Download Chemokine-Induced Migration Inhibits Integrin

This information is current as
of June 15, 2017.
Plexin C1 Engagement on Mouse Dendritic
Cells by Viral Semaphorin A39R Induces
Actin Cytoskeleton Rearrangement and
Inhibits Integrin-Mediated Adhesion and
Chemokine-Induced Migration
Thierry Walzer, Laurent Galibert, Michael R. Comeau and
Thibaut De Smedt
References
Subscription
Permissions
Email Alerts
This article cites 33 articles, 13 of which you can access for free at:
http://www.jimmunol.org/content/174/1/51.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2005 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
J Immunol 2005; 174:51-59; ;
doi: 10.4049/jimmunol.174.1.51
http://www.jimmunol.org/content/174/1/51
The Journal of Immunology
Plexin C1 Engagement on Mouse Dendritic Cells by Viral
Semaphorin A39R Induces Actin Cytoskeleton Rearrangement
and Inhibits Integrin-Mediated Adhesion and
Chemokine-Induced Migration
Thierry Walzer,1 Laurent Galibert, Michael R. Comeau, and Thibaut De Smedt
C
ytoskeleton is required for cells to move, polarize,
change shape, engulf particles, or interact with other
cells. Different families of proteins inducing cytoskeleton
remodeling have been identified. Among these are semaphorins,
which belong to a growing family of soluble and membrane bound
proteins that can provide either repulsive or attractive guidance
signals on a wide range of neurons (1–5). Developmental defects
in several loss of function semaphorin mutants have revealed the
crucial importance of these proteins in the guidance or migration
of several cell types like neurons or endothelial cells. Semaphorins
share a conserved, 500 amino acid residue domain near their amino
terminus called the Sema domain. Currently, 25 members have
been identified from invertebrates to human (2). A semaphorin
homologue called A39R has also been identified as being encoded
within the genomes of several poxviruses like vaccinia (6).
Two families of semaphorin receptors have been identified:
plexins and neuropilins (1–5). Plexins are type I transmembrane
proteins that also contain a Sema domain in their extracellular part
and an intracellular domain called the SP (sex and plexins) domain
(7, 8). They are divided into four subfamilies, plexin A to plexin D,
according to the structure of their extracellular domain. Semaphorins
signal through direct binding to plexins alone, or in some cases, in
combination with neuropilins. The most remarkable consequence of
the engagement of plexins by semaphorins in neurons is the local
rearrangement of the actin cytoskeleton (3, 5, 9) through the regulation of the activity of small GTPases of the Rho and Rac families (9,
Amgen, Seattle, WA 98119
Received for publication August 3, 2004. Accepted for publication September
28, 2004.
10) and their downstream effector actin-binding protein cofilin (11).
Cofilin phosphorylation by Lin-11-Isl-1-Mec-3 kinase in response to
semaphorin inhibits cofilin ability to bind and depolymerize pointed
ends of F-actin, which inhibits F-actin turnover in neuron growth
cones. Moreover, three recent reports indicate that integrin function is
regulated by semaphorins (12–14) by an as yet unknown mechanism.
Emerging evidence points also to a role for semaphorins and
plexins in the immune system (for a review, see Ref. (15). However, these two families of proteins have been studied independently and no semaphorin-plexin pair has been identified in the
immune system. Some semaphorins have been shown to play roles
in immune regulation, but they seem to function through unique
receptors that are not used in the nervous system. Several plexins
are also expressed by leukocytes, but their cellular ligands as well
as the consequence of their engagement on cellular physiology and
actin-based cytoskeleton in particular are unknown.
We report that plexin C1 is expressed on mouse dendritic cells
(DCs)2 and neutrophils and is the only receptor for the viral semaphorin homologue A39R on these cells. We investigated the consequences of plexin C1 engagement by a recombinant form of A39R on
mouse bone marrow-derived DCs. We found that in vitro binding of
A39R to plexin C1 inhibited integrin-mediated DC adhesion and
spread without affecting their maturation or viability. A39R induced a
decrease of LPS-induced focal adhesion kinase (FAK) phosphorylation in DCs and the rearrangement of the actin cytoskeleton. Moreover, we found that a synthetic cell-permeable peptide containing a
cofilin phosphorylation site suppressed A39R-mediated effects on DC
adhesion. Finally, A39R treatment inhibited DC ability to migrate to
various chemokines in vitro, indicating a potential role for semaphorins and plexins in the regulation of leukocyte movement.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
Address correspondence and reprint requests to Dr. Thierry Walzer, at the current
address, Center d’Immunologie de Marseille Luminy, Case 906, Campus de Luminy,
13288 Marseille cedex 9, France. E-mail address: [email protected]
Copyright © 2005 by The American Association of Immunologists, Inc.
2
Abbreviations used in this paper: DC, dendritic cell; FAK, focal adhesion kinase;
Flt3L, Fms-like tyrosine kinase-3 ligand.
0022-1767/05/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
The poxvirus A39R protein is a member of the semaphorin family previously reported to bind plexin C1. We show that, in the
mouse, plexin C1 is expressed on dendritic cells (DCs) and neutrophils and is the only receptor for A39R on these cells. The
biological effects of a recombinant form of A39R were examined in vitro on mouse DCs derived from wild-type or plexin C1ⴚ/ⴚ
mice. A39R binding to plexin C1 on DCs inhibited integrin-mediated adhesion and spreading in vitro. This phenomenon was
accompanied by a decrease in integrin signaling, measured by focal adhesion kinase phosphorylation, and a rearrangement of the
actin cytoskeleton, without inducing DC maturation or affecting their viability. The A39R effect on DC adhesion was blocked by
a specific inhibitor of cofilin phosphorylation, suggesting that the regulation of F-actin turnover by plexin C1 was essential to
induce cellular retraction. Furthermore, A39R binding to plexin C1 inhibited chemokine-induced migration of DCs in vitro,
suggesting that plexins and semaphorins could be involved in the regulation of leukocyte movement. The Journal of Immunology,
2005, 174: 51–59.
