BTUB (from mouse, human, and S. cerevisiae DNA, respectively) contained deletions that extended 2, 3, and 11 nucleotides, respectively, 5' to the initiating ATG. These intermediates were then used to initiate a second phase of deletions, this time involving the processive removal of tubulin-coding sequences from the 3' end. After cleavage at the unique EcoRI site located in the M13 polylinker 3' to the tubulin sequences, exonuclease III and mung bean nuclease digestion was again used to generate a set of fragments carrying random 3' deletions. The DNAs were digested at the unique Bglll site within the M13 sequences, and the collection of fragments was then ligated to a BgIII-HincII fragment of fusion vector M13-NruItk. This vector was itself constructed by ligating the 1.7-kilobase NruI-EcoRI fragment of tk (that contained the coding sequence for tk beginning at codon 97 and extending through the 3'-flanking region [Fig. 1A]) into M13mpl8 that had been digested with EcoRI and XbaI (the latter had been blunted with mung bean nuclease). M13-Nrultk was then digested with BglII (within the M13 coding sequence) and with Hincll (in the polylinker), and the 9-kilobase fragment (containing the portion of M13 complementary to that carried by the tubulin 3' deletions) was isolated and ligated to the tubulin deletions. (The strategy of using the M13 BglII site allowed the direct selection of recombinants, since the BglII-Hinclldigested fusion vector lacked an essential portion of M13 sequences which could only be provided by the fragments carrying tubulin sequences with random 3' deletions.) Plaques were randomly selected and screened by dideoxy DNA sequencing to determine the extent of 3' deletions and the precise sequence at the junction between tubulin and tk. 1225 Although the tk-coding sequences began at the desired NruI site, the actual fusion with tubulin was separated by six bases of M13 linker DNA. (Only tubulin deletions ending after the first nucleotide of a tubulin codon created in-frame fusions with the truncated tk gene.) To form the final plasmids, replicative-form DNA from appropriate M13 deletions was cleaved with EcoRI at the EcoRI site in the 3'-flanking region of tk. The DNA was blunted with Klenow, cleaved with HindIII (at the M13 linker site 5' to the tubulin-tk fusion) and ligated into plasmid DNA from pMTtk that had been digested with NdeI (at the site within the pBR322 vector), blunted with Klenow, and finally digested with HindIII (within the MT 5' untranslated region). Construction of cI2A2 and cI2A3/4. Site-directed mutagenesis was used to construct cP2A2 and cp2A3/4. A 700base-pair SmaI fragment which contained exon 1 of the authentic c,B2 gene was subcloned into M13mpl8, and recombinants were selected which had the insert oriented such that the coding strand of exon 1 was also the plus strand of the phage. OligoA2 (5'GTGCACGATCTCCATGATGCC GGT3') and oligoA3/4 (5'CTGGATGTGCACACGCATGA TGCC3') were synthesized by using a DNA synthesizer (Applied Biosystems model 380A) and purified by high-pressure liquid chromatography. Mutagenesis was performed as described previously (44) and as modified elsewhere (23). After the desired deletion was identified by DNA sequencing, the SmaI fragment from the M13 recombinant was subcloned in the correct orientation into plasmid pcP2ASma at its unique SmaI site to create pc,32A2Sma and pcp2A3/ 4Sma. pc32ASma was generated by cutting pcP2 with SmaI and religating the vector portion. Since there were three SmaI sites within c132, reintroduction of the mutagenized SmaI 700-base-pair fragment into pc32ASma did not fully regenerate an intact gene. To restore the missing 5'-flanking sequences in these last two constructs, a 1-kilobase AatII fragment which spanned the two 5'-proximal SmaI sites was isolated from authentic c,B2 and introduced into pcp32A2Sma and pcp2A3/4Sma which had been digested with AatII. The final constructs pcP2A2 and pcf32A3/4 were identical to the authentic c,32 gene, except for the presence of the corresponding deletions within exon 1. Si probes. To detect RNAs transcribed from either transfected or endogenous genes, the following DNA probes were used in S1 nuclease protection analyses. All probes were 5' end labeled with polynucleotide kinase after being digested with the appropriate restriction endonuclease and phosphatase treatment. (i) Ribosomal RNA. To analyze the level of endogenous 18S rRNA, pl8S (18), a plasmid carrying a portion of the mouse 18S rDNA gene, was linearized at the BamHI site that lies 600 bases 3' to the mature 5' border of 18S rRNA. Hence, a 600-base protected fragment was expected after hybridization to 18S rRNA and S1 nuclease digestion. (ii) Mouse j5-tubulin mRNA. To detect RNAs from the endogenous mouse m15 gene, a probe was prepared from a pUC9 subclone of m,B5 sequences isolated from a Xgtll cDNA library (40). This plasmid was linearized at the unique XhoI site that lies 355 nucleotides from the 5' border of the cloned cDNA. S1 nuclease analysis of m15 RNAs with this probe should yield a protected fragment of 355 bases. (iii) Chicken (2-tubulin mRNAs (c32, c02A2, and cp2A3/4). To detect RNAs transcribed from transfected chicken ct2, we used a probe from a cDNA clone (pT2; 9) of c,B2. Since this cDNA clone actually derives from an RNA that was initiated from a very minor cP2 transcription 1226 YEN ET AL. initiation site that lies 29 bases 5' to the major site of transcription initiation (41), it contains -24 bases of sequence 5' to the major site of initiation. After digestion and end labeling at the unique BglII site at codon 84, an Si resistant fragment of 315 nucleotides was expected for spliced cP2 RNAs that were initiated at the major transcription initiation site. For RNA with deletions at codons 2 or 3 and 4, protected fragments of 246 and 240 nucleotides, respectively, were expected after probe cleavage at the site of the deletion. (iv) MT-C-tk, MT-H-tk, MT-M-tk, and MT-Y-tk series. To detect RNAs from the chicken (MT-C-tk), human (MT-Htk), mouse (MT-M-tk), or yeast (MT-Y-tk) series of deletion constructs fused to tk, plasmid DNA from each gene was 5' end labeled at the EcoRV site in the HSV tk-coding region (49 nucleotides from the tubulin-HSV tk fusion junction). The size of the predicted fragments included 49 nucleotides of tk and linker sequences, the number of P-tubulin nucleotides, and 68 bases of MT 5' untranslated region. (v) MTtk mRNA. The MTtk gene was 5' end labeled