Download PDF - International Journal of Biological Sciences

Int. J. Biol. Sci. 2011, 7
Ivyspring
International Publisher
823
International Journal of Biological Sciences
2011; 7(6):823-836
Research Paper
Cloning and Characterization of a 2-Cys Peroxiredoxin in the Pine Wood
Nematode, Bursaphelenchus xylophilus, a Putative Genetic Factor Facilitating the Infestation
Zhen Li 1,2, Xiaoxia Liu 1, Yanna Chu 1, Yan Wang 1, Qingwen Zhang 1,, Xuguo Zhou 2,
1. Department of Entomology, China Agricultural University, Beijing 100193, China
2. Department of Entomology, University of Kentucky, Lexington, KY 40546-0091, USA
 Corresponding author: Dr. Qingwen Zhang, Department of Entomology, China Agricultural University, Yuanmingyuan
West Road, Beijing 100193, China. Phone: 86-10-62733016 Fax: 86-10-62733016 Email: [email protected] or Dr. Xuguo
"Joe" Zhou, Department of Entomology, University of Kentucky, S-225 Agricultural Science Center North, Lexington, KY
40546-0091. Phone: 859-257-3125; Fax: 859-323-1120; Email: [email protected]
© Ivyspring International Publisher. This is an open-access article distributed under the terms of the Creative Commons License (http://creativecommons.org/
licenses/by-nc-nd/3.0/). Reproduction is permitted for personal, noncommercial use, provided that the article is in whole, unmodified, and properly cited.
Received: 2011.03.15; Accepted: 2011.04.29; Published: 2011.07.07
Abstract
The pine wood nematode, Bursaphelenchus xylophilus, is an invasive plant parasitic nematode and a worldwide quarantine pest. An indigenous species in North America and the
causal agent of pine wilt disease, B. xylophilus has devastated pine production in Southeastern Asia including Japan, China, and Korea since its initial introduction in the early
1900s. The reactive oxygen species (ROS) is the first line of defense utilized by host plants
against parasites, while nematodes, counteractively, employ antioxidants to facilitate
their infection. Peroxiredoxins (Prxs) are a large class of antioxidants recently found in a
wide variety of organisms. In this report, a gene encoding a novel 2-cysteine peroxiredoxin protein in B. xylophilus was cloned and characterized. The 2-cysteine peroxiredoxin
in B. xylophilus (herein refers to as “BxPrx”) is highly conserved in comparison to
2-cysteine peroxiredoxins (Prx2s) in other nematodes, which have two conserved cysteine amino acids (Cp and Cr), a threonine-cysteine-arginine catalytic triad, and two signature motifs (GGLG and YF) sensitive to hydrogen peroxide. In silico assembly of BxPrx
tertiary structure reveals the spatial configuration of these conserved domains and the
simulated BxPrx 3-dimensional structure is congruent with its presumed redox functions. Although no signal peptide was identified, BxPrx was abundantly expressed and
secreted under the B. xylophilus cuticle. Upon further analysis of this leader-less peptide,
a single transmembrane α-helix composed of 23 consecutive hydrophobic amino acids
was found in the primary structure of BxPrx. This transmembrane region and/or readily
available ATP binding cassette transporters may facilitate the transport of non-classical
BxPrx across the cell membrane. Recombinant BxPrx showed peroxidase activity in vitro
reducing hydrogen peroxide using glutathione as the electron donor. The combined results from gene discovery, protein expression and distribution profiling (especially the
“surprising” presence under the nematode cuticle), and recombinant antioxidant activity
suggest that BxPrx plays a key role in combating the oxidative burst engineered by the
ROS defense system in host plants during the infection process. In summary, BxPrx is a
genetic factor potentially facilitating B. xylophilus infestation.
Key words: Bursaphelenchus xylophilus, pine wilt disease, reactive oxygen species, Peroxiredoxin,
hydrogen peroxide.
http://www.biolsci.org
Int. J. Biol. Sci. 2011, 7
824
Introduction
The pinewood nematode, Bursaphelenchus xylophilus (Steiner and Buhrer) Nickle, is the pathogenic
agent of pine wilt disease, which has caused serious
damage to pine forests in Japan, Korea, and China [1].
Bursaphelenchus xylophilus is native to North America
[2] and was introduced to Japan in the 1900s, South
Korea in the 1980s, China in 1982 [3], and later to
Portugal, Canada and 40 other countries [4, 5]. In
China alone, the combined damage and management
costs exceed 4 billion US dollars annually [6].
Biotic and abiotic factors affecting B. xylophilus
infection
Bursaphelenchus xylophilus completes its life cycle
within a temperature range of 25-30 °C; therefore, the
population density of B. xylophilus normally peaks
after summer, decreases from the beginning of the
winter and reaches its lowest point the following
spring [7]. Water status in pines also plays an important role in the pine-nematode relationship, and a
reduced transpiration rate in pine can stimulate population growth of B. xylophilus [8]. In addition to abiotic factors, such as temperature and water stress,
biotic factors also play a prominent role in the infection and distribution of this plant pathogenic nematode. A better understanding of these biotic factors
will provide essential information to control the
spread of this devastating disease in pine trees. The
innate resistance of pine is one of the most important
biotic factors limiting the occurrence of pine wilt disease. Bursaphelenchus xylophilus can rapidly reproduce
and spread in susceptible pine trees, but its movement
is restricted among resistant pine trees [9]. It has been
reported that resistant pine species produce additional secondary metabolites to recognize and suppress the invasion of pathogens [10].
After millions of years of co-evolution with parasites, host plants have evolved various resistant
mechanisms against the parasite infection. In many
plants, the first line of defense involves an oxidative
burst which generates toxic reactive oxygen species
(ROS), including superoxide anion (O2-·), hydrogen
peroxide (H2O2) and the hydroxyl radical (·OH) [11].
ROS production in plants is particularly important in
the defense and recognition of novel pathogens [12],
because it can affect many key events in
plant-pathogen interactions, including signal transduction, antimicrobial effect, membrane lipoxidation,
cell wall modification, induced resistance, and hypersensitive cell death [11]. Counteractively, parasites
produce antioxidants to protect them from the host
plant‟s ROS defenses [13]. Therefore, removing ROS
in host plants is critical for the survival of parasites.
Given the fact that B. xylophilus can successfully infest
and spread in pine trees, antioxidant proteins likely
play a key role in the host-parasite interaction.