52
PLEXIN ENGAGEMENT REGULATES LEUKOCYTE MOVEMENT
Materials and Methods
Mice and reagents
C57BL/6 mice were obtained from The Jackson Laboratory and used at the
age of 6 –12 wk. The generation of plexin C1⫺/⫺ mice has already been
described (12). Plexin C1⫺/⫺ mice were bred in house. All of the experimental procedures used in this study were approved by a local committee
according to federal guidelines. SFHA39R (shorty-Flag-histidine or A39R)
was expressed from Chinese hamster ovary cells and purified as described
(7). All proteins were tested for endotoxin contents using a Limulus assay
(Whittaker M.A. Bioproducts) and were shown to be ⬍3 EU/mg. A39R
was used at 1 ␮g/ml in every in vitro assay unless otherwise mentioned.
Blocking Abs against ␤1 integrin (clone HA2/5) and ␤2 integrin (clone
GAME-46) were obtained from BD Immunocytometry Systems) and used
at 10 ␮g/ml. Isotype control (hamster IgM and rat IgG1; BD Biosciences)
were used as controls. Synthetic peptides were obtained from Synpep. S3
and RV peptide sequences have been described elsewhere (11). S3 peptide
contains the phosphorylation site of cofilin and the cell-permeable sequence motif of penetratin. Cofilin phosphorylation has been shown to be
efficiently and specifically inhibited in cells cultured in the presence of this
peptide. As a control, the RV peptide containing the same penetratin domain and the reverse sequence of the cofilin phosphorylation domain
were used.
Bone marrow cells were isolated by flushing femurs with complete medium supplemented with 2% heat-inactivated FBS (Invitrogen Life Technologies). RBC were lysed. The cells were then resuspended in culture
medium consisting of McCoy’s medium supplemented with essential and
nonessential amino acids, 1 mmol/L sodium pyruvate, 2.5 mmol/L HEPES
buffer (pH 7.4), vitamins, 5.5 ⫻ 10⫺5 mol/L 2-ME, 100 U/ml penicillin,
100 ␮g/ml streptomycin, 0.3 mg/ml L-glutamine, and 10% FBS (all medium reagents from Invitrogen Life Technologies). Bone marrow cells
were cultured as previously described (16) for 9 days at 1 ⫻ 106 cells/ml,
in tissue culture flasks (BD Falcon; BD Biosciences Discovery Labware) in
culture medium supplemented with 200 ng/ml recombinant human Fmslike tyrosine kinase-3 ligand (Flt3L) (Chinese hamster ovary cell-derived;
Amgen). After primary culture with Flt3L, DCs were subsequently cultured in IMDM (Invitrogen Life Technologies) supplemented with nonessential amino acids, 1 mmol/L sodium pyruvate, 2.5 mmol/L HEPES buffer
(pH 7.4), 2-ME, 100 U/ml penicillin, 100 ␮g/ml streptomycin, 0.3 mg/ml
L-glutamine, and 10% FBS (all medium reagents from Invitrogen Life
Technologies). In vitro activation of the DCs was accomplished by the
addition of 2 ␮g/ml phosphorothioate-modified oligodeoxynucleotides
containing CpG motifs 1826 (TCCATGACGTTCCTGACGTT) (Proligo),
5 ␮g/ml CD40L trimer (Amgen), 20 ng/ml recombinant murine GM-CSF
(R&D Systems) for the indicated times.
Adhesion assay
DCs were cultured in flat-bottom 96-well plates (BD Biosciences) at a
concentration of 1 ⫻ 106/ml (100 ␮l/well). LPS (Sigma-Aldrich) was
added at 1 ␮g/ml when indicated. When indicated, 96-well plates were also
previously coated for 2 h at 37°C with bovine fibronectin (Sigma-Aldrich).
After culture, medium was removed from the wells and nonadherent cells
were gently washed away by pipetting up and down with PBS. PBS was
then removed and plates were frozen at ⫺80°C. Plates were then thawed
and the number of cells that were present in the wells before freezing was
evaluated by measuring the amount of DNA in each well using the Cyquant
kit (Molecular Probes) according to the manufacturer’s instructions. The
plates were read on a VictorII fluorescence reader (Wallac). The percentage
of adherent cells was evaluated by measuring the amount of DNA of a
standard dilution of cells using the same technique.
Flow cytometry
Cells were preblocked at 4°C for 20 min in FACS buffer (PBS containing
2% FBS, 2% normal rat serum, 2% normal hamster serum, 2% normal
mouse serum, 10 ␮g/ml CD16/CD32 (2.4G2) anti-FcR mAb (BD Biosciences), and 0.02% sodium azide). All mAbs were purchased from BD
Pharmingen except where noted. In addition to isotypes controls, the following mAbs (clone name given in parentheses) were used: CD3 (1452C11), CD8 (53-6.7), CD11b (M1/70), CD11c (HL3), CD19 (1D3), CD40
(HM40-3), CD45R/B220 (RA3-6B2), CD86 (GL-1), IAb (AF6-120.1),
Gr-1 (RB6-8C5), Ly6c (AL-21), and Pan-NK (DX5). PE-conjugated F4/80
(CI:A3-1) was purchased from Caltag Laboratories. One IgG1 mAb
(M652) was obtained from a rat immunized with a fusion protein consisting of the first 950 amino acids (predicted to be extracellular) of mouse
plexin C1 fused with the Fc part of human IgG1. A39R binding on DCs
Immunocytochemistry and confocal microscopy
For confocal analyses, DCs were cultured into eight chamber coverslips
that were previously coated with bovine fibronectin. In some experiments,
wild-type and plexin C1⫺/⫺ DCs were labeled with cell tracker red and
green (Molecular Probes), respectively, before culture according to manufacturer’s instructions. The distribution of F-actin was visualized using
Alexa 488-conjugated phalloidin (Molecular Probes) on paraformaldehyde-fixed DCs that had been permeabilized in PBS 0.1% Triton X-100
BSA 0.5%. For live imaging, coverslips were placed on a 37°C heated
stage. Samples were viewed and images acquired on a confocal laser scanning microscope (Nikon; Molecular Dynamics) using a 60 Å objective and
appropriate filters.