at the NruI site (codon 97). MTtk mRNAs initiating from the MT promoter were expected to yield an S1 resistant product of 449 nucleotides. This product included 348 nucleotides of HSV tk sequence (292 nucleotides of coding sequence and 56 nucleotides of 5' untranslated leader), 33 nucleotides of M13 polylinker, and 68 nucleotides of MT 5' untranslated sequence. DNA transfections. Mouse Ltk- cells were transiently transfected by using a modified DEAE-dextran procedure as described by Lopata et al. (28). In all cases, parallel dishes of cells were transfected with 8.0 ,ug of the complete c,B2 gene or with each engineered construct. At 30 to 38 h posttransfection, duplicate dishes of transfected cells were incubated for the final 6 h of culture in normal medium (DMEM; 4,500 mg of glucose per liter, 10% fetal calf serum, 290 mg of glutamine per liter) or in the same medium containing 10 ,uM colchicine. RNA isolation. Cytoplasmic RNA was isolated by a modification by Favaloro et al. (15). Cells were washed once with 5 ml of ice-cold phosphate-buffered saline, and 300 ,ul of lysis buffer (0.14 M NaCl, 1.5 mM MgCl2, 10 mM Tris [pH 8.6], 0.5% Nonidet P-40, 10 mM vanadyl-ribonucleoside complexes) was added to the monolayer of cells. Cells were scraped with a rubber policeman and transferred to 1.5-ml Microfuge tubes prechilled to 4°C. Lysis was achieved by gentle vortexing for 10 s, and the cell extract was centrifuged for 4 min in a Microfuge at 4°C to remove nuclei. The supernatant was removed and diluted with an equal volume of 2x proteinase K buffer (0.2 M Tris hydrochloride [pH 7.5], 25 mM EDTA, 0.3 M NaCl, 2% sodium dodecyl sulfate). Proteinase K was added to 400 ,ug/ml, and the cell lysate was incubated at 37°C for 30 min. After this time, the lysate was phenol-chloroform extracted, chloroform extracted, and then precipitated with 1/10 volume of 3M sodium acetate (pH 5.2), and 2.5 volumes of ethanol. The resulting RNA pellet was suspended in diethylpyrocarbonate-treated water, quantitated by A260, and stored frozen at -800C. Si nuclease analysis. An excess of double-stranded DNA probe (0.02 pmol) was mixed with 2.5 ,ug of cytoplasmic RNA (to measure 18S rRNA, only 0.25 ng was used), lyophilized to dryness, and suspended in 20 ,lI of a solution containing 80% formamide, 0.4 M NaCl, 40 mM PIPES [piperazine-N,N'-bis(2-ethanesulfonic acid)] (pH 6.4), and 1 mM EDTA. After being heated to 90°C for 5 min, the hybridization reactions were incubated for 12 to 16 h at MOL. CELL. BIOL. either 61°C (for pl8S-5', pmP5, and chicken P2 gene) or 59°C (for cp2A2m, cp2A3/4, MTtk, and MT-Y-tk, MT-C-tk, MTH-tk, and MT-M-tk plasmids), diluted 10-fold by addition to ice-cold S1 nuclease buffer (0.2 M NaCl, 30 mM sodium acetate [pH 4.5], 5 mM ZnC12, 50 ,ug of denatured salmon sperm DNA per ml), and incubated in the presence of 120 U of S1 nuclease (Bethesda Research Laboratories, Inc., Gaithersburg, Md.) at 23°C for 70 min. Sl-resistant probe fragments were resolved on 9 M urea-6% polyacrylamide gels and visualized by autoradiography. Quantification of gel autoradiographs. Autoradiographs were quantified with a Zeineh soft-laser densitometer (model SLR-504-XO; Biomed Instrument Co., Inc., Fullerton, Calif.). Analysis of polysome distributions. Single 100-mm-diameter dishes of transfected L cells, at just-subconfluent density, were used for analysis of polysome distributions. Polysome profiles were obtained by the method of Geyer et al. (17). Each 100-mm-diameter dish of cells was washed two times with 5 ml of ice-cold phosphate-buffered saline, then lysed by the addition of 200 RI of polysome lysis buffer (10 mM Tris [pH 8.4], 10 mM NaCl, 3 mM MgCl2, 0.5% [wt/vol] Nonidet P-40). The lysates were transferred to 1.5-ml Eppendorf tubes and vortexed for 10 s. Nuclei were pelleted, and the resulting supematants were layered on 15 to 40% (wt/vol) sucrose gradients in polysome gradient buffer (10 mM Tris [pH 8.4], 10 mM NaCl, 1.5 mM MgCl2). Gradients were centrifuged at 32,500 rpm for 2 h at 4°C in a rotor (SW41; Beckman Instruments, Inc.). Gradient fractions were collected with a density gradient fractionator (model 185; ISCO, Inc., Lincoln, Nebr.) connected to a type 6 optical unit and a UA5 absorbance monitor. A total of 36 fractions of -0.4 ml each were collected in 1.5-ml Eppendorf tubes containing 80 ,ud of 5 x proteinase K buffer (final concentration, 200 p,g of proteinase K per ml). After all fractions were collected, they were placed at 37°C for 1 h, phenol-chloroform extracted, and then ethanol precipitated. RNA from three consecutive fractions was pooled in a final volume of 21 ,ud of diethylpyrocarbonate-treated water and stored at -80°C. RESULTS Sufficiency of 1-tubulin codons 1 to 16 to confer j8-tubulin autoregulation onto a chimeric mRNA. We have previously shown (16) that insertion of a 106-base-pair segment of exon 1 of the chicken 132 tubulin gene (57 bases of 5'-untranslatedregion sequence and 49 coding nucleotides) into a chimeric gene composed of the mouse MT I promoter and an HSV tk gene body is sufficient to bring the resultant mRNA under tubulin autoregulatory control. Further, since the complete B2 5' untranslated region could be deleted from the authentic gene without disrupting regulation, we predicted that the regulatory domain must reside within the coding portion of exon 1. To confirm this prediction, we constructed a chimeric gene (MT-C16-tk) in which only the first 49 translated nucleotides (encoding amino acids 1 to 16) from the chicken 132 tubulin gene were fused in the proper translational reading frame to the HSV tk gene (Fig. 1A). Transcription of this fusion gene was driven by the mouse MT promoter segment (which also provided a 68-base 5' untranslated region). Translation of the RNA transcribed from MT-C16-tk should produce a fusion protein, the first 16 amino acids of which are 1 tubulin and the remaining 278 amino acids of which are tk (the first AG initiation codon was the 1-tubulin AG). NUCLEOTIDES SPECIFYING 13-TUBULIN AUTOREGULATION VOL. 8, 1988 ARI TGA ATG HaeI 1227 Rl CB2 H3 RlI t A-G N'ut, i+-4S- + --1 M3 ATO HaeINl N®e/RI N + + _i PI N de GA - UI n MTtk R .GA H SV-:_'xe MT C16tk 18S M55 C16 18S M%35 Cp2 18S MP5 MTtk B-- m -+ - --I+-+-+ 622- - - -+-+ __ - 527- -_- 404- - M-+-+ + m 9 309- 242- 217- 201- 1 2 3 4 9 10 11 12 13 1415 1617 18 19 FIG. 1. Sufficiency of 16 amino-terminal codons of chicken ,2 tubulin to confer tubulin autoregulation. (A) Schematic