Download Supplementary Methods - Word file

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts
no text concepts found
Transcript
Materials and methods
Peptides, antibodies and immunoprecipitation
A peptide corresponding to the amino acid sequence of Miwi was designed
based on sequence deposited in GenBank (NM_021311). The peptide ( NMTGRARAR-C) was conjugated to mcKLH using Imject Maleimide Activated
mcKLH Kit (Pierce) and used to raise rabbit polyclonal antibodies (Covance). For
immunoprecipitation reactions, each testis was dounced in 1mL RIPA buffer (for
piRNA northern) (50mM Tris pH8.0, 150mM NaCl, 0.1% SDS, 1% Triton-X, 0.5%
Na deoxycholate, 1mM DTT, protease inhibitors, 100U/ml RNASIN) or in Triton
buffer (for miRNA northern) (25mM Tris pH7.5, 150mM NaCl, 1.5 mM MgCl2, 1%
Triton, 1mM DTT, protease inhibitors, 100U/ml RNASIN). 1 mL of mouse testis
extract was pre-cleared by incubation with 30 μl of Protein A/G-agarose (Roche)
at 4°C for 1 h. Pre-cleared extracts were then incubated with 50 μl of antiserum
overnight at 4°C then with 15 μl of Protein A/G agarose at 4°C for 1 h 30 min.
Immunoprecipitates were washed three times (30 min each) in lysis buffer.
Small RNA isolation and Northern blot
Mouse testes were frozen on dry ice, powdered using a Stanley model 51-941,
and total RNA was isolated using Trizol. Small RNAs were separated by 15%
denaturing PAGE. Where indicated, gels were stained with SybrGold (Molecular
Probes) and electroblotted onto Hybond-N+ membranes (Amersham).
Membranes were UV crosslinked and hybridized with 32P end-labeled
oligonucleotide probes in Church and Gilbert Moderate Buffer at 42°C (1% BSA,
0.5M NaPO4, 15% formamide, 1mM EDTA, 7% SDS). Probes for detecting
piRNAs were perfectly complementary to the sequenced piRNAs. Probe
sequences are as follows.
piR-1 : AAAGCTATCTGAGCACCTGTGTTCATGTCA
piR-2 : ACCAGCAGACACCGTCGTATGCATCACACA
piR-3 : ACCACTAAACATTTAGATGCCACTCTCA
region adjacent to piR-3: TACAGAGAACAGAGTAGAATCTACTCTCAG
After hybridization, membranes were washed with 1XSSC containing 0.1% SDS
at 42°C three times, each 15 min. Membranes were exposed to a phosphor
imager screen, which were scanned on a BAS-2500 imager (Fuji) and quantified.
Small RNA cloning
Sixty micrograms of total mouse testis RNAs were separated by 15% denaturing
PAGE gel, visualized by SYBR-gold staining, and small RNAs of 25~35 nt were
gel-purified. Small RNAs were ligated to 3’ adaptor and 5’ acceptor sequentially,
and then RT-PCR amplified as described18. The resulting PCR products were
either TOPO cloned according to the manufacturer’s protocol (Invitrogen) or
reamplified using a pair of 454 cloning primers :
5’ primer : GCCTCCCTCGCGCCATCAGATCGTAGGCACCTGAAA
3’ primer : GCCTTGCCAGCCCGCTCAGATTGATGGTGCCTACAG
The reamplified products were gel-purified and then provided to 454 Life
Sciences (Branford, CT) for sequencing.
Bioinformatics
Beginning with raw reads obtained from 454, we removed adapter sequences by
using BLAST to identify the boundaries of the smallRNAs. The smallRNA
sequences were mapped to the mouse genome (Aug 2005, mm7 from UCSC)
using BLAST. All data (sequences, mapping information) were entered into a
relational database. Positions of RefSeq exons and repeats were also
downloaded from UCSC and entered into the relational database.
The size distribution of the complete population (Fig S2A) showed that
sequences of 29 and 30 nucleotides were predominantly recovered. Based upon
these results, and the SYBR-staining and Northern analysis shown in Fig. 1, we
restricted further investigation to 25-32 nucleotide sequences, of which we
obtained 77,480. Since pyrosequencing is error-prone, the population was next
subjected to a quality cut-off, wherein all sequences were compared to the
consensus mouse genome and those with more than 2 defects (mismatches or
gaps) were discarded. Sequences in the 25-32 nt size range, not annotated as
a previously known non-coding RNA, and passing this cut-off were classified as
candidate piRNAs.
piRNA densities were determined by calculating a moving average of piRNAs in
a 5 kB sliding window (100 base increments) along each chromosome. Use of a
kernel density estimator gave similar results. Only clones that map 1 to 5 times
to the genome were used in density analysis. Boundaries of clusters were
determined by the small RNA density dropping below a threshold that was set at
5 piRNAs/5Kb. The densities of exons and repeats were using a 50kB window,
scanning the genome in increments of 1000 bases. The density values were
multiplied by 500 for plotting purposes. Views of piRNA clusters in Fig 2 and 3
were generated using the UCSC genome browser.