Immunoprecipitations
The 35 million DCs/condition were cultured onto 150 ⫻ 25 mm Petri
dishes in 20 ml of medium. At the end of the culture, plates were quickly
transferred onto an ice bath. Floating cells were collected by quick centrifugation at 4°C and lysed together with adherent cells on the Petri dish
in RIPA lysis buffer (150 mM NaCl, 1% Nonidet P-40, 5 mM Tris pH 8.0).
Lysates were incubated for 1 h with 1 ␮g of anti-FAK (Santa Cruz Biotechnology) after preclearing and then incubated with 25 ␮l of protein
A-agarose for 2 h. Agarose beads were washed three times with lysis
buffer. Immunoprecipitates were separated on Novex precast gels (Invitrogen Life Technologies). Proteins were transferred to a polyvinylidene difluoride membrane (Invitrogen Life Technologies) and probed with antiFAK Ab (Santa Cruz Biotechnology) or anti-phospho-FAK (Y397) Ab
(Zymed Laboratories).
Cytokine detection
Levels of IL-1, IL-2, IL-4, IL-6, TNF-␣, GM-CSF, IFN-␥, and IL-12p70 in
DC culture supernatants were measured using the Beadlyte Mouse MultiCytokine Detection System (Upstate Biotechnology) and the Luminex100
plate reader (Luminex) according to the manufacturer’s instructions. Quantification of cytokines was performed by regression analysis from a standard curve generated using cytokine standards included in the kit. Only
IL-6, TNF-␣, and IL-12p70 were detected in DC culture supernatant.
Chemotaxis assay
Cells were labeled with calcein-AM dye (Molecular Probes) according to
the manufacturer’s instructions. Recombinant mouse MIP-1␣/CCL, (R&D
Systems) was diluted in PBS 0.1% BSA at a final concentration of 100
ng/ml and was added to the bottom wells (30 ␮l) of Neuroprobe ChemoTX
96-well plates no. 101-3 (NeuroProbe) together or not with A39R. Pore
size was 3 ␮m, and well diameter was 3.2 mm. Labeled cells were resuspended in RPMI 1640/10% FBS and added (2 ⫻ 104 cells in 25 ␮l) to the
top filter sites of the ChemoTX system. The plates were then incubated at
37° and 5% CO2 for 60 min. After incubation, the cell droplets on the top
of the plate were washed off thoroughly with PBS/0.1% BSA four to five
times. Excess liquid was removed from the top of the filter. The plates were
read on a Molecular Devices Gemini Spectramax XS reader at excitation
490 nm/emission 528 nm, with a cutoff of 515 nm. Values were expressed
as mean fluorescent count fold increase by calculating as follows: (experimental fluorescent counts)/(spontaneous fluorescent counts).
Statistics
All values for p were calculated with the unpaired Student’s t test assuming
equal variances.
Results
Plexin C1 is expressed by DCs and neutrophils and is the only
receptor for A39R
Plexin C1 was previously identified as a receptor for A39R in
human and mouse but its expression has only been partially documented in the immune system (7). We therefore generated an Ab
against mouse plexin C1 (see Materials and Methods) that allowed
us to measure the expression of plexin C1 on a large panel of
immune cells. Little to no expression was found on lymphocytes,
NK cells, and macrophages (Fig. 1A). By contrast, neutrophils,
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
DC cultures
was detected using a biotinylated rat mAb against the Flag (Flag M1;
Amgen). Streptavidin-PerCP (BD Biosciences) was used for secondary
staining. Flow cytometric analyses were performed on a FACSCalibur with
CellQuest software (both BD Biosciences).
The Journal of Immunology
53
splenic DCs, skin Langerhans cells, as well as in vitro generated
DCs obtained from cultures of bone marrow cells in the presence
of Flt3L were all found to express detectable levels of surface
plexin C1 (Fig. 1A and data not shown). Importantly, the antiplexin C1 Ab did not bind to plexin C1⫺/⫺ DCs or to other plexin
C1⫺/⫺ cell types (Fig. 1B and data not shown). Consistent with Ab
staining, recombinant poxvirus A39R strongly bound to C57BL/6
bone marrow-derived DCs and to freshly isolated C57BL/6 splenic
DCs but not to DCs, neutrophils, or any other leukocytes from
plexin C1⫺/⫺ deficient mice (Fig. 1B and data not shown). Thus, these
data demonstrate that plexin C1 is the only receptor for A39R on
mouse leukocytes and that DCs and neutrophils express it.
A39R inhibits integrin-mediated adhesion and inhibits FAK
phosphorylation
Semaphorins are known to induce axon collapse (1–5), a phenomenon that could involve the regulation of cell adhesion through the
modulation of integrin activity (13). We asked whether A39R
could have a similar effect on mouse DCs. To test this hypothesis,
we took advantage of the fact that freshly isolated spleen DCs or
bone marrow-derived DCs placed in culture transiently adhere to
plastic (Fig. 2A and data not shown). This adhesion occurs within
2 h and is enhanced by maturation-inducing agents like LPS (Fig.
2A). This adhesion is dynamic as DCs are motile cells that, under
those in vitro conditions, constantly extend and retract lamellipodia, spreading and stretching their cellular body from one adher-
ence point to another. This makes them often multipolar and from
time to time creates long “dendrites” (Fig. 2B and Ref. (17). Strikingly, when A39R was added at the beginning of the culture together with LPS, it completely prevented the formation of membrane processes by DCs (Fig. 2C) as well as their adhesion to
plastic. This effect was dependent on plexin C1 as A39R did not
affect plexin C1⫺/⫺ DCs either cultured in separate wells (Fig. 2,
D and E) or in the same wells as wild-type cells (Fig. 2, F and G,
wild-type and plexin C1⫺/⫺ cells discriminated by a prior labeling
with green and red dye, respectively). A39R was effective on wildtype DCs at a wide range of concentrations (Fig. 2H), and importantly, without affecting their viability (Fig. 2I). A39R also inhibited DC adhesion when DCs were cultured on extracellular matrix
substrates such as fibronectin, (see below) collagen IV, or vitronectin (data not shown), which suggested that A39R-induced signal inhibited DC adhesion mediated by integrins. To explore this
possibility, the role of integrins in in vitro DC adhesion on plastic
or on a physiologic substrate like fibronectin was studied.