representation of the cP2 gene (CP2) and hybrid genes MTtk and MT-C16-tk, (MTC16tk). Symbols: , pBR322 sequences; -,,c2 or tk 5'-flanking, , exon sequences corresponding to 5' and 3'-flanking, or intron sequences; I=, exon (Ex) sequences corresponding to coding regions; 3' untranslated regions; _, MT promoter, 5'-flanking and 5' untranslated sequences. RI, EcoRI site; H3, HindIII site; ATG, ATG translation initiation codon; TGA, translation termination codon. (B) Mouse Ltk- cells transfected with cP2 (lanes 1 to 6), MTtk (lanes 7 to 12), or MT-C16-tk (lanes 14 to 19). Equal amounts of cytoplasmic RNA from control (lanes marked -) or colchicine-treated (lanes marked +) cells were analyzed by S1 nuclease for 18S rRNA (18 S; lanes 1, 2, 7, 8, 14, and 15), mP5 mRNA (M,B5; lanes 3, 4, 9, 10, 16, and 17), c52 mRNAs (C12; lanes 5 and 6), MTtk (lanes 11 and 12), or MT-C16-tk (C16; lanes 18 and 19). Nucleotide size markers (in bases, lane 13) are shown at the left. Arrows mark expected positions for fragments protected by cP2 and MT-C16-tk RNAs. 5 6 7 8 MT-C16-tk, MTtk (a control MT-tk gene that did not contain any tubulin sequences but did retain the tk translation initiation codon), and the authentic c,2 tubulin gene (Fig. 1A) were each transfected into duplicate dishes of mouse L cells. S1 nuclease analysis was used to measure the level of each transcript in RNA from control cells and from cells to which colchicine had been added to induce microtu- bule depolymerization and elevate the concentration of unpolymerized tubulin subunits. Figure 1B shows the results of S1 protection assays used to determine the levels of endogenous mouse mP5 3-tubulin mRNA and the mRNAs from the transfected genes. As previously reported (16), RNAs from the authentic c32 gene were destabilized after the elevation of the unpolymerized tubulin subunit content 1228 MOL. CELL. BIOL. YEN ET AL. A RI H 4 - 3 TGA ATG -. t - S V -t ~~~~~H k _ Asr G Ie G:y Ala Met Arg GM Hte Cal MIis Gle 1 Ala Gv : Hl18 ATG AGC *AA C -G GAC A GC,CAG CC +C-7CtjG CCr7rr,CC .MC GAG- AC 'GMT CGCC A 1116 AT AM GA.A AC G C16 A.G . C.-AG, AC M7 D: CC C--C M CAC AC GAG -CC.CA GM. GA AC GA G CC C C-C iA: Y16 ACI AGA A.A AC AC- CAT ATC CCC GCA C-CC Ser .Lie MB5 622527- B C -A.-: 7,-:r GAG AC- C _ r CA . AACC- GAA A7 7, 18S ..4011im. M16 Awa-1w- -217 -201 404- -190 U.mw 622- 527- -180 4iW_i .H18 -217 -201 404- -190 .* ..180 :- -180 622-D 527- __Y16 -217 -201 (Fig. 1B, lanes 5 and 6), as were m,5 RNAs (Fig. 1B, lanes 3 and 4). Transfection of MTtk yielded RNA transcripts that were completely insensitive to tubulin subunit concentration (Fig. 1B, lanes 11 and 12). Incorporation of the first 16 codons of P tubulin as the first translated nucleotides of a chimeric tk gene, however, yielded an RNA whose stability was sensitive to the level of free tubulin subunits (Fig. 1B, lanes 18 and 19). (The faint larger species seen in these lanes correspond to minor transcriptional initiation sites that were also evident in all RNAs expressed from the MT promoter.) Quantitation of these results by densitometry confirmed these qualitative impressions and revealed a 6.5-fold lower level of MT-C16-tk RNAs in colchicine-treated cells (compared with a 9-fold loss of the RNAs encoding endogenous mP5 tubulin). (In all cases, 18S rRNA levels were constant [Fig. 1B, lanes 1, 2, 7, 8, 14, and 15], thereby insuring that we had analyzed comparable amounts of RNA from control and colchicine-treated cells.) We conclude that a sequence that identifies the cP2 mRNA as a substrate for autoregulated changes in stability resides within the first 16 translated codons. 1-tubulin autoregulatory signal is functionally conserved during evolution. Since tubulin gene sequences are evolutionarily conserved (-65% nucleotide identity between human and yeast P tubulins; 12) and since tubulin autoregulation has been documented in a wide variety of species (see Discussion in reference 33), we next tested whether sequences isolated from the amino-terminal-coding domain of other P-tubulin genes also confer tubulin autoregulatory properties when linked to nontubulin genes. For this, we prepared hybrid genes analogous to MT-C16-tk but in which the chicken tubulin sequence for codons 1 to 16 was substituted with codons 1 to 16 of the mouse mP5 gene, codons 1 to 18 of the human hp1 gene, or codons 1 to 16 of the S. cerevisiae TUB2 P-tubulin gene (Fig. 2A). Each of the hybrid genes was transfected into L cells, and the accumulated levels of transcripts were assayed by Si nuclease analysis in RNA from control cells and from cells to which colchicine had been added to elevate the level of free tubulin subunits. Insertion of the mouse sequences (Fig. 2B), human sequences (Fig. 2C), or yeast sequences (Fig. 2D) conferred autoregulation onto an otherwise unregulated tk mRNA. Moreover, addition of the amino-terminal segment from each species had approximately the same quantitative effect (6.5- to 8-fold). Autoregulation of P-tubulin mRNAs is specified by as few as 13 nucleotides which encode the NH2-terminal four amino acids. Inspection of the nucleotide and amino acid sequences of the amino-terminal-coding sequences of hpl, mP5, cP2, and yeast TUB2 genes (Fig. 2A) reveals a high degree of sequence identity. At the nucleotide level, 32 of the 48 bases 404- -190 the 16 amino-terminal codons of the mouse -180 FIG. 2. Functional conservation of sequences sufficient to confer P-tubulin autoregulation. (A) Schematic representation of hybrid genes consisting of an MT promoter and 5' untranslated region, 16 to 18 codons for the amino terminus of ( tubulin, and 278 codons of tk plus the tk 3'-flanking region. See the legend to Fig. 1 for explanation of symbols. Below the gene are shown the nucleotide and corresponding amino acid sequences for the j-tubulin portions. H18, MT-H18-tk, a hybrid gene containing 18 codons of the human hpl gene; M16, MT-M16-tk, a hybrid gene containing mP5 gene; C16, MT- C16-tk, a hybrid gene which contains 16 codons of the chicken cP2 gene; Y16, MT-Y16-tk, a hybrid gene containing 16 codons of the S. cerevisiae (-tubulin gene. (B to D) Mouse Ltk- cells transfected with hybrid genes MT-M16-tk (B), MT-H18-tk (C), or MT-Y16-tk (D). Equal amounts of cytoplasmic RNA from control (lanes marked -) and colchicine-treated (lanes marked +) cells were analyzed by S1 nuclease methods for endogenous m,B5 mRNAs (Mf5), 18S rRNA, (18S), and MT-M16-tk, MT-H18-tk, or MT-Y16-tk RNAs. In each panel, an arrow marks the nuclease-resistant fragment corresponding to RNAs initiated at the major MT transcription initiation site. Nucleotide size markers (in bases) are shown at either side. NUCLEOTIDES SPECIFYING j-TUBULIN AUTOREGULATION VOL. 8, 1988 TGA H3 ATG ARI - Me- Arg 116 ATG AGG M12 ATG AGG N9 ATG AGG N5 ATG AGG YS ATG AGA M4 ATG AGO N2 ATG AGO 18S H SSV-tk RilNde I L Giu Ile Val His le Gin Aia Giy Gin Gys Giy An Gin Ie GAA ATC GTG CAC ATC CAG GCGC GGA CAG TGT GGC MC CAG ATC GM ATC GTG CAC ATC GAG GCC WGA CAG TOT G GM GAA GMA GAA G ATC ATC ATC ATC 1229 G GTG CAC ATG CAG GCC G GTG C ATT C G 1BS MB5 MB5 M12 622- r-1 527- M9 - -201 -190 _ -180 -190 -180 404- ; B -160 C -160 -ft 2X4 Y5 M5 -180 -160 -160 -i47 D - E a--180 M4A M4 _ W -147 _ M2 -160 -147 -147 as .