Antioxidants and peroxiredoxins
The major antioxidants in eukaryotic organisms
include superoxide dismutase which detoxifies the
superoxide anion, catalase, glutathione peroxidase
which is involved in the breakdown of cellular peroxides, and peroxiredoxin which functions to inactivate hydrogen peroxide [13, 14 and 15]. Based on the
catalytic mechanisms and the presence of either one
or two highly conserved cysteine residues, peroxiredoxins (Prxs) are classified into 1-Cys, typical 2-Cys,
and atypical 2-Cys Prxs. Catalytic reactions of the
typical 2-Cys, atypical 2-Cys, and 1-Cys Prx are
through the formation of intermolecular disulfide,
inner-molecular disulfide [16], and the participation
of small chemical thiols as reduced agents, respectively [17]. Prxs are multifunctional proteins, for example they function as antioxidants, by reducing alkyl peroxide and hydrogen peroxide to alcohol or
water, respectively [18, 19]. They can also protect
against phospholipid peroxidation [20] and serve as a
peroxynitrite reductase for the detoxification of the
reactive nitrogen species (RNS) [21] to protect cells
from oxidant-induced membrane damage and prevent cell death [22]. In addition, Prxs are also considered to be signal transmitters in phosphorylation and
transcriptional regulation, presumably through regulation of hydrogen peroxide [23]. Differing from other
antioxidants, Prxs have no cofactors, such as metals or
prosthetic groups for its antioxidant activity. The
highly conserved cysteine residues are their active
sites [16]. The cysteine residue near the N-terminus is
referred to as Cp, which exists in all Prxs; whereas the
cysteine residue near the C-terminus is referred to as
Cr, and it only exists in the 2-Cys Prxs [16].
Despite recent progresses in the genomic [24]
and epigenomic [25] understanding of this
world-wide quarantine pest, there is virtually no information available regarding the Prx gene in plant
pathogenic B. xylophilus and its potential role in engineering the antioxidative counterattack against pine
hosts. In this study, we pursue the following objectives: (1) Clone and sequence peroxiredoxin in the plant
pathogenic B. xylophilus (BxPrx) using RACE-PCR; (2)
Gain a better understanding of the transmembrane
pathway of leader-less BxPrx based on the in silico
structural analysis of BxPrx; and (3) Express recombinant BxPrx heterogeneously in a bacterial system
and investigate the tissue localization of BxPrx by
http://www.biolsci.org
Int. J. Biol. Sci. 2011, 7
immunohistochemistry using a polyclonal antibody
raised against recombinant BxPrx.
Materials and Methods
Bursaphelenchus xylophilus culture and maintenance
The B. xylophilus isolate JSZJ1-6 [3] was kindly
provided by Dr. Bingyan Xie (Institute of Vegetables
and Flowers, Chinese Academy of Agricultural Sciences). B. xylophilus was maintained at 25 °C for one
week on a necrotrophic fungus, Botrytis cinerea, grown
on a PDA (Potato Dextrose Agar) culture dish. Mixed
stages of B. xylophilus were then harvested with a
Baermann funnel, and washed with M9 buffer
(KH2PO4 30 g/L, K2HPO4 60 g/L, NaCl 50 g/L) before
subjecting the isolate to subsequent experiments [26].
BxPrx gene discovery and sequence analysis
A thorough search of available sequences at a
web-based nematode genomics database, Nematode.Net v3.0 (http://www.nematode.net) showed
that Prx2s are evolutionarily conserved in all extant
nematode species. After alignment of the deduced
protein sequences of Prx2 from EST libraries obtained
at this website, the degenerate primers (Table. S1)
were designed based on several highly conserved
domains for the cloning of BxPrx. Total RNA was extracted from mixed stages of B. xylophilus using RNeasy Mini kit (Qiagen, Hamburg, Germany) according
to the manufacture‟s protocols. The first strand cDNA
used in 3′ RACE and 5′ RACE were synthesized with
3′ full RACE core set (Takara, Dalian, China) and
Firstchoice® RLM RACE Kit (Ambion, Foster City,
CA, USA), respectively. The 3′ end product of the
BxPrx gene was obtained with oligodT-3 site adaptor
primer (Takara) and the degenerate primer BxPrx3S.
5′ end sequence was obtained with 5′ RACE outer
primer (Ambion) and BxPrx5R. The entire sequence
was amplified by the primer set BxPrxSB and
BxPrxRS (Table S1) which include restriction sites
BamH I and Sal I to the 5′ and 3′ ends, respectively,
and the resulting PCR products were validated by
direct sequencing.
The deduced protein sequence, pI (Iso-electric
Point) and MW (Molecular Weight) of BxPrx were
predicted by DNAman v.5.2.2 (Lynnon Biosoft, Quebec, Canada). The catalytic triad of BxPrx was determined by a Conserved Domain search on the NCBI
website (http://www.ncbi.nlm.nih.gov/Structure/
cdd/wrpsb.cgi) [27]. Protein tertiary structure was
predicted by an online protein structure homology-modeling server SWISS-MODEL using the automated mode and modified by PyMOL-v1.3r1 software. All published EST sequences of Prx2 in nema-
825
todes
were
obtained
from
Nematode.Net
(http://www.nematode.net). The signal peptide of
BxPrx
was
determined
using
SignalP
(http://www.cbs.dtu.dk/services/SignalP/)
[28],
and the transmenbrane region of BxPrx was predicted
by TMHMM (http://www.cbs.dtu.dk/services/
TMHMM-2.0/). The hydrophobicity profile of BxPrx
was analyzed by DNAman v.5.2.2. Secretome 2.0
Server
(http://www.cbs.dtu.dk/services/
SecretomeP/) was used to characterize the
non-classical secreted proteins.
Phylogenetic relationship of BxPrx with other
Prx2s
All Prx2 sequences in animals which have the
full open reading frames (ORFs) were extracted from
GenBank, loaded in MEGA 4, and aligned. The phylogenetic relationship of BxPrx with other Prx2s was
revealed using two different methods: (1) the neighbor-joining (NJ) analysis with an Amino: Poisson
correction model; (2) the maximum parsimony (MP)
analysis. The sites containing missing data or alignment gaps were removed in a pair-wise fashion. A
total of 1,000 bootstrap replications were used to test
topology. Bootstrap values (>50) were reported with
each branch and the taxonomic origins of the sequences were highlighted.
Nuclear localization of BxPrx
Intracellular localization of BxPrx was investigated through transient expression of the
Cam35S::GFP-BxPrx fusion construct which was
bombarded into onion epidermal cells [29] using
Model PDS-1000/He Biolistic Particle Delivery System (Baumbusch, LO.). Plasmid Cam35S::GFP -BxPrx
was constructed by inserting the entire coding sequence of BxPrx into the Cam35S-GFP plasmid behind the Cam35S promoter (Cauliflower Mosaic virus
35S promoter) and GFP (Green Fluorescent Protein)
reporter gene after digestion with BamH I and Sal I
(Fig. S1A). The resulting in-frame fusion was confirmed by restriction mapping and DNA sequencing.
Expression was detected against a blank Cam35S-GFP
control with a Bx60 Olympus microscope using a blue
wide band cube for fluorescence observation.
Recombinant protein expression, purification and
validation
A recombinant expression plasmid was constructed by ligating the entire open reading frame of
BxPrx into a bacterial expression vector pET-28a (Fig.