DC adhesion to plastic. ␤2 integrins confer a general stickiness to
polymorphonuclear granulocytes resulting in their strong adhesion
to many substrates, including plastic (18). To determine the role of
␤2 integrins in DC adhesion to plastic, we cultured DCs on plastic,
in the presence of blocking anti-␤2, or control Abs (isotype control
or blocking anti-␤1), and measured their adhesion (Fig. 3A, left).
Results show that DC adhesion to plastic was dependent on ␤2
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 1. Plexin C1 is preferentially expressed
on DCs and neutrophils and is the only receptor for
A39R. A, Spleen, bone marrow cells (for neutrophils),
or peritoneal exudate cells (for macrophages) were stained
with various Abs combinations plus an Ab against plexin
C1 for flow cytometry. Plexin C1 expression was then
determined on the different subsets using the following
analyze gates: T cells (CD3⫹CD19⫺DX5⫺), B cells
(CD19⫹B220⫹), NK cells (DX5⫹CD3⫺), macrophages
(CD11bbrightF4/80⫹), neutrophils (GR1brightCD11bbright),
DCs (CD11c⫹), CD8⫹ DCs (CD11c⫹CD8⫹), CD8⫺
DCs (CD11c⫹CD8⫺), plasmacytoid DCs (pDCs,
CD19⫺B220⫹Ly6C⫹). Flt3L (FL) bone marrow-derived DCs were stained only with the anti-plexin C1 Ab.
Results are representative of three experiments. B,
Wild-type and plexin C1⫺/⫺ bone marrow-derived DCs
were either stained with the anti-plexin C1 Ab (left panels) or incubated with A39R and then stained with an
Ab against the Flag (right panels). T, T cells; B, B cells;
M␾, macrophages; Neutro, neutrophils; pDCs, plasmacytoid dendritic cells; BMDC, bone marrow-derived
dendritic cells. Results are representative of three
experiments.
54
PLEXIN ENGAGEMENT REGULATES LEUKOCYTE MOVEMENT
integrins as the addition of anti-␤2 Ab reduced DC adhesion to
plastic by 60%. By contrast, a blocking anti-␤1 Ab had no effect
on DC adhesion to plastic and a combination of anti-␤2 and anti␤1 Abs had the same effect than the anti-␤2 Ab alone.
DC adhesion to fibronectin. In vitro adhesion of mouse polymorphonuclear or human Langerhans cells to fibronectin occurs
through ␤1 integrin receptors (19). The effect of blocking anti-␤2,
anti-␤1, or control Abs on DC adhesion to fibronectin was measured (Fig. 3A, right). DC adhesion to fibronectin-coated wells was
reduced by 40% by the anti-␤2 blocking Ab (Fig. 3A, right), showing a residual ␤2 binding to plastic even in the presence of fibronectin. Anti-␤1 Ab alone reduced DC adhesion to fibronectin
by 40% as well. A combination of both Abs had an additive effect
and reduced DC adhesion by 80%. These results show that in these
culture conditions, DC adhesion to fibronectin-coated wells was
mediated at 80% by ␤1 and ␤2 integrins.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 2. A39R prevents DC adhesion to plastic.
A–H, Wild-type (WT) and plexin C1⫺/⫺ bone marrowderived DCs were cultured with medium alone, or medium supplemented with LPS or LPS⫹A39R, as indicated. DCs were cultured for different times (A), or 2 h
(B–H). A and H, the percentage of adherent cells was
measured at the end of the culture as described in Materials and Methods. B–G, Representative confocal microscopy images at the end of the 2 h cultures. F and G,
Wild-type and plexin C1⫺/⫺ DCs have been labeled
with cell tracker red and cell tracker green, respectively,
and then mixed up at a 1:1 ratio before the culture. H,
Wild-type (䡺) and plexin C1⫺/⫺ (F) DCs are represented. Mean adhesion (ⴱ) shown atop bar is statistically different from mean adhesion in the control condition without A39R (p ⬍ 0.01). No symbol indicates
no difference. I, Wild-type DCs were cultured with (䡺)
or without (f) A39R (1 ␮g/ml) and the percentage of
viable cells was measured over time in culture by flow
cytometry as the percentage of propidium iodide-negative cells. The two curves are not statistically different.
Results are representative of at least three experiments.
Effect of A39R on integrin-mediated DC adhesion. Results presented in Fig. 3A show that DC adhesion to plastic or fibronectin was
reduced by 80% by A39R. In particular, the effect of A39R on DC
adhesion to fibronectin was similar than the combined effect of blocking Abs against ␤1 and ␤2 integrins. Thus, plexin C1 engagement by
A39R inhibited DC adhesion mediated by integrins.
These results suggest that integrin function in DCs could be
affected following A39R binding to plexin C1. To further test this
hypothesis, we measured the effect of A39R on the level of FAK
phosphorylation in DCs, as FAK phosphorylation is associated
with integrin activation, i.e., cells expressing active integrins contain a high proportion of Y397-phosphorylated FAK (20–24). As
shown in Fig. 3B, a high proportion of FAK was phosphorylated
on Y397 following a culture in the presence of LPS. By contrast,
LPS/A39R-treated DCs displayed a more reduced proportion of
phosphorylated FAK. Thus A39R-induced signal inhibits integrin
The Journal of Immunology
55
FIGURE 3. A39R inhibits integrin-mediated DC adhesion and inhibits FAK phosphorylation. A, Wild-type
(WT) bone marrow-derived DCs were cultured in medium
supplemented with LPS into uncoated (left) or fibronectincoated (right) wells. A39R or blocking Abs against integrins were added, as indicated. After 2 h of culture, the
percentage of adherent cells was measured, as described in
Materials and Methods. Mean adhesion (ⴱ) atop bar is
significantly different from mean adhesion in the control
condition (Ig ctrl) (p ⬍ 0.001). No symbol indicates no
significant difference. B, FAK phosphorylation was analyzed in DCs at the end of the 2 h culture by immunoprecipitation of total FAK and immunoblotting with antiphospho-FAK (Y397) Ab. Results in are representative of
at least three experiments.
signaling as measured by FAK phosphorylation in DCs, further
supporting the inhibition of integrin function by A39R.