- F G -123 FIG. 3. Determination of the minimal sequence that can confer j-tubulin autoregulation. (A) Schematic representation of hybrid genes corisisting of an MT promoter and 5' untranslated region, 2 to 16 codons of the amino-terminal-coding sequences for mP5 or yeast p tubulin linked in the proper translational reading frame to 278 codons of tk, and the tk 3'-flanking region. See the legend to Fig. 1 for explanation of symbols. Below the gene are shown the nucleotide sequences for the P-tubulin portions contained within genes MT-M16-tk (M16), MT-M12-tk (M12), MT-M9-tk (M9), MT-M5-tk (M5), MT-Y5-tk (Y5), MT-M4-tk (M4), and MT-M2-tk (M2). (B to G) Mouse Ltk- cells transfected with hybrid genes. Equal amounts of cytoplasmic RNA from control (lanes marked -) and colchicine-treated (lanes marked +) cells were analyzed by S1 nuclease methods for endogenous mP5 mRNAs (M,5) and 18S rRNA (18S) and MT-M12-tk (B), MT-M9-tk (C), MT-M5-tk (D), MT-Y5-tk (E), MT-M4-tk (F), or MT-M2-tk (G) RNAs. In each panel, an arrow marks the nuclease-resistant fragment corresponding to RNAs initiated at the major MT transcription initiation site. Nucleotide size markers (in bases) are shown at either side (positions of markers for 622, 527, and 404 bases are denoted by dashes to the left of panels C to G). encoding residues 1 to 16 are conserved throughout all four genes. At the amino acid level, the encoded polypeptides are identical among the vertebrates and only 3 substitutions appear within the first 16 codons of the yeast sequence. To determine more precisely which of these sequences was sufficient to confer p-tubulin autoregulation, a series of chimeric MT-tubulin-tk genes was constructed which contained the same MT and tk segments but which carried between 16 and 2 P-tubulin codons at the amino terminus (see Materials and Methods for details). Appropriate deletions were ligated in the proper translation reading frame to produce a fusion protein composed of a few amino-terminal amino acids of f tubulin followed by the majority of the sequences for tk. Figure 3A shows the sequences contained in several fusion genes carrying m,5 sequences and one containing yeast ,-tubulin sequences. Each of these genes was transfected and tested for whether its RNA transcripts were still subject to P-tubulin autoregulation. When unpolymerized tubulin subunit levels were elevated with colchicine, RNAs transcribed from genes containing only 12 or 9 m[5 codons (MT-M12-tk or MT-M9-tk, respectively) were destabilized as if they were authentic 1-tubulin mRNAs (Fig. 3B and C). (The heterogeneity in size of MT-M9-tk-protected fragments 1230 MOL. CELL. BIOL. YEN ET AL. A.-:, m! RI -;A 13_C)1 C C62 Met A-, Glu C1e Val His 7-e Gln Ala Gly Gln Cys Gly Asn Gln Ile Gly Ala Lys A.( TG :C Ci;;: A C"v-"'3V. GA .;-C C.C rAA C CkG GCC GC CAG ILIh;AC A. , J~u -,'.7G GCAG TGCG - A CGAG GC MAG GGC G.C GAG GGC GGC AACGAAC ATC GCr GGCGGOGGG GAGC GGGCTG - Gr AIG GCC GC;6 GCAG T GG0CC AAC AG ATC GGC GCT AAG C.__ 2O A-7CGO C;-A 2 C f3 18S MB5 CB2 -+ _-+-_+ -404 622- _ 527- -309 B 18S Ml35 _2 18S 622---_ 622- 527- M1n5+ 3,4 + -404 -404 - 527- C -309 -242 _ D - _- .....-309 -. -242 FIG. 4. Deletion of codon 2 or codons 3 and 4 disrupts autoregulation of RNAs from the cP2 tubulin gene. (A) Schematic diagram of genes cP2A2 or cp2A3/4 for which site-directed mutagenesis was used to delete c,B2 codon 2 or condons 3 and 4, respectively. See the legend to Fig. 1 for explanation of symbols. (B to D) Mouse Ltk- cells transfected with c132 (B), c(32A2 (A2) (C), or c32A3/4 (A3/4) (D). Equal amounts of cytoplasmic RNA from control (lanes marked -) and colchicine-treated (lanes marked +) cells were analyzed by S1 nuclease methods for endogenous m,B5 mRNAs (M,5), 18S rRNA (18S), and the RNA from the transfected gene. Arrows mark the nuclease-resistant fragments. Nucleotide size markers (in bases) are shown at either side. was probably due to incomplete S1 digestion.) Genes containing only five mouse (MT-M5-tk) or yeast (MT-Y5-tk) ,B-tubulin codons were also regulated by the concentration of tubulin subunits (Fig. 3D and E). Even a construct (MT-M4tk) with only the first four m15 codons was still regulated efficiently (Fig. 3F), a qualitative result confirmed by densitometry. However, insertion of only two codons in front of tk (MT-M2-tk) yielded RNAs that, like MTtk alone, were insensitive to the tubulin subunit level (Fig. 3G). (In several efforts, we failed to obtain a construct with only three ,B-tubulin codons.) Nucleotides encoding amino acids 1 to 4 of ,B tubulin essential for tubulin autoregulation. Although the 13 nucleotides which encode the first four amino acids of 1 tubulin are sufficient to confer autoregulation onto heterologous mRNAs, it remained possible that multiple, redundant regulatory domains were present in an authentic gene. To determine whether the codons for residues 1 to 4 were necessary and sufficient to specify autoregulation, codon 2 or codons 3 and 4 were deleted from the authentic cP2 gene by site-directed mutagenesis. The resultant genes (cp2A2 and c32A3/4; Fig. 4A) were transfected into L cells to test whether RNAs from these genes were still substrates for autoregulation. (The translation reading frame was unchanged in these deletions, so that except for the absence of amino acid 2 or amino acids 3 and 4, an authentic 13-tubulin polypeptide would be translated.) Although RNAs from transfections of the authentic cP2 gene yielded autoregulated instability as expected, the absence of only codon 2 or codons 3 and 4 resulted in complete insensitivity to autoregulation (Fig. 4B to D). (Since the Si probe used was from the unmutated cP2 gene, two fragments were