S1B). The resulting recombinant construct was validated by the direct sequencing of PCR products and
then transformed into an Escherichia coli BL21 (DE3)
competent cell. Escherichia coli was cultured at 37 oC
http://www.biolsci.org
Int. J. Biol. Sci. 2011, 7
for 16 hrs with shaking at 250 rpm. It was then diluted
1:50 (V:V) into liquid LB (Lysogeny Broth), and the
liquid medium was shaken continuously until the
OD600 value reached 0.4-0.6. The induction conditions,
such as isopropyl β-D-1-thiogalactopyranoside (IPTG)
concentration and incubation temperature, were optimized to maximize the yield of soluble recombinant
BxPrx. A series of IPTG concentrations ranging from
0, 1, 2, and 5 mM was tested. The induction was then
carried out at two different temperatures: 37 oC, 250
rpm shaking for three hours, and 20 oC, 150 rpm
shaking for 16 hrs. 100 ml of bacterial culture from
each treatment was precipitated by centrifugation at
4,000 g for 15 min. Then the pellets were dissolved in
the lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10
mM Imidazole, pH 7.0), and sonicated (250 W, 10 s ×
10 times, 30 s interval, in ice) to break up the bacteria.
After centrifugation at 4 oC, 12,000 rpm for 20 min, the
supernatant of sonicated fraction was mixed with
Ni-NTA agarose (Qiagen, Hamburg Germany). To
purify recombinant BxPrx, the resulting protein was
washed (50 mM NaH2PO4, 300 mM NaCl, 20 mM
imidazole, pH 7.0) and then eluted (50 mM NaH2PO4,
300 mM NaCl, 250 mM Imidazole, pH 7.0). A total of
10 elution fractions were collected with 500 µl in each
fraction.
After SDS-PAGE and staining by coomassie
blue, the band of the purified BxPrx protein was cut
out from the gel. After being dipped in a 100 µl discoloration solution (H2O: methonal: acetic acid = 5: 4:
1) for 20 min, dehydrated with 100 µl acetonitrile for
10 min, and alkylated with 50 µl indoacetamide for 30
min in dark, the product was treated with 15 µl 0.01
µg/µl trypsin for 16 h, and then was extracted with
100 µl 5 % TFA (trifluoroacetic acid) at 40 oC for 1h.
After drying under nitrogen and mixed with 5 µl 0.1
% TFA, the sample was loaded into an ABI-4800
MALDI-TOF-TOF for a confirmation test of the induced recombinant protein.
BxPrx activity assay
The activity of recombinant BxPrx on the reduction of hydrogen peroxide (H2O2) and cumene hydroperoxide (C9H12O2) was measured at OD340 according to Kwatia [30]. The reaction mixture contained 5 mM potassium phosphate (pH 7.0), 1 mM
EDTA, 0.1 mM NADPH, 1mM L-glutathione, and 0.1
unit/ml glutathione reductase (Sigma). One unit of
activity is defined as the amount of enzyme required
to cause the oxidation of 1 nmol of NADPH per minute.
826
BxPrx antiserum production and immunoblot
analysis
A polyclonal antiserum against recombinant
BxPrx was obtained by consecutive 4-week injections
of the purified protein into a rabbit. For the first injection, 1 mg of BxPrx protein was injected concurrently
with 1 mg Freund‟s Complete Adjuvant (Sigma, St.
Louis, MO). In the following 3 weeks, 1 mg of protein
was injected mixed with 1 mg of Freund‟s Incomplete
Adjuvant (Sigma, St. Louis, MO). The serum supernatant were obtained after centrifugation of collected
blood samples subjected to immunoblot analysis at 4
°C, 12,000 rpm for 15 min.
To test the quality of resulting anti-BxPrx serum,
30 µg of total protein extract from B. xylophilus and B.
mucronatus were separately loaded in 12 % SDS-PAGE
for the immunoblot analysis. The protein bands were
transferred from SDS-PAGE to a nitrocellulose (NC)
membrane. Goat anti-rabbit IgG-alkaline phosphatase
(Fermentas, MD) (diluted by 1: 10000) was used as the
secondary antibody. Immunoreactions were visualized by adding 5-bromo-4-chloro-3-indolyl-phosphate
and p-nitroblue tetrazolium chloride (Promega, WI).
Immunohistolocalization
Mixed stages of B. xylophilus were fixed in the
solution of paraformaldehyde (4 %) and glutaraldehyde (2 %) in 0.1 M phosphate buffered saline (PBS)
(pH 7.4), dehydrated in an ethanol series and embedded in LR (London Resin Company) White resin
with polymerization at 60 °C. Ultrathin sections
(60–80 nm) were cut with a diamond knife on a
Reichert Ultracut Ultramicrotome (Reichert Company, Vienna, Austria). For immunohistochemistry, the
grids were subsequently floated on droplets of the
following solutions: PBS (containing 50 mM glycine),
PBGT (PBS containing 0.2 % gelatine, 1 % bovine serum albumin and 0.02 % Tween-20), the primary antibody (Sigma) diluted with PBGT, and the secondary
antibody diluted with PBGT. Optional silver intensification increased the size of the gold granules from 10
to about 40 nm, and 2 % of uranyl acetate increased
the tissue contrast for observation in the transmission
electron microscope (HITACHI H-7500, Hitachi, Tokyo, Japan). The primary antibody was diluted 1: 2000
and incubated overnight at 4 °C. The secondary antibody, an anti-mouse IgG which was coupled to 10 nm
colloidal gold (AuroProbe EM, GAR G10; Amersham
Biosciences, Little Chalfont, Buckinghamshire, UK),
was diluted 20-fold and incubated at room temperature for 60-90 min.
http://www.biolsci.org
Int. J. Biol. Sci. 2011, 7
827
Results
Cloning and sequence analysis of BxPrx
The full length cDNA of BxPrx was determined
through RACE-PCR and was deposited in GenBank
under accession number EU095848. The cDNA of
BxPrx contains 588 bp ORF encoding 195 amino acids.
The predicted isoelectric point (pI) and molecular
weight (MW) are 6.54 and 21,854 Da, respectively.
BxPrx contained two conserved functional cysteine
regions flanked by valine and proline residues (VCP).
The cysteines, located at the peptide positions 49 and
170, respectively, are generally referred to as Cp and
Cr (Fig. 1A and 1B). BxPrx is, therefore, classified as a
2-cys peroxiredoxin [17]. Moreover, Cp is a part of the
catalytic triad. Two conserved motifs GGLG and YF
are also identified in BxPrx, which are critical as a
signal transmitter through sensitive recognition of
H2O2 changes. Prx2 have been found in human, animal, plant-parasitic, and free living nematodes, and
BxPrx shares a high degree of similarity with Prx2
from other nematodes, such as Ascaris suum [159/195
(81 %)], Caenorhabditis elegans [157/195 (80 %)], Globodera rostochiensis [153/193 (79 %)].