Strong evidence shows that semaphorin binding to plexins induces
actin cytoskeleton rearrangement in neurons or cell lines (3, 5, 9),
a phenomenon associated with cellular retraction. Therefore, we
investigated the effect of A39R on the actin cytoskeleton of DCs.
To better visualize this effect, A39R was added to DCs that had
been previously left to adhere for 2 h. In these conditions, as monitored by time-lapse microscopy, A39R induced a progressive retraction of adherent DC membrane processes within 10 min of
treatment (Fig. 4A). Collapsing DCs displayed multiple spikes
rather than the characteristic lamellipodia that progressively disappeared resulting in a round or loosely adherent cell (Fig. 4A).
This effect was plexin C1-dependent as plexin C1⫺/⫺ DC morphology was not altered in response to A39R (data not shown).
Detection of F-actin with phalloidin in spread, adherent DCs
showed diffuse intracellular pattern and some more intense staining at the edge of the membrane (Fig. 4B, before A39R). Upon
treatment with A39R, the collapse of lamellipodia was associated
with an increase in the intensity of the F-actin staining at the base
of the spikes or within the spikes themselves, consistent with a
local reorganization of the actin cytoskeleton (Fig. 4B, after A39R,
early, and intermediate stages). At a later stage, F-actin staining
was restricted to the perinucleus region of the rounded cell (Fig.
4B, after A39R, final stage). Upon treatment with A39R, FAK
phosphorylation on Y397 progressively decreased (Fig. 4C). After
30 min of treatment with A39R, this phosphorylation was barely
detectable (Fig. 4C) and DCs were detached (Fig. 4D).
Taken together, these results demonstrate that A39R induces a
rearrangement of the actin cytoskeleton, and inhibits FAK phosphorylation in adherent plexin C1 expressing DCs, leading to a retraction
of their membrane processes and inhibition of their adhesion.
A39R effect on DC is blocked by a cofilin phosphorylation
inhibitor
Cofilin binds to and depolymerizes pointed ends of F-actin,
thereby increasing monomeric actin intracellular concentration
leading to an increased F-actin turnover (25, 26). Phosphorylation
of cofilin by kinases like Lin-11-Isl-1-Mec-3 kinase dissociates it
from F-actin and inhibits its F-actin depolymerization activity. Because Sema3A induces actin cytoskeleton rearrangement through
cofilin phosphorylation in neurons (11), we tested the involvement
of cofilin phosphorylation in A39R-induced detachment of DCs.
DCs were cultured in the presence of S3, a synthetic cell-permeable peptide containing a cofilin phosphorylation site that prevents
A39R does not induce maturation of DCs or affects the
maturation induced by CpG oligonucleotides
As DC maturation and activation is associated with changes in
adherence and morphology with reorganization of their cytoskeleton (27–29), we tested whether A39R-induced morphological
changes were associated with DC maturation. First, DCs were cultured with A39R or medium and MHC class II and costimulatory
molecules expression (Fig. 6A) as well as cytokine production
(Fig. 6B) was measured. Fig. 6 shows that A39R did not induce
DC maturation. Then, we cocultured DCs with or without A39R
and stimuli known to induce DC maturation such as a combination
of CpG oligonucleotides with CD40L and GM-CSF. Fig. 6 shows
that A39R addition did not alter DC maturation induced by these
stimuli. Thus, A39R does not induce maturation of DCs or affect
the maturation induced by CpG/CD40L/GM-CSF.
A39R inhibits chemokine-induced DC migration in vitro
Leukocyte trafficking in homeostatic conditions and their recruitment to inflamed sites are regulated by different classes of chemoattractant molecules that regulate leukocyte actin cytoskeleton and their
adhesion molecules such as integrins in a coordinated fashion. To
investigate the effect of A39R semaphorin on DC migration to chemokines, an in vitro chemotaxis assay was used. Wild-type or plexin
C1⫺/⫺ DCs were placed in the upper chamber of a transwell system
and medium or the CCL3 was added to the lower chamber. CCL3 is
known to induce immature DC migration to inflamed sites through its
binding to the chemokine receptor CCR5. When indicated, A39R, or
as a negative control, heat-inactivated A39R were also added to the
lower chamber at different concentrations, alone or in combination
with CCL3. Results presented in Fig. 7 show that CCL3 induced DC
migration to the lower chamber of the transwell system in comparison
with medium alone or A39R alone. Strikingly, A39R, but not heat
inactivated A39R, inhibited wild-type DC migration to CCL3 in a
dose-dependent manner. By contrast, A39R had no effect on plexin
C1⫺/⫺ DC migration induced by CCL3. A similar inhibition of DC
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
A39R induces actin cytoskeleton rearrangement, retraction of
membrane processes, and detachment of adherent DCs
the phosphorylation of endogenous cofilin and its inactivation (11)
or a negative control, scrambled, peptide (RV) before the addition
of A39R or PBS, then DC adhesion was measured. As shown in
Fig. 5, in the absence of peptide, the addition of A39R induced a
detachment of ⬃60% of DCs. Increasing concentration of RV peptide had no effect on this A39R-induced detachment. By contrast,
micromolar concentrations of S3 peptide efficiently inhibited
A39R-induced DC detachment, without increasing DC adhesion in
the control PBS condition. These results suggest that cofilin phosphorylation is a key downstream event in A39R-induced plexin C1
signaling and further link plexin C1 with the regulation of actin
cytoskeleton.