detected in analyses of RNAs from cp2A2 and c232A3/4. One fragment corresponded to S1 cleavage at the site of the deletion, whereas the larger fragment [representing probe protection to the normal cP2 transcription initiation site] was due to incomplete S1 digestion at the site of the deletion.) Since these deletions disrupted autoregulation, we conclude that the sequences within the first 13 translated nucleotides of (3 tubulin that are sufficient to confer autoregulation are also necessary for specifying an RNA as a substrate for autoregulation. RNAs carrying the 13-nucleotide sequence must be translated beyond codon 41 to be substrates for autoregulation. Previously, we have shown that insertion of a premature translation termination codon at position 27 of the authentic human tubulin gene M40 results in disruption of autoregulation (33). Further, inhibitors of protein synthesis that disrupt NUCLEOTIDES SPECIFYING VOL. 8, 1988 ARI H3 ATG + TGA + _t_H_S V- tk N 0-TUBULIN AUTOREGULATION 1231 RI/Nde V t"11 1 M16 in-frame Eaa -tbulir. .t1G c8,. : ' >:_. 3 0 G-A i CrcCG c -- % Total 296.. 817 out-of-frame + 17 aa -:rub.-a..i..i XM ATS (N;f 5 x-CC GAC -CT CGSA - . H-.S't k GA- - - Totasl 41as Y16 out-of-frame Ml3 lSaa rTuIir.n .rcG NN )t, 4 S :9s7.tk * AC: C rcA --A. - To'otel 31aa H18 out-of-frame 'iaa Tubtlir. t MI3 ccA .rc .1146 or C-"C CC 18S ii S.t kS CGA Total 33aa 18S M17out MB5 d+ 622- e _- MB5 + Y16out -+ +- - 527-217 0 404- -217 - -201 -201 -190 B 180 18S MB5 -190 C -180 H180ut n -217 Alr -201 -190 -180 D FIG. 5. Out-of-frame MT-tubulin-tk fusions whose RNAs encode truncated polypeptides are not substrates for tubulin autoregulation. (A) Schematic diagram of MT-tubulin-tk genes in which the fusion between p-tubulin and tk coding sequences places the tk codons in either of the two inappropriate translation reading frames. See the legend to Fig. 1 for explanation of symbols. aa, Amino acid. (B to D) Mouse Ltkcells transfected with MT-M17OUt-tk (M17,0ut; B), MT-Y160ut-tk (Y160ut; C), or MT-Hl80ut-tk (Hl80.u; D). Equal amounts of cytoplasmic RNA from control (lanes marked -) and colchicine-treated (lanes marked +) cells were analyzed by S1 nuclease methods for endogenous mP5 mRNAs (M35), 18S rRNA (18S), and the RNA from the transfected gene. In each panel, an arrow marks the nuclease-resistant fragment corresponding to RNAs initiated at the major MT transcription initiation site. Nucleotide size markers (in bases) are shown at either side. The positions of markers for 622, 527, and 404 bases are indicated by dashes to the left of panels C and D. polyribosomes unlinked tubulin RNA levels from the level of free subunits, whereas a protein synthesis inhibitor (cycloheximide) that freezes mRNAs onto polyribosomes enhanced autoregulated tubulin RNA instability. Together, these findings led us to propose that only RNAs that are attached to polyribosomes are substrates for autoregulation. If this is correct, then insertion of the amino-terminal codons of P tubulin in front of tk should yield autoregulated RNAs only when the tubulin and tk sequences are linked to produce a long, open translation reading frame that allows many ribosomes to be attached simultaneously to a single RNA. In screening the MT-H-tk, MT-M-tk, and MT-Y-tk deletion series (Fig. 2 and 3), we obtained numerous constructs containing various numbers of tubulin codons that 1232 YEN ET AL. MOL. CELL. BIOL. . e *m12^t m__ .m35 - i u .-rnl2jt,, CHX- CLC- + + + - + 18S C 18S M135 M152out we" M12 O M12out M12 s 1 2 3 4 FIG. 6. RNAs from out-of-frame MT-tubulin-tk genes were effi- were linked to either of the two incorrect translational reading frames of tk. Since in either of these inappropriate tk frames translation termination codons are found 13 or 22 amino acids into the tk sequences, these MT-tubulin-tk fusion genes can only encode truncated polypeptides. Three such out-of-frame constructs that contained 16 to 18 codons of human, mouse, or yeast 1 tubulin are diagrammed in Fig. 5A. The mouse construct (MT-M17OUt-tk) contained precisely the same sequences as MT-M16-tk (Fig. 2), except that it possessed two additional tubulin nucleotides. The translation product consisted of 17 amino acids of 1B tubulin, 2 amino acids encoded by linker sequences, and 22 amino acids produced from one of the two wrong reading frames of tk. The human or yeast construct (MT-H18Out-tk or MTY160ut-tk, respectively) yielded a polypeptide composed of 18 or 16 residues of 1B tubulin, respectively, 2 linker amino acids, and 13 residues translated from the other incorrect tk frame. When these out-of-frame constructs were transfected and tested for autoregulation, the stabilities of all encoded RNAs were independent of the free tubulin concentration (Fig. 5B to D), despite the fact that RNAs from the corresponding in-frame fusions were autoregulated (Fig. 2B to D). Thus, RNAs that contain the identifier sequences are not substrates for autoregulation when their translation terminates before codon 42. RNAs from out-of-frame MT-tubulin-tk genes fail to autoregulate not because of failure to be translated. Since none of the RNAs transcribed from the out-of-frame MT-tubulin-tk genes were autoregulated even though they encoded polypeptides of up to 41 amino acids, the most likely interpretation was that translation must proceed 3' to codon 41 for autoregulation to occur. However, it was also possible that the out-of-frame RNAs failed to regulate because they were not translated efficiently (and thus were not present at the site at which autoregulation takes place). To test this hypothesis, we analyzed polysome profiles of RNAs from cells transfected with MT-M12,Ut-tk, both before and after a colchicine-induced increase in the free tubulin subunit concentration (Fig. 6A). When each gradient fraction was analyzed for MT-M12OUt-tk RNA or for the endogenous mouse m15 RNA, most of the out-of-frame MT-M12out-tk RNA cosedimented with di- and trisomes. Since a ribosome apparently spans -15 to 20 codons (34), this is the position predicted for an mRNA that efficiently attached to ribosomes but contained only 36 codons. A parallel analysis was also performed on RNA from cells transfected with the analogous in-frame MT-M12-tk gene (Fig. 6B). Like m,B5 RNAs, MT-M12-tk RNAs were found in the heavy polysome fractions, and these polyribosomal MT-M12-tk RNAs were degraded in cells with elevated free tubulin subunit concentrations (Fig. 6A and B, rows marked +). No