A catalytic triad consisting of threonine, cysteine,
and arginine are found to be in close spatial proximity
and forms a triangle shape in their 3-D tertiary structure to facilitate the redox catalytic reaction (Fig. 1B).
The two motifs GGLG and YF are located at the opposite ends in the tertiary configuration, and Cp is
closer to the ATP binding motif GGLG to initiate the
catalytic reaction of BxPrx with the supply of ATP.
Motif YF helix is located above the Cr in their spatial
configuration, and this arrangement could potentially
block the reduction reaction of BxPrx from the oxidized status and it is important for Prx2‟s function as
a signal transmitter.
Phylogenetic analysis
The phylogenetic relationship of BxPrx with
other Prx2s from the animal kingdom is depicted in
Fig. 2. Phylogenies derived from both neighbor joining (NJ) and maximum parsimony (MP) methods
were generally congruent, and the results of the two
phylogenetic trees and associated bootstrap supports
are displayed in Fig. 2. Prx2 sequences came from five
clades of nematodes with different life histories (Table 1).
Table 1. BxPrx homologues in nematodes
Clade
Clade I
Clade III
Clade IVa
Clade IVb
Clade V
Species
Xiphinema index
Trichinella spiralis
Ascaris suum
Toxocara canis
Dirofilaria immitis
Brugia malayi
Strongyloides stercoralis
Parastrongyloides trichosuri
Strongyloides ratti
Zeldia punctata
Heterodera glycines
Meloidogyne hapla
Meloidogyne paranaensis
Meloidogyne incognita
Pratylenchus penetrans
Meloidogyne arenaria
Meloidogyne javanica
Globodera pallida
Ditylenchus africanus
Globodera rostochiensi
Meloidogyne chitwoodi
Caenorhabditis elegans
Nippostrongylus brasiliensis
Ancylostoma ceylanicum
Caenorhabditis remanei
Pristionchus pacificus
Haemonchus contortus
Ancylostoma caninum
Ostertagia ostertagi
Host
Plants
Human
Human
Dogs, cats, and human
Dogs and cats
Human
Human
Possums
Mice
Free living (bacterivore)
Plant (soybean)
Plants (root knot)
Plant (coffee)
Plants (root knot)
Plant (meadow)
Plants (root knot)
Plants (root knot)
Plant (potato cyst)
Plant (peanut)
Plant (potato cyst)
Plants (root knot)
Free living (bacterivore)
Rats
Human and hamster
Free living (bacterivore)
Free living (bacterivore)
Sheep and goats
Dogs
Cattles
Contig ID
XI01176
TS00204
AS00117
TX02017
DI00483
BM01405
SS01309
PT00761
SR00321
ZP00073
HG03313
MH01325
MP00535
MI02462
PE00136
MA03144
MJ00986
GP03375
DA00204
GR13953
MC03207
F09E5.15
NB00963
AE00970
CR02463
PP00536
HC02224
AC03236
OS00892
RFα
+2
+3
+1
+2
+2
+2
+2
+3
+1
+1
+2
+2
+2
+3
+3
+1
+2
+2
+3
+2
+1
+1
+2
+2
+1
+3
+2
+2
+3
H-Score§
806
573
849
786
758
438
805
804
650
830
817
810
807
807
718
680
611
560
450
282
239
843
835
833
831
831
792
761
367
e-Value£
6.0e-81
4.7e-56
5.1e-85
2.2e-78
2.0e-75
2.1e-41
5.5e-81
7.6e-81
1.5e-64
6.9e-83
1.7e-81
1.1e-80
2.0e-80
2.1e-80
5.6e-71
6.1e-67
1.1e-59
2.7e-54
1.3e-53
4.8e-43
6.4e-20
5.7e-84
3.3e-83
5.4e-83
8.1e-83
8.4e-83
1.2e-78
2.5e-75
1.2e-67
“α”: Reading Frame. “§”: High Score, species of the first three highest score were highlighted. “£”: Smallest sum probability P (N)
http://www.biolsci.org
Int. J. Biol. Sci. 2011, 7
828
Figure 1. Sequence and structural analysis of BxPrx. (A) Alignment of BxPrx with orthologues in other nematode species.
Grey blocks represent conserved amino acids across all nematodes. The schematic drawing of conserved domains of BxPrx is
shown in blue blocks. Two conserved functional active cysteine sites (AS-Cp and AS-Cr) and two H2O2 sensitive (HS) motifs
(GGLG and YF) are highlighted in blue boxes. Accession numbers of Prx2s used in this study are Acanthocheilonema viteae
http://www.biolsci.org
Int. J. Biol. Sci. 2011, 7
829
[AAL91102], Brugia malayi [Q17172], Onchocerca volvulus [AAC32810], Ascaris suum [Q9NL98], Dirofilaria immitis
[AAC38831], Haemonchus contortus [AAT28331], Ostertagia ostertagi [CAD20737], Bursaphelenchus xylophilus
[ABW81468], Globodera rostochiensis [CAB48391], and Caenorhabditis elegans [NP_872052]. (B) Schematic drawing of
BxPrx primary and tertiary structures. The grey bar shows the conserved typical 2-Cys Prx domain. The two conserved active
sites (Cp and Cr), H2O2 sensitive motifs (GGLG and YF), and catalytic triad (Thr-Cys-Arg) are highlighted in BxPrx tertiary
structure as colored spheres. One sphere represents one of the atoms in the corresponding amino acids.
Figure 2. Phylogenetic relationship of BxPrx with Prx2s from other organisms. (A) Neighbor-joining (NJ) consensus tree.
(B) Maximum parsimony (MP) consensus tree. The branch length of the NJ and MP tree indicates evolutionary distance.
Accession numbers of the Prx2s used in this study are Xenopus tropicalis [NP_989001], Ascaris suum [Q9NL98], Onchocerca
volvulus [AAC32810], Onchocerca ochengi [AAC77922], Dirofilaria immitis [AAC38831], Brugia malayi [Q17172], Acanthocheilonema viteae [AAL91102], Litomosoides sigmodontis [AAG10102], Ostertagia ostertagi [CAD20737], Haemonchus
contortus [AAT28331], Caenorhabditis elegans [NP_872052], Globodera rostochiensis [CAB48391], Bursaphelenchus xylophilus [ABW81468], Fenneropenaeus indicus [ACS91344], Bombus ignitus [ACP44066], Helicoverpa armigera [ABW96360],
Bombyx mori [NP_001037083], Osmerus mordax [ACO09982], Thunnus maccoyii [ABW88997], Danio rerio [NP_001002468],
Mus musculus [NP_035693], Rattus norvegicus [AAH58481], and Homo sapiens [NP_005800]. Calculated bootstrap value is
attached to each branch and the value is a confidence level supporting this arrangement. BxPrx is highlighted in a box.
http://www.biolsci.org
Int. J. Biol. Sci. 2011, 7
The deduced ORFs have the two conserved
functional cysteine sites which suggest a similar antioxidative function through the same catalytic
mechanism. Among all the sequences, Prx2 from A.
suum has the highest identity with BxPrx which is
consistent with the results of phylogenetic analysis, in
which BxPrx has the closest evolutionary relationship
with a Prx2 in A. suum. Additionally, two main clades
are resolved from the NJ tree, flatworms and a cluster
of nematodes, arthropods and mammals; In MP tree,
all the Prx2s originated from a same evolutionary
root, only with an isolated branch of Haliotis duscus
discus from taxonomic level of mollusc.