56
PLEXIN ENGAGEMENT REGULATES LEUKOCYTE MOVEMENT
migration by A39R was also observed when the other CCR5 ligands
CCL4 and CCL5 or the CXCR4 ligand stromal cell-derived factor-1
were used as chemoattractants (data not shown). Moreover, A39R
effect was not directional as it had the same effect when added in the
lower chamber with the chemokines than in the upper chamber with
the cells, or in both chambers (data not shown). Thus, plexin C1
engagement by A39R semaphorin inhibits chemokine-induced migration of DCs in vitro.
Discussion
An increasing number of reports show semaphorin/plexin expression in immune cells (15). In particular, several semaphorins seem to
function in the reciprocal stimulation of T cells and APCs through
nonplexin receptors. These semaphorins were thus believed to act
through mechanisms that are different from those that are used in the
nervous system (15). We show in this study for the first time that
semaphorin binding to a plexin can regulate actin cytoskeleton rearrangements as well as integrin function in immune primary cells, in a
similar manner than what was described for neurons.
We found that, in the mouse, plexin C1 was expressed mainly
on DCs and neutrophils. Very little expression of plexin C1 was
measured on B cells, although human plexin C1 was cloned from
a B cell line, indicating a possible difference in plexin C1 expression between human and mouse. A39R did not bind to B cells,
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 4. A39R induces actin cytoskeleton rearrangement, retraction of membrane processes, and detachment of adherent DCs. A, Wild-type (WT)
bone marrow-derived DCs were cultured for 2 h in medium supplemented with LPS onto fibronectin-coated coverslips that were placed on a 37 degrees
heated stage mounted on the confocal microscope. Pictures were taken by confocal time-lapse microscopy at the indicated times after addition of A39R
at a concentration of 1 ␮g/ml. B–D, Wild-type bone marrow-derived DCs were cultured for 2 h in medium supplemented with LPS onto fibronectin-coated
coverslips (B), petri dishes (C), or 96-well plates (D) before the addition of A39R (1 ␮g/ml) for different times. B, The distribution of F-actin in DCs was
visualized by phalloidin staining either before A39R treatment or 15 min after addition of A39R. After A39R treatment, three types of F-actin distribution
were observed corresponding to three stages in the membrane retraction process: “early”, “intermediate,” and “final”. DCs in intermediate and final stages
of membrane retraction were found as soon as 1 min after A39R addition and within the next 15 min after. After 20 min of A39R treatment, at least 95%
of the DCs were in the final stages. C, FAK phosphorylation was analyzed in DCs at the indicated times after addition of A39R by immunoprecipitation
of total FAK and immunoblotting with anti-phospho-FAK (Y397) Ab. D, The number of adherent DCs in each well was measured 30 min after the addition
of different concentrations of A39R. Results are expressed as the mean percentage ⫾ SD of adherent cells relative to the control condition without A39R.
Mean adhesion (ⴱ) shown atop bar is significantly different from mean adhesion in the control condition without A39R (p ⬍ 0.01). No symbol indicates
no significant difference. Results are representative of at least three experiments.
The Journal of Immunology
DCs, or to any other leukocytes from plexin C1⫺/⫺ deficient mice
(our study and data not shown) indicating that plexin C1 is the
unique receptor for A39R on mouse leukocytes.
The inhibitory effect of A39R on DC adhesion was not due to a
down-regulation of either ␤1 or ␤2 integrin expression, measured
by flow cytometry (data not shown). Rather, this inhibition of adhesion was correlated with a dephosphorylation of FAK, a crucial
mediator of integrin signaling, suggesting the inhibition of integrin
function by A39R. We also found that A39R induced a plexin
C1-dependent local increase in F-actin in adherent DCs, accompanied by the retraction of membrane processes and DC detachment. This effect, reminiscent of semaphorin-induced neuron
growth cone collapse, was blocked by a cell permeable peptide
(S3) that inhibits cofilin phosphorylation. Cofilin, a well-known
mediator of F-actin depolymerization, is active in the unphosphorylated state. Thus, by triggering plexin C1, A39R could promote
the phosphorylation of cofilin, which in turn, would reduce F-actin
depolymerization. Aizawa et al. (11), the originators of the S3
peptide, showed a similar phenomenon in Sema3A-treated neu-
FIGURE 6. A39R does not induce maturation of
DCs or affect the maturation induced by CpG oligonucleotides. Bone marrow-derived DCs were cultured for
the indicated times (A) or for 24 h (B) in the indicated
conditions. CpG/CD40L/GM-CSF mixture (CpG) is
shown in A. CD40, CD86, and I-Ab expression was then
measured by flow cytometry (A) or cytokine secretion
was measured in the supernatant (B) as described in
Materials and Methods. Results are representative of
three experiments. A39R addition had no statistical effect on the parameters measured in A and B.
rons, suggesting that cofilin phosphorylation is a central event in
semaphorin-induced signaling in different cell types. It is, however, unclear how cofilin phosphorylation and the reduction of
F-actin turnover may lead to lamellipodia/growth cone retraction.
Barberis et al. (14) recently showed that Sema4D induced disassembly of focal adhesions in plexin B1 transfected COS cells.
Interestingly, they found that this disassembly occurred before the
actin cytoskeleton rearrangement suggesting that integrin inhibition and the resulting loss of adherence was the initial event induced by plexin signaling, causing membrane retraction. It is possible that cofilin phosphorylation occurs as a consequence of the
regulation of integrin function by semaphorins. A direct link between plexins and integrins remains however to be identified.