corresponding loss of polysomal MT-M12ou,-tk RNAs was observable after ciently translated but were not substrates for autoregulation even when ribosomal dwell time was increased with cycloheximide. (A) Polysome profiles generated from lysates ofjust-subconfluent dishes of L cells transfected with MT-M12OUt-tk, with or without colchicine treatment to elevate the concentration of free subunits. The profile shown is from cells not treated with colchicine (although the two profiles were essentially indistinguishable; 33). The direction of sedimentation (big arrows) is left (top of gradient) to right (bottom of gradient). The small arrows mark the positions of the 40S, 60S, and 80S (monosome) ribosomal subunits. The positions of disome (2'), trisome (3'), etc. are marked with numbers. Arrowheads (V) delineate the portions of both gradients from which fractions were collected. The rows beneath the profile show Si analysis of RNA recovered from profile fractions. m12,ut, RNAs from MT-M12OUt-tk; mP5, RNAs from mP5; -, RNA from control cells; +, RNA from colchicine-treated cells. (B) Results of an experiment analogous to that described in the legend to panel A, except that cells were transfected with the in-frame gene MT-M12-tk. m12j., RNA from MT-M12-tk. (C) Four parallel dishes of L cells transfected with MT-M12OUt-tk or MT-M12-tk. At 4 h before harvest, no drug, colchicine (CLC), cycloheximide (CHX), or colchicine plus cycloheximide was added (to 10 ,uM for colchicine and to 5 ,uM for cycloheximide). Cytoplasmic RNA was prepared and analyzed by S1 nuclease for 18S rRNA (18S), endogenous mP5 RNAs (M15), and MT-M12OUt-tk (M12Out) or MT-M12-tk RNAs (M12). -, Absence of drug; +, presence of drug. VOL. 8, 1988 NUCLEOTIDES SPECIFYING P-TUBULIN AUTOREGULATION treatment with colchicine. We conclude that MT-M12out-tk RNAs are efficient substrates for translation, despite their inability to autoregulate. Failure of RNAs from out-of-frame MT-tubulin-tk genes to autoregulate not due to diminished dwell time while attached to ribosomes. One obvious difference between substrate (in-frame) RNAs and nonsubstrate (out-of-frame) RNAs is the time that a ribosome remains attached to an individual RNA. Since the initial RNA degradation step occurs preferentially on ribosome-bound RNAs (33; see also above), a possible explanation for the failure of out-of frame RNAs to autoregulate is a kinetic one: ribosomes may elongate and release faster than the recognition-cleavage step. We tested this by treating cells transfected with MT-Ml20ut-tk with cycloheximide, an inhibitor that blocks translation elongation but does not affect translation initiation (39). Cycloheximide thus traps mRNAs onto ribosomes and drives almost all ribosomal subunits into polyribosomes (14, 20, 33). Moreover, as might be anticipated, cycloheximide enhances tubulin autoregulation in L cells for either endogenous mP5 RNAs or in-frame MT-tubulin-tk fusion genes even in the absence of complete microtubule depolymerization (Fig. 6C, compare lanes 1 and 3). Nonetheless, the very significant increase in ribosome dwell time induced by cycloheximide failed to restore autoregulation to MT-M120Ut-tk RNAs. DISCUSSION We have now identified the first 13 translated nucleotides as the sequences necessary and sufficient to specify a ribosome-bound mRNA as a substrate for P-tubulin autoregulation. From earlier observations with protein synthesis inhibitors, we concluded that the primary substrates for regulated mRNA instability were polyribosome-bound RNAs (33). We have now found that chimeric RNAs that encode truncated translation products are not substrates for autoregulation. Although precisely how much farther translation must proceed to restore autoregulation remains to be elucidated, RNAs subject to autoregulation must be translated somewhere beyond codon 41. Polysome profiles and the use of cycloheximide to slow translocation of ribosomes have shown that the failure of out-of-frame RNAs to regulate is not simply due to inefficient association with polysomes nor to the shorter time an inRNA is associated with any one ribosome. Consideration of all of these data suggests two models for the novel mechanism that establishes the regulated instability of polyribosome-bound P-tubulin RNAs. The first possibility is that the recognition event that marks an RNA as a substrate is the nucleotide sequence of the RNA itself. As the level of unpolymerized subunits is increased, the tubulin subunits bind (directly or indirectly) to the amino-terminalcoding sequences of a translating 1-tubulin RNA. Since the ribosome may cover -50 nucleotides of the mRNA (34), presumably the RNA recognition sequence would be accessible for binding only immediately after it emerges from the ribosome (and before it reinitiates on a second ribosome). The binding event must induce a change in the conformation of the tubulin mRNA which makes it a more efficient substrate for a preexisting ribonuclease (e.g., by inhibiting its refolding into a native ribonucleoprotein). A problem with this model is that it is not obvious how subunit binding to the RNA could be enhanced on mRNAs saturated with cycloheximide-stalled polyribosomes. The alternative model exploits the observation that the recognition sequence encodes a four-residue, amino-ter- 1233 minal polypeptide. Since a- and 1-tubulin subunits interact with each other (Kd = 10-8; 13), the true recognition event could be a protein-protein interaction in which free subunits interact with the nascent tubulin polypeptide immediately as it emerges from the large ribosomal subunit. The proteinprotein binding event would then stimulate tubulin mRNA degradation, either by activation of a ribosome-associated nuclease or by induction of transient ribosome stalling that leaves tubulin RNAs in a more exposed conformation. Precisely how a protein-protein binding event could be transduced through a ribosome to yield RNA cleavage is not clear, although strong precedent for protein-protein binding inducing ribosome stalling is provided by the proposed role of a signal recognition particle in the translation of secreted proteins (42). This peptide recognition model can easily account for the finding that only mRNAs attached to ribosomes are substrates for autoregulated RNA instability. Obviously, linkage of enhanced tubulin RNA instability to subunit binding of the newly made polypeptide can only be achieved while the mRNA and polypeptide are physically