830
Cellular distribution of BxPrx
Based on the primary structure analysis, there is
no signal peptide at the N-terminal of BxPrx, which is
consistent with other known Prx2s. However, the
cellular distribution study using a GFP reporter system demonstrated that BxPrx is located within both
the cytoplasm and nucleus of the onion epidermis cell
(Fig. 3A and 3B). The green florescent signals emitted
by the blank Cam35S-GFP construct were detected in
all portions of the onion cell, including the nucleus,
cytoplasm and vacuole (Fig. 3A); whereas signals
from the Cam35S::GFP-BxPrx construct were predominately located in the nucleus and cytoplasm (Fig.
3B).
Figure 3. Intracellular localization of BxPrx. (A) 35S::GFP, GFP fluorescence signal was ubiquitously distributed in the
whole cell. (B) 35S::GFP-BxPrx, GFP signal was strictly located in the cytoplasm and nucleus. The photo was created by
overlaying the differential interference contrast light micrographs with the fluorescence micrographs. C & D presents two
plausible transmembrane mechanisms for BxPrx to reach the cytoplasm. (C) Transmembrane region within BxPrx. A
23-amino acid transmembrane region was predicted by TMHMM. The sequence of the predicted transmembrane region is
provided, and the transmembrane helix is highlighted in red. Hydrophobicity profile of BxPrx was analyzed by DNAman. The
23 consecutive hydrophobic amino acids coincide with the single transmembrane region in BxPrx. (D) A survey of the
available ATP-binding cassette transporter genes in animals including nematodes.
http://www.biolsci.org
Int. J. Biol. Sci. 2011, 7
The in silico secretome study supports the cellular localization of BxPrx in the onion epidermal cells.
The estimated NN-score of BxPrx as a secretome is
0.597 (above the default threshold of 0.5), which
means that BxPrx is a non-classical secretable protein.
These results indicate that BxPrx, a leader-less peptide, can be secreted and enters the cytoplasm without
a leading signal peptide. A transmembrane helix
composed of 23 hydrophobic amino acids provided a
plausible transmembrane mechanism for the leader-less BxPrx (Fig. 3C). In addition, surveying GenBank shows that ATP-binding cassette transporters
(ABC-transporter) are commonly found in animals
including all nematodes for which sequence information is available (Fig. 3D). ABC transporters typically share a highly conserved ATPase domain and
provide energy for transportation and other biological
processes. Therefore, it is germane to speculate that
transmembrane helix and ABC transporters could
831
potentially facilitate the transmembrane activity of the
leader-less BxPrx in B. xylophilus.
Recombinant BxPrx: optimization and validation
Three concentrations of IPTG (1, 2, and 5 mM)
and two different incubation temperatures (20 and 37
°C) were examined to maximize the cytosolic induction of recombinant pET-28a-BxPrx (Fig. 4). The optimal induction conditions were determined to be 1
mM IPTG and 20 °C for 16 hrs because 1) the induction of recombinant BxPrx by IPTG showed no significant improvement beyond 1 mM concentration
(Fig. 4A), and 2) the yield of soluble BxPrx recombinant protein was greatly reduced at 37 °C, although
the overall production of BxPrx recombinant protein
was significantly increased at a higher incubation
temperature. Under optimal conditions, 100 ml of
bacterial culture produced 0.949±0.025 g of precipitate. After a single step purification procedure
(Ni-NTA agarose), it generated 1.233±0.067 mg of
purified BxPrx protein (Fig. 4B).
Figure 4. Recombinant protein expression, purification and validation. (A) Optimal concentration of IPTG for the induction of recombinant BxPrx. 1, 2, 3, and 4 are the protein expressions with blank pET-28a plasmid induced by 5, 2, 1, and
0 mM of IPTG, separately; 5, 6, 7, and 8 are the protein expressions of recombinant BxPrx induced by 5, 2, 1, and 0 mM of
IPTG, respectively. (B) Recombinant BxPrx expression after induced by 1mM IPTG at 20 oC for 16 hrs. (1) without IPTG, (2)
crude, (3) supernatant after sonication, (4) resuspended pellet after sonication, (5) 1st flow-through after initial protein
loading (6) flow-through after washing solution, and (7-9) the 2nd, 3rd, 10th fraction of the eluted BxPrx. (C) Mass spectrometry test of the purified BxPrx. 5 peaks (highlighted with arrows) in the mass spectrum matched with 5 peptide segments (Inset, highlighted in red) of the BxPrx protein in B. xylophilus. (D) Specific activity assay of recombinant BxPrx.
Control, without BxPrx; Two different substrates, hydrogen peroxide (H2O2) and cumene hydroperoxide (C9H12O2), respectively, were used for the activity assay of recombinant BxPrx.
http://www.biolsci.org
Int. J. Biol. Sci. 2011, 7
The identity of heterogeneously expressed protein was validated by the mass spectrometry analysis
(Fig. 4C). The purified recombinant protein exhibited
high sequence homology with 5 peptide fragments
from BxPrx. The specific activity of BxPrx was measured at 547.2±15.2 units/mg protein and 41.1±2.3
units/mg protein to reduce hydrogen peroxide (H2O2)
and cumene hydroperoxide (C9H12O2), respectively,
with a negative control of 11.1±0.8 units/mg protein
(Fig. 4D). Recombinant BxPrx showed highly specific
activity toward hydrogen peroxide.
Immunoblot analysis and immunohistolocalization
study
The polyclonal antiserum raised against the recombinant BxPrx recognized the target BxPrx as a
single band, but only detected the protein extracted
from B. xylophilus not B. mucronatus (Fig. 5A). This
832
result suggested that the Prx2 in B. mucronatus either
has a low homology with BxRrx or is expressed at
significantly lower concentrations. Bursaphelenchus.
mucronatus is closely related to B. xylophilus, but only
the latter one causes pine wilt disease. The differences
in Prx2 structure and expression profile may lead to
the distinctive differences in pathogenicity between
the two species. Immunohistochemistry was carried
out to determine the distribution of BxPrx in tissues
(Fig. 5B-E). The results showed that BxPrx was
abundantly expressed in B. xylophilus and the protein
was predominantly localized under the cuticle surface
(Fig. 5C), i.e., in the particles inside the body (Fig. 5D)
and the muscle cells under the body surface (Fig. 5E).
The negative control with preimmune serum showed
no detectable binding in B. xylophilus samples (Fig.
5B).