We found that plexin C1 engagement by A39R could prevent
chemokine-induced migration of DCs. Similarly, a previous study
reported that CD100 and Sema3A semaphorins inhibited chemokine-induced migration of human monocytes in vitro through binding to an unknown receptor (30). This inhibition is not due to an
interference with chemokine receptor signaling. Indeed we found
that A39R did not alter the calcium response induced by chemokines (data not shown). Instead, the mechanism of A39R-induced
inhibition of migration likely involves the inhibition of integrin
function that is critical for leukocyte migration. Thus, in a simple
model, integrin activity could be the molecular switch used by
different guidance molecules either to attract or repel cells. Similarly, following early studies in neurons revealing the repellent
activity of many semaphorins on cultured neurons in vitro, it was
believed that semaphorins were guiding axons by providing them
with “stop” signals in areas where they should not grow. These
signals were thought to be complementary to attractant, chemokine
signals to guide the growing axons. Recent studies in the field of
endothelial cells refined this view. Indeed, Serini et al. (13) showed
that autocrine loops of Sema3 chemorepellents exert an essential
permissive role in the execution of vasculature remodelling by
inhibiting integrin-mediated adhesion of endothelial cells to the
extracellular matrix, allowing the de-adhesion necessary for vascular remodelling. They proposed that such a fine-tuning of integrin-mediated adhesion to the extracellular matrix allows a graded
control of endothelial cell migration rate and redirectioning during
migration. Thus, semaphorin signals could in fact help cells to
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 5. A39R effect on DCs is blocked by a cofilin phosphorylation
inhibitor. Wild-type bone marrow-derived DCs were cultured in medium
supplemented with LPS for 1 h. RV (left) or S3 (right) peptides were then
added at the indicated concentrations and DCs were cultured for one more
hour. A39R or PBS was then added for 30 min, as indicated. The number of
adherent DCs in each well was measured. Results are expressed as the mean
percentage ⫾ SD of adherent cells relative to the control condition without
A39R and without peptide. Paired bars show that mean adhesions (ⴱ) are
significantly different (p ⬍ 0.001). NS, No statistical difference (p ⬎ 0.05).
57
58
PLEXIN ENGAGEMENT REGULATES LEUKOCYTE MOVEMENT
move along a chemokine gradient, provided that both signals are
not delivered in an antagonistic manner, by contributing to the
dynamic of integrin activity. More experiments using semaphorin
and plexin-deficient animals are required to test whether this
model could apply to leukocyte migration. In the case of plexin
C1, the identification of its cognate cellular ligand will also be a
determinant to study its precise function in the regulation of leukocyte movement. Based on in vitro binding studies and homology
with A39R it was suggested that Sema7A is the ligand for plexin
C1 (8). However, our own attempts as well as others (31) have
failed to show any binding of recombinant Sema7A on primary
plexin C1 expressing leukocytes. Moreover, Sema7A has been
shown to promote axon outgrowth in neurons in a plexin C1-independent manner (12).
A39R semaphorin is produced by many strains of poxviruses
and seems to be secreted at very high amounts by virus-infected
cells. A study by Gardner et al. (32) specifically addressed the role
of A39R using different recombinant strains of vaccinia virus in a
model of intradermal infection in mice. The authors reported that
the forced expression of A39R by vaccinia strains that do not normally express it increased the severity and the persistence of skin
lesions. It was, however, unclear whether this phenomenon was
due to an increased immunopathology or to an increased virulence
of the strain. The authors proposed that A39R might have intrinsic
proinflammatory properties in this mouse system. This possibility
was supported by the observation by Comeau et al. (7) that plexin
C1 engagement by A39R induced a modest increase in the production of some proinflammatory cytokines in human monocytes.
However, we did not detect any production of IL-1, IL-2, IL-4,
IL-6, TNF-␣, GM-CSF, IFN-␥ and IL-12p70 by various mouse
leukocytes (spleen cells, bone marrow cells, DCs, neutrophils, B
cells) upon treatment with A39R in vitro (our study and data not
shown), suggesting that a proinflammatory activity for A39R in
mice is unlikely. Thus, we rather favor the hypothesis that A39R
secretion might somehow alter the movement of plexin C1-expressing cells (DCs, monocytes, granulocytes) in the proximity of
Acknowledgments
We especially thank Dr. M. K. Spriggs who initiated the work on semaphorins. We also thank Dr. J. Peschon who generated plexin C1-deficient
mice, S. Wong Madden for the production of A39R protein, K. Schooley,
for technical advice, J. Bradshaw, D. Kaufman, L. Strockbine for technical
help, G. Carlton for graphics assistance, and Drs. D. Fitzpatrick, C. Maliszewski, J. Vakili, and A. Youakim for critical reading of the manuscript.
References
1. Dickson, B. J. 2002. Molecular mechanisms of axon guidance. Science 298:1959.
2. Goshima, Y., T. Ito, Y. Sasaki, and F. Nakamura. 2002. Semaphorins as signals
for cell repulsion and invasion. J. Clin. Invest. 109:993.
3. Nakamura, F., R. G. Kalb, and S. M. Strittmatter. 2000. Molecular basis of semaphorin-mediated axon guidance. J. Neurobiol. 44:219.
4. Tamagnone, L., and P. M. Comoglio. 2000. Signalling by semaphorin receptors:
cell guidance and beyond. Trends Cell Biol. 10:377.
5. Pasterkamp, R. J., and A. L. Kolodkin. 2003. Semaphorin junction: making tracks
toward neural connectivity. Curr. Opin. Neurobiol. 13:79.
6. Kolodkin, A. L., D. J. Matthes, and C. S. Goodman. 1993. The semaphorin genes
encode a family of transmembrane and secreted growth cone guidance molecules.
Cell 75:1389.
7. Comeau, M. R., R. Johnson, R. F. DuBose, M. Petersen, P. Gearing,
T. VandenBos, L. Park, T. Farrah, R. M. Buller, J. I. Cohen, et al. 1998. A
poxvirus-encoded semaphorin induces cytokine production from monocytes and
binds to a novel cellular semaphorin receptor, VESPR. Immunity 8:473.
8. Tamagnone, L., S. Artigiani, H. Chen, Z. He, G. I. Ming, H. Song, A. Chedotal,
M. L. Winberg, C. S. Goodman, M. Poo, et al. 1999. Plexins are a large family
of receptors for transmembrane, secreted, and GPI-anchored semaphorins in vertebrates. Cell 99:71.
9. Castellani, V., and G. Rougon. 2002. Control of semaphorin signaling. Curr.
Opin. Neurobiol. 12:532.
10. Liu, B. P., and S. M. Strittmatter. 2001. Semaphorin-mediated axonal guidance
via Rho-related G proteins. Curr. Opin. Cell Biol. 13:619.