linked, i.e., while both are still held on the ribosome. Further, since 30 to 40 amino acids of the newly translated polypeptide are covered by the large ribosomal subunit (43), this model can also easily explain why RNAs that yield truncated translation products are not substrates for autoregulation. In these cases, RNA release from the ribosome precedes the emergence of the 3-tubulin amino-terminal peptide. Although we have not proven which of these two alternatives is correct, several considerations make the second model more attractive. First, the encoded polypeptide (MetArg-Glu-Ile) is absolutely conserved among all Pi tubulins sequenced to date, whereas a significant number of base substitutions within the 13-nucleotide recognition domain have been tolerated during evolution for example, see Fig. 2A. Moreover, a search of the Los Alamos DNA sequence library revealed that the RNA sequence most conserved evolutionarily (AUG NGN GAG/A AUC G/A) is not unique to 3-tubulin RNAs, although a similar search of the protein sequence data base revealed that Met-Arg-Glu-Ile is found exclusively in 13 tubulin. Even with the possibility that the true minimal sequence may be only Met-Arg-Glu (we were unsuccessful in isolating a fusion construct that carried only the first three 3-tubulin codons), our search of the protein library revealed that while several known proteins carry this sequence internally, only tubulins (both 13 and a) have it at their amino termini. In any event, future site-directed mutants in which the recognition sequences have been frameshifted into an untranslated reading frame will be needed to unambiguously distinguish between these two models. The identification of the sequence that specifies 3-tubulin mRNAs as substrates for autoregulated instability further highlights the unanswered question of the functional end to which autoregulation is utilized. The recognition that autoregulation has been widely conserved during speciation (see Discussion in reference 33) strongly suggests that it serves an important functional role. At first glance, autoregulation appears to be largely redundant, since the polymerization reaction in vitro is self buffering: subunits continue to assemble until the pool of subunits is depleted to the critical concentration at which free subunits are at steady state with polymer. However, Mitchison and Kirschner (T. J. Mitchison and M. W. Kirschner, Cell Biophys., in press) have recently demonstrated that the concept of a unique critical concentration for a microtubule array in a closed system (i.e., in a cell with a fixed amount of tubulin and whose 1234 MOL. CELL. BIOL. YEN ET AL. microtubules are nucleated from specific centrosomal sites) is not meaningful. Rather, microtubules can polymerize at almost any subunit concentration provided that nucleation is sufficiently rapid. In light of this, the number and stability of nucleated microtubules depend on two factors: nucleation capacity and subunit concentration. Thus, as we initially proposed (33), autoregulation of tubulin synthesis may represent the cellular mechanism that establishes a level of unpolymerized subunits necessary to ensure a nucleated array of dynamic microtubules. Finally, in addition to the present example of ,B tubulin, the expression of an increasing number of eucaryotic genes has now been identified to be regulated at least in part by RNA stability. For example, a series of lymphokine, cytokine, and proto-oncogene mRNAs contain within their 3' untranslated regions a 50-base AU-rich sequence that destabilizes the RNA (37). Similarly, histone mRNAs carry specific sequences in their 3' untranslated regions that confer cell cycle-dependent RNA stability (4, 19). Moreover, the pathways that establish RNA stability for all of these examples are similar insofar as RNA instability appears to require active translation (e.g., for RNAs encoding c-myc [27], c-fos [22, 30, 31], and histones [2, 19, 38]). However, unlike the case for tubulin in which cycloheximide-induced ribosome stalling enhances mRNA instability (33), the instability of these other RNAs appears obligatorily linked to ongoing protein synthesis. For these RNAs, translational arrest with cycloheximide results in increased stability of the corresponding RNAs, a feature that has led to the suggestion that mRNA degradation is coupled to the completion of translation (27). In this regard, it has been shown that histone mRNA degradation not only requires the presence of histone mRNAs on polysomes (2) but, in addition, that translation proceeds close to the 3' of the mRNA (19). Despite differences in detailed mechanisms, the present examples of regulated mRNA instability leads us to propose the existence of a common motif in which RNA degradation is integrally linked to ribosome attachment and translation. In light of this, we would also offer the appealing suggestion that the RNase(s) that affects the cleavages may actually be localized to actively translating ribosomes (and perhaps is a peripheral subunit thereof). ACKNOWLEDGMENTS T.J.Y. and J.S.P. have been supported by postdoctoral fellowships from the American Cancer Society and the National Institutes of Health (NIH), respectively. D.A.G. has been supported by an NIH predoctoral training grant. This work has been supported by a grant from the NIH to D.W.C., who is also the recipient of an NIH research career development award. LITERATURE CITED 1. Ben-Ze'ev, A., S. R. Farmer, and S. Penman. 1979. Mechanisms of regulating tubulin synthesis in cultured mammalian cells. Cell 17:319-325. 2. Bird, R. C., F. A. Jacobs, and B. H. Sells. 1986. Stability of histone mRNAs is related to their location on polysomes. Biochem. Cell Biol. 64:99-105. 3. Brinster, R. L., H. Y. Chen, and M. Trumbauer. 1981. Somatic expression of herpes thymidine kinase in mice following infection of a fusion gene into eggs. Cell 27:223-231. 4. Capasso, O., G. C. Bleeker, and N. Heintz. 1987. Sequences controlling H4 mRNA sequence abundance. EMBO J. 6:18251831. 5. Caron, J., A. L. Jones, L. B. Rali, and M. W. Kirschner. 1985. Autoregulation of tubulin synthesis in enucleated cells. Nature (London) 317:648-650. 6. Caron, J. M., A. L. Jones, and M. W. Kirschner. 1985. Autoregulation of tubulin synthesis in hepatocytes and fibroblasts. J. Cell Biol. 101:1763-1772. 7. Cleveland, D. W. 1987. The multitubulin hypothesis revisited: what have we learned? J. Cell Biol. 104:381-383. 8. Cleveland, D. W., and J. C. Havercroft. 