Figure 5. Immunoblot analysis and immunohistolocalization of BxPrx in B. xylophilus. (A) Immunoblot analysis of a
polyclonal antiserum raised against recombinant BxPrx to total proteins extracted from B. xylophilus and B. mucronatus,
respectively. M, Molecular marker; Bx, B. xylophilus; Bm, B. mucronatus. A single band was detected in B. xylophilus, but
not in B. mucronatus. (B-E) Immunohistolocalization of BxPrx in B. xylophilus using preimmune serum from a healthy rabbit
as a negative control (B). BxPrx antiserum is found to bind to particles (D) and muscle fiber cells (E) under the cuticle of B.
xylophilus (C). D and E are the close-up imagines of C. The scale bars of B-E are 2 µm, 0.5µm, 0.1µm and 0.1µm respectively.
http://www.biolsci.org
Int. J. Biol. Sci. 2011, 7
Discussion
BxPrx gene discovery
Prx2 is a common theme in parasitic and
free-living nematodes, and its primary structure is
highly conserved. The alignment of BxPrx with Prx2
from other species demonstrates that BxPrx has two
highly conserved cysteine functional sites for antioxidant activity. The N-terminal cysteine is referred to as
peroxidatic cysteine (Cp), and the resolving cysteine
(Cr) is located at the C-terminus. Cp is the primary
site of enzyme oxidation which can attack peroxides
that is subsequently oxidized to a cysteine sulfenic
acid (Cp-SOH) [18]. Then, the reduction of the enzyme to its original active reduced state involves thioredoxin and Cr [31, 32]. The antioxidant catalytic
reaction of BxPrx is assisted by the catalytic triad
composed of threonine, cysteine, and arginine. In the
BxPrx primary structure, arginine is about 80 amino
acids away from threonine and cysteine, but they are
in close proximity in the tertiary structure to initiate
the catalytic reaction. In the following catalytic reaction, deprotonation of the catalytic cysteine (49 Cys)
thiol group is facilitated by H- bonding with the
threonine hydroxyl group, and the positive charge of
the arginine side chain. Therefore, the conserved catalytic triad is critical to the antioxidant activity of
BxPrx; the destruction of this tertiary structure could
lead to the loss of antioxidative activity.
BxPrx also has two conserved motifs of
Gly-Gly-Leu-Gly (GGLG) near the N-terminus and
Tyr-Phe (YF) in the C-terminal arm. GGLG and YF are
common features of Prx2s, and they can detect the
fluctuation of hydrogen peroxide levels in the environment [33, 34]. The GGLG motif is a part of the ATP
binding site in the complex structure of peroxiredoxin
[33] and is located in close proximity to Cp in the
BxPrx tertiary structure, which could provide a convenient energy supply for the catalytic reaction. The
catalytic redox reaction of peroxiredoxin is an
ATP-dependent reaction. As a H2O2 sensitive motif,
GGLG can react quickly and supply energy for the
initiation of an antioxidant reaction for Prx2 when
H2O2 levels increase. Therefore, GGLG potentially
plays a critical role in the antioxidative mechanism of
BxPrx. On the other hand, a YF-containing C-terminal
helix is observed to be located above the active site in
the tertiary structure of BxPrx to prevent unfolding,
which will cause a longer reaction of the active site Cr.
Consequently, Prx is prone to inactivation when
challenged with high levels of H2O2, i.e., Prx is sensitive to increasing H2O2 [34]. Therefore, by having two
sensitive motifs for H2O2, BxPrx should also play a
role in the signal transmission of B. xylophilus, in terms
833
of sensing the ROS defense of the host plant and detoxifying ROS as an antioxidant enzyme.
The phylogenetic analysis showed that Prx2 in
mammals, arthropods and nematodes originated
from the same root, which suggests that Prx2 could
play a similar function in all these organisms. Among
them, BxPrx had the shortest genetic distance to a
Prx2 in Ascaris suum in the constructed NJ tree with
bootstrap value of 58 on the root branch of the two
Prxs; in MP tree, the bootstrap value on the root
branch of the two Prxs is 46, so it is cutoff when values
over 50 are shown. Ascaris suum (a large roundworm)
is a parasitic nematode that causes ascariasis in pigs.
Although the hosts of the two parasites belong to different taxonomic groups, the two parasites have similar transmission pathways and have similar life histories in their respective hosts. Bursaphelenchus xylophilus is transmitted by insect vectors such as the
Japanese pine sawyer beetle, and A. suum also utilizes
a dung beetle as an intermediary for distribution.
They are both migratory parasites and they can move
within the host to feed. Similar transmission pathways and living conditions result in similar parasite-host relationships, which suggests a similar function for their antioxidant Prx.
Transmembrane mechanism of the leader-less
BxPrx
Based on an array of web-based bioinformatics
analyses, BxPrx, a leader-less peptide, is predicted to
have transmembrane capabilities. The outcome of this
in silico prediction was validated by both nuclear- and
immunohistolocalization studies. Unlike classical secretion via the endoplasmic reticulum (ER)/Golgi
Body pathway for proteins with signal peptides,
non-classical secretion of leaderless proteins requires
a structural accommodation (e.g., transmembrane
regions within the leader-less peptides) or a carrier
(transmembrane proteins such as the ABC transporter). In this study, a stretch of 23 consecutive hydrophobic amino acids assembles the only transmembrane helix on the OFR of BxPrx, which potentially can assist BxPrx transmission through the hydrophobic lipid bilayer of the cell membrane. A domain swap or mutation at the transmembrane helix
would provide a definitive answer for the involvement of this transmembrane mechanism in B. xylophilus.
ABC transporters are members of a protein super-family that is one of the largest and most ancient
families found in all extant phyla from prokaryotes to
humans [35]. As transmembrane proteins, ABC
transporters can carry a wide variety of substrates
across extra- and intra-cellular membranes using the
http://www.biolsci.org
Int. J. Biol. Sci. 2011, 7
energy from ATP hydrolysis [36]. Moreover, ABC
transporters, which are prevalent among all nematodes, were considered as a possible transmembrane
mechanism for the ER/Golgi-independent leader-less
secretion pathway in a parasitic flatworm, liver fluke
Fasciola hepatica, especially for the secretion of the
leader-less F. hepatica antioxidants such as Prx2 [37].
Therefore, we propose that leader-less BxPrx is secreted either by its transmembrane region or by a
specific ABC transporter or by both mechanisms
working together in B. xylophilus.
Characterization of recombinant BxPrx
Higher induction temperatures lead to a greater
production of recombinant protein within a shorter
time which typically results in the abnormal folding
of a protein and the formation of an inclusion body. In
this study a large quantity of active recombinant
BxPrx was obtained by induction at optimal conditions (20 oC overnight with 1 mM IPTG). Zipfel et al
[38] recombinantly expressed a Prx2 from the human
parasitic nematode, Onchocerca volvulus. The detailed
characterization of this recombinant Prx2 indicated
that O. volvulus Prx2 predominantly expressed at the
host-parasite interface, which was important for the
infection by this parasitic nematode.