1983. Is apparent autoregulatory control of tubulin synthesis nontranscriptionally controlled? J. Cell Biol. 97:919-924. 9. Cleveland, D. W., M. A. Lopata, R. J. MacDonald, N. J. Cowan, W. J. Rutter, and M. W. Kirschner. 1980. Number and evolutionary conservation of a- and ,-tubulin and cytoplasmic ,B- and ,y-actin genes using specific cloned cDNA probes. Cell 20:95105. 10. Cleveland, D. W., M. A. Lopata, P. Sherline, and M. W. Kirschner. 1981. Unpolymerized tubulin modulates the level of tubulin mRNAs. Cell 25:537-546. 11. Cleveland, D. W., M. F. Pittenger, and J. R. Feramisco. 1983. Elevation of tubulin levels by microinjection suppresses new tubulin synthesis. Nature (London) 305:738-740. 12. Cleveland, D. W., and K. F. Sullivan. 1985. Molecular biology of genetics of tubulin. Annu. Rev. Biochem. 54:331-365. 13. Dietrich, H. W., III, and R. C. Williams, Jr. 1977. Reversible association of the o,B dimer of calf brain tubulin. J. Cell Biol. 75: 277a. 14. Fan, H., and S. Penman. 1970. Regulation of protein synthesis in mammalian cells. Inhibition of protein synthesis at the level of initiation during mitosis. J. Mol. Biol. 50:655-670. 15. Favaloro, J., R. Treisman, and R. Kamen. 1980. Transcription maps of polyoma virus-specific RNA: analysis by two-dimensional nuclease Si gel mapping. Methods Enzymol. 65:718-749. 16. Gay, D. A., T. J. Yen, J. T. Y. Lau, and D. W. Cleveland. 1987. Sequences that confer P tubulin autoregulation through regulated mRNA stability reside within exon 1 of a I tubulin mRNA. Cell 50:671-679. 17. Geyer, P. K., 0. Meyuhas, R. P. Perry, and L. F. Johnson. 1982. Regulation of ribosomal protein mRNA content and translation in growth-stimulated mouse fibroblasts. Mol. Cell. Biol. 2:685693. 18. Goldman, W. E., G. Goldberg, L. H. Bowman, D. Steinmetz, and D. Schlessinger. 1983. Mouse rDNA: sequences and evolutionary analysis of spacer and mature RNA regions. Mol. Cell. Biol. 3:1488-1500. 19. Graves, R. A., N. B. Pandey, N. Chodchoy, and W. F. Marzluff. 1987. Translation is required for regulation of histone mRNA degradation. Cell 48:795-804. 20. Hogan, B. L. M. 1969. The effect of inhibitors of protein synthesis on the level of ribosomal subunits in ascites cells. Biochim. Biophys. Acta 182:264-266. 21. Kirschner, M. W., and T. J. Mitchison. 1986. Beyond self assembly: from microtubules to morphogenesis. Cell 45:329342. 22. Kruijer, W., J. A. Cooper, T. Hunter, and I. Verma. 1984. PDGT induces rapid but transient expression of the c-fos gene. Nature (London) 312:711-716. 23. Kunkel, T. A. 1985. Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc. Natl. Acad. Sci. USA 82: 488-492. 24. Lau, J. T. Y., M. F. Pittenger, and D. W. Cleveland. 1985. Reconstruction of appropriate tubulin and actin gene regulation after transient transfection of cloned p-tubulin and P-actin genes. Mol. Cell. Biol. 5:1611-1620. 25. Lee, M. G.-S., S. A. Lewis, C. D. Wilde, and N. J. Cowan. 1983. Evolutionary history of a multigene family: an expressed human p-tubulin gene and three processed pseudogenes. Cell 33:477- 486. 26. Lewis, S. A., M. G.-S. Lee, and N. J. Cowan. 1985. Five mouse tubulin isotypes and their regulated expression during development. J. Cell Biol. 101:852-861. 27. Linial, M., N. Gunderson, and M. Groudine. 1985. Enhanced transcription of c-myc in bursal lymphoma cells requires continuous protein synthesis. Science 230:1126-1131. 28. Lopata, M. A., D. W. Cleveland, and B. Sollner-Webb. 1984. High level transient expression of a chloramphenicol acetyl VOL. 8, 1988 29. 30. 31. 32. 33. 34. 35. 36. NUCLEOTIDES SPECIFYING ,B-TUBULIN AUTOREGULATION transferase gene by DEAE-dextran mediated DNA transfection coupled with a dimethyl sulfoxide or glycerol shock treatment. Nucleic Acids Res. 12:5707-5717. Lopata, M. A., J. C. Havercroft, L. T. Chow, and D. W. Cleveland. 1983. Four unique genes required for p tubulin expression in vertebrates. Cell 32:713-724. Miller, A. D., T. Curran, and I. Verma. 1984. c-fos protein can induce cellular transformation: a novel mechanism of activation of a cellular oncogene. Cell 36:51-60. Muller, R., R. Bravo, J. Burckhardt, and T. Curran. 1984. Induction of c-fos gene and protein by growth factors precedes activation of c-myc. Nature (London) 312:716-720. Neff, N. F., J. H. Thomas, P. Grisali, and D. Botstein. 1983. Isolation of the 1 tubulin gene from yeast and demonstration of its essential function in vivo. Cell 33:211-219. Pachter, J. S., T. J. Yen, and D. W. Cleveland. 1987. Autoregulation of tubulin expression is achieved through specific degradation of polysomal tubulin mRNAs. Cell 51:283-292. Patton, J. R., and C.-B. Chae. 1983. A method for mapping RNA initiator, terminator, splice and protein binding sites. Ribosome binding sites of P globin messenger RNA. J. Biol. Chem. 258:3991-3995. Pittenger, M. F., and D. W. Cleveland. 1985. Retention of autoregulatory control of tubulin synthesis in cytoplasts: demonstration of a cytoplasmic mechanism that regulates the level of tubulin expression. J. Cell Biol. 101:1941-1952. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc- 37. 38. 39. 40. 41. 42. 43. 44. 1235 ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467. Shaw, G., and R. Kamen. 1986. A conserved AU sequence from the 3' untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Cell 46:659-667. Sive, H. L., N. Heintz, and R. G. Roeder. 1984. Regulation of human histone gene expression during the HeLa cell cycle requires protein synthesis. Mol. Cell. Biol. 4:2723-2734. Stanners, C. P. 1966. The effect of cycloheximide on polyribosomes from hamster cells. Biochem. Biophys. Res. Commun. 24:758-764. Sullivan, K. F., and D. W. Cleveland. 1986. Identification of conserved isotype-defining variable region sequences for four vertebrate v tubulin polypeptide classes. Proc. Natl. Acad. Sci. USA 83:4327-4331. Sullivan, K. F., J. T. Y. Lau, and D. W. Cleveland. 1985. Apparent gene conversion between 3-tubulin genes yields multiple regulatory pathways for a single 1-tubulin polypeptide isotype. Mol. Cell. Biol. 5:2454-2465. Walter, P., and V. Lingappa. 1986. Mechanism of protein translocation across the endoplasmic reticulum membrane. Annu. Rev. Cell Biol. 2:499-516. Yonath, A., K. R. Leonard, and H. G. Wittman. 1987. A tunnel in the large ribosomal subunit revealed by three-dimensional image reconstruction. Science 236:813-816. Zoller, M. J., and M. Smith. 1983. Oligo-directed mutagenesis. Methods Enzymol. 100:468-500.