The different reactions on the immunoblots between B. xylophilus and B. mucronatus suggest differences at either the Prx2 genes or Prx2 expression profiles. Bursaphelenchus mucronatus, an indigenous species in China, is very similar to the morphology and
biology of B. xylophilus [39]. However, B. mucronatus
and B. xylophilus have distinctively different pathogenicities. Bursaphelenchus mucronatus has weak
pathogenicity [40] and the disease prevalence of B.
mucronatus is far less than that of B. xylophilus [3]. It
was reported that the propagation of B. xylophilus was
higher than B. mucronatus, and even higher under
competitive conditions in laboratory cultures [39].
After more than two-decades of invasion, B. xylophilus
has significantly increased its colonization capability
and has replaced B. mucronatus in natural forest ecosystems in China [3]. This phenomenon might be the
result of a differentially expressed gene associated
with the pathogenicity and invasive capability of the
two parasites. Most recently, a microRNA survey
provided novel information on the regulation of
growth, development, behavior, and stress response
in B. xylophilus at the epigenetic level [25]. Combining
genomic and epigenomic resources in B. xylophilus
will shed light on the molecular underpinnings that
govern the infection and distribution of B. xylophilus.
834
Tissue localization of BxPrx
The immunohistolocalization study with a polyclonal antiserum against recombinant BxPrx suggest
that: 1) BxPrx is fairly abundant, 2) this antioxidant
can be found in muscle cells and particles, and 3) it is
widely distributed and concentrated underneath the
cuticle of the nematode. This localization profile coincides with Prxs in other parasitic nematodes. A 2-Cys
Prx from a plant parasitic nematode, the yellow potato cyst nematode Globodera rostochiensis, was found
on the cuticle surface and in the stylet secretions of
infective and post-infective juveniles [41, 42]. The
other 2-Cys Prx was localized in the hypodermis and
cuticle in the infective larvae of Onchocerca volvulus,
the nematode pathogen causing onchocerciasis or
„river blindness‟ disease in Africa [38]. Based on the
abundance, distribution, and localization profile of
BxPrx, it is germane to speculate that the secretion of
this antioxidant in the cuticle region could be an
adaptive response to protect this plant parasitic nematode against the host immune responses.
Summary
Prx has been found in a wide range of organisms, including bacteria, plants, invertebrates and
mammals [18], and has been shown to play important
roles in parasite-host interactions. In this study, a
2-cysteine peroxiredoxin gene in B. xylophilus (BxPrx)
was successfully cloned and its primary structure was
thoroughly analyzed. BxPrx, a conserved Prx2 protein, has two conserved cysteine active sites, a catalytic triad, and two H2O2 sensitive motifs. The spatial
configuration and the putative functions of these
conserved domains were analyzed using a tertiary
structure simulated by the SWISS-MODEL. Two
plausible transmembrane mechanisms are discussed
in light of the presence of this leader-less BxPrx in the
cytoplasm and under the B. xylophilus cuticle. The
induction of recombinant BxPrx is optimized, and the
purified recombinant protein exhibited specific Prx
activity neutralizing H2O2. The combined results from
the gene discovery, protein localization, and recombinant protein characterization suggest that BxPrx
potentially plays a key role in combating the oxidative
burst engineered by the ROS defense system in host
plants during the infection process. In short, BxPrx is
a putative genetic factor facilitating B. xylophilus infestation of pine tree hosts.
Acknowledgments
We are grateful to Weiquan Liu (China Agricultural University) and Hongjing Hao (China Institute
of Atomic Energy) for their technical assistance. We
also thank Bingyan Xie (Institute of Vegetables and
http://www.biolsci.org
Int. J. Biol. Sci. 2011, 7
Flowers, Chinese Academy of Agricultural Sciences)
for the B. xylophilus isolates. Special thanks go to John
J. Obrycki, Kenneth F. Haynes and Barbara J. Duncan
(University of Kentucky) for their comments on an
earlier draft. This research was funded by a National
“973” project (Award #: 2009CB119204).
Author Contribution
ZL, YC, and YW conceived the experiments; ZL,
XL, QZ, and XZ designed the study; ZL, QZ, and XZ
analyzed the data; and ZL, QZ, and XZ wrote the
manuscript. All authors read and approved the final
version of manuscript.
Conflict of Interests
The authors have declared that no conflict of interest exists.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
Aikawa T, Kikuchi T, Kosaka H. Population structure of Bursaphelenchus xylophilus within single Pinus thunbergii trees
inoculated with two nematode isolates. Forest Pathol. 2006; 36:
1-13.
Kanzaki N, Futai K. A PCR primer set for determination of
phylogenetic relationships of Bursaphelenchus species within
the xylophilus group. Nematology. 2002; 4: 35-41.
Cheng X, Cheng F, Xu R, et al. Genetic variation in the invasive
process of Bursaphelenchus xylophilus (Aphelenchida: Aphelenchoididae) and its possible spread routes in China. Heredity.
2008; 100: 356-365.
Zhao L, Wei W, Kang L, et al. Chemotaxis of the pinewood
nematode, Bursaphelenchus xylophilus, to volatiles associated
with host pine, Pinus massoniana, and its vector Monochamus
alternatus. J Chem Ecol. 2007; 33: 1207-1216.
Dwinell LD. The pinewood nematode: regulation and mitigation. Annu Rev Phytopathol. 1997; 35: 153-166.
Shi J, Luo Y, Wu H, et al. Impact of the invasion by Bursaphelenchus xylophilus on forest growth and related growth models
of Pinus massoniana population. Acta Ecol Sin. 2008; 28:
3193-3204.
Futai K. Ecological studies on the infection sources of pine wilt
(I). Population dynamics of pine wood nematodes in the withered stem of Japanese red pine. Bull Kyoto Univ Forests. 1986;
57: 1-3.
Suzuki K, Kiyohara T. Influence of water stress on development
of pine wilting disease caused by Bursaphelenchus lignicolus.
Eur J Forest Pathol. 1978; 8: 97-107.
Mori Y, Miyahara F, Tsutsumi Y, et al. Relationship between
resistance to pine wilt disease and the migration or proliferation of pine wood nematodes. Eur J Plant Pathol. 2008; 122:
529-538.
Hanawa F, Yamada T, Nakashima T. Phytoalexins from Pinus
strobus bark infected with pinewood nematode, Bursaphelenchus xylophilus. Phytochemistry. 2001; 57: 223-228.
Baker CJ, Orlandi EW. Active oxygen in plant pathogenesis.
Annu Rev Phytopathol. 1995; 33: 299-321.
Lamb C, Dixon RA. The oxidative burst in plant disease resistance. Annu Rev Plant Physiol Plant Mol Biol. 1997; 48:
251-275.
LoVerde PT. Do antioxidants play a role in schistosome
host-parasite interactions? Parasitol Today. 1998; 14: 284-289.
835
14. Sies H. Strategies of antioxidant defense. Eur J Biochem. 1993;
215: 213-219.
15. Chandrashekar R, Tsuji N, Morales TH, et al. Removal of hydrogen peroxide by a 1-cysteine peroxiredoxin enzyme of the
filarial parasite Dirofilaria immitis. Parasitol Res. 2000; 86:
200-206.
16. Chae HZ, Chung SJ, Rhee SG. Thioredoxin-dependent peroxide
reductase from yeast. J Biol Chem. 1994; 269: 27670-27678.
17. McGonigle S, Curley GP, Dalton JP. Peroxiredoxins: a new
antioxidant family. Parasitol Today. 1998; 14: 139-145.
18. Netto LES, Chae HZ, Kang SW, et al. Removal of hydrogen
peroxide by thiol-specific antioxidant enzyme (TSA) is involved
with its antioxidant properties. J Biol Chem. 1996; 271:
15315-15321.
19. Bruchhaus I, Richter S, Tannich E. Removal of hydrogen peroxide by the 29 kDa protein of Entamoeba histolytica. Biochem
J. 1997; 326: 785-789.
20. Manevich Y, Sweitzer T, Pak JH, et al. 1-Cys peroxiredoxin
overexpression protects cells against phospholipid peroxidation-mediated membrane damage. Proc Natl Acad Sci USA.
2002; 99: 11599-11604.
21. Bryk R, Griffin P, Nathan C. Peroxynitrite reductase activity of
bacterial peroxiredoxins. Nature. 2000; 407: 211-215.
22. Kim HS, Pak JH, Gonzales LW, et al. Regulation of 1-cys
peroxiredoxin expression in lung epithelial cells. Am J Resp
Cell Mol Biol. 2002; 27: 227-233.
23. Fujii J, Ikeda Y. Advances in our understanding of peroxiredoxin, a multifunctional, mammalian redox protein. Redox
Rep. 2002; 7: 123-130.
24. Kikuchi T, Aikawa T, Kosaka H, et al. Expressed sequence tag
(EST) analysis of the pine wood nematode Bursaphelenchus
xylophilus and B. mucronatus. Mol Biochem Parasitol. 2007;
155: 9-17.
25. Huang Q, Cheng X, Mao Z, et al. MicroRNA discovery and
analysis of pinewood nematode Bursaphelenchus xylophilus
by deep sequencing. PLoS ONE. 2010; 5: e13271.
26. Kikuchi T, Jones JT, Aikawa T, et al. A family of glycosyl hydrolase family 45 cellulases from the pine wood nematode
Bursaphelenchus xylophilus. FEBS Lett. 2004; 572: 201-205.
27. Marchler-Bauer A, Lu S, Anderson JB, et al. CDD: a Conserved
Domain Database for the functional annotation of proteins.
Nucleic Acids Res. 2011; 39: 225-229.
28. Bendtsen JD, Nielsen H, von Heijne G, et al. Improved prediction of signal peptides: SignalP 3.0. Mol Biol. 2004; 340: 783-795.
29. Haslekås C, Viken MK, Grini PE, et al. Seed 1-cystein Peroxiredoxin antioxidants are not involved in dormancy, but contribute to inhibition of germination during stress. Plant
Physilol. 2003; 133: 1148-1157.
30. Kwatia MA, Botkin DJ, Williams DL. Molecular and enzymatic
characterization of Schistosoma mansoni thioredoxin peroxidase. J Parasitol. 2000; 86: 908-915.
31. Knoops B, Loumaye E, Van Der Eecken V. Evolution of the
peroxiredoxins. In: Flohé L, Harris J R. Peroxiredoxin Systems.
New York: Springer; 2007: 27-40.
32. Rhee SG, Chae HZ, Kim K. Peroxiredoxins: a historical overview and speculative preview of novel mechanisms and
emerging concepts in cell signaling. Free Radic Biol Med. 2005;
38: 1543-1552.
33. Jönsson TJ, Johnson LC, Lowther WT. Structure of the sulphiredoxin-peroxiredoxin complex reveals an essential repair
embrace. Nature. 2008; 451: 98-101.
34. Wood ZA, Poole LB, Karplus PA. Peroxiredoxin evolution and
the regulation of hydrogen peroxide signaling. Science. 2003;
300: 650-653.
35. Jones PM, George AM. The ABC transporter structure and
mechanism: perspectives on recent research. Cell Mol Life Sci.
2004; 61: 682-699.
http://www.biolsci.org
Int. J. Biol. Sci. 2011, 7
836
36. Davidson AL, Dassa E, Orelle C, et al. Structure, function, and
evolution of bacterial ATP-binding cassette systems. Microbiol
Mol Biol Rev. 2008; 72: 317-364.
37. Robinson MW, Menon R, Donnelly SM, et al. An integrated
transcriptomics and proteomics analysis of the secretome of the
helminth pathogen Fasciola hepatica. Mol Cell Proteomics.
2009; 8: 1891-1907.
38. Zipfel PF, Schrum S, Bialonski A, et al. The peroxidoxin 2 protein of the human parasite Onchocerca volvulus: recombinant
expression, immunolocalization, and demonstration of homologous molecules in other species. Parasitol Res. 1998; 84:
623-631.
39. De Guiran G, Bruguier N. Hybridization and phylogeny of the
pinewood nematode (Bursaphelenchus spp.). Nematologica.
1989; 35: 321-330.
40. Mamiya Y, Enda N. Bursaphelenchus mucromus n. sp. (Nematoda: Aphelenchoididae) from pine wood and its biology and
pathogenicity to pine trees. Nematologica. 1979; 25: 353-361.
41. obertson L, Robertson WM, Sobczak M, et al. Cloning, expression and functional characterization of a peroxiredoxin from
the potato cyst nematode Globodera rostochiensis. Mol Biochem Parasitol. 2000; 111: 41-49.
42. Williamson VM, Gleason CA. Plant-nematode interactions.
Curr Opin Plant Biol. 2003; 6: 327-333.
Additional Tables and Figures
Table S1. Primer sequences for the expression of recombinant BxPrx
Primer ID
Primer Sequence (5′-3′)
BxPrx3S
TTYGTNTGYCCNACNGAR
BxPrx5R
NGCNGGRCANACYTCNCC
BxPrxSB
CGGGATCCATGTCCAAGGCTTTCATT*
BxPrxRS
ACGCGTCGACTTAATGTTTGTTGAAATA**
“*”: BamH I recognition site is underlined . “**”: Sal I recognition site is underlined.
Figure S1. Construction of recombinant plasmid vectors. Recombinant plasmids of Cam35S-GPS-BxPrx (A) and
pET-28a-BxPrx (B), respectively, were constructed by ligating the entire ORF of BxPrx into the Cam35S-GFP between restriction sites BamH I and Sal I.
http://www.biolsci.org