11. Aizawa, H., S. Wakatsuki, A. Ishii, K. Moriyama, Y. Sasaki, K. Ohashi,
Y. Sekine-Aizawa, A. Sehara-Fujisawa, K. Mizuno, Y. Goshima, and I. Yahara.
2001. Phosphorylation of cofilin by LIM-kinase is necessary for semaphorin 3Ainduced growth cone collapse. Nat. Neurosci. 4:367.
12. Pasterkamp, R. J., J. J. Peschon, M. K. Spriggs, and A. L. Kolodkin. 2003.
Semaphorin 7A promotes axon outgrowth through integrins and MAPKs. Nature
424:398.
13. Serini, G., D. Valdembri, S. Zanivan, G. Morterra, C. Burkhardt, F. Caccavari,
L. Zammataro, L. Primo, L. Tamagnone, M. Logan, et al. 2003. Class 3 semaphorins control vascular morphogenesis by inhibiting integrin function. Nature
424:391.
14. Barberis, D., S. Artigiani, A. Casazza, S. Corso, S. Giordano, C. A. Love,
E. Y. Jones, P. M. Comoglio, and L. Tamagnone. 2004. Plexin signaling hampers
integrin-based adhesion, leading to Rho-kinase independent cell rounding, and
inhibiting lamellipodia extension and cell motility. FASEB J. 18:592.
15. Kikutani, H., and A. Kumanogoh. 2003. Semaphorins in interactions between T
cells and antigen-presenting cells. Nat. Rev. Immunol. 3:159.
16. Brasel, K., T. De Smedt, J. L. Smith, and C. R. Maliszewski. 2000. Generation
of murine dendritic cells from flt3-ligand-supplemented bone marrow cultures.
Blood 96:3029.
17. Swetman, C. A., Y. Leverrier, R. Garg, C. H. Gan, A. J. Ridley, D. R. Katz, and
B. M. Chain. 2002. Extension, retraction and contraction in the formation of a
dendritic cell dendrite: distinct roles for Rho GTPases. Eur. J. Immunol. 32:2074.
18. Sixt, M., R. Hallmann, O. Wendler, K. Scharffetter-Kochanek, and
L. M. Sorokin. 2001. Cell adhesion and migration properties of ␤2-integrin negative polymorphonuclear granulocytes on defined extracellular matrix molecules:
relevance for leukocyte extravasation. J. Biol. Chem. 276:18878.
19. Le Varlet, B., M. J. Staquet, C. Dezutter-Dambuyant, P. Delorme, and
D. Schmitt. 1992. In vitro adhesion of human epidermal Langerhans cells to
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 7. A39R inhibits chemokine-induced migration of DCs in
vitro. In vitro wild-type (WT) (䡺) and plexin C1⫺/⫺ (f) DC migration
analysis in a chemotaxis assay toward CCL3 is shown. When indicated
A39R (left) or heat-inactivated A39R (A39RHI) (right) was also added to
the lower chamber of the transwell system, together or not with CCL3.
Values are expressed as follows: (experimental fluorescent counts)/(spontaneous fluorescent counts). Results are presented as the mean ⫾ SD of
triplicate wells, and the experiment was performed four times. Mean migration (ⴱ) is significantly different (p ⬍ 0.001) from mean migration in the
control condition (CCL3 without A39R or heat-inactivated A39R). No
symbol indicates no statistical difference (p ⬎ 0.02).
infected cells. Indeed, the uncontrolled expression of a semaphorin
is predicted to have important consequences on the movement of
responsive cells based on their activity on integrin function, as
illustrated by our in vitro experiments. This effect could benefit the
virus by inhibiting the recruitment of immune effector cells at the
site of virus infection. Another possibility could be that regulating
cell cytoskeleton and shape of neighboring cells could help the
virus to infect them, as recently shown for human T cell leukemia
virus (33).
In conclusion, we found that A39R binding to plexin C1 on
primary mouse DCs induces actin cytoskeleton rearrangement, inhibits integrin-mediated adhesion and FAK phosphorylation, and
impairs chemokine-induced migration in vitro. These data identify
for the first time semaphorins and plexins as potent regulators of
the actin cytoskeleton in the immune system and suggest that they
could be involved in the regulation of leukocyte movement.
The Journal of Immunology
20.
21.
22.
23.
24.
25.
26.
laminin and fibronectin occurs through ␤1 integrin receptors. J. Leukocyte Biol.
51:415.
Burridge, K., C. E. Turner, and L. H. Romer. 1992. Tyrosine phosphorylation of
paxillin and pp125FAK accompanies cell adhesion to extracellular matrix: a role
in cytoskeletal assembly. J. Cell Biol. 119:893.
Guan, J. L., and D. Shalloway. 1992. Regulation of focal adhesion-associated
protein tyrosine kinase by both cellular adhesion and oncogenic transformation.
Nature 358:690.
Hanks, S. K., M. B. Calalb, M. C. Harper, and S. K. Patel. 1992. Focal adhesion
protein-tyrosine kinase phosphorylated in response to cell attachment to fibronectin. Proc. Natl. Acad. Sci. USA 89:8487.
Lipfert, L., B. Haimovich, M. D. Schaller, B. S. Cobb, J. T. Parsons, and
J. S. Brugge. 1992. Integrin-dependent phosphorylation and activation of the
protein tyrosine kinase pp125FAK in platelets. J. Cell Biol. 119:905.
Schaller, M. D., C. A. Borgman, B. S. Cobb, R. R. Vines, A. B. Reynolds, and
J. T. Parsons. 1992. pp125FAK a structurally distinctive protein-tyrosine kinase
associated with focal adhesions. Proc. Natl. Acad. Sci. USA 89:5192.
Arber, S., F. A. Barbayannis, H. Hanser, C. Schneider, C. A. Stanyon,
O. Bernard, and P. Caroni. 1998. Regulation of actin dynamics through phosphorylation of cofilin by LIM-kinase. Nature 393:805.
Lawler, S. 1999. Regulation of actin dynamics: the LIM kinase connection. Curr.
Biol. 9:R800.
59
27. Winzler, C., P. Rovere, M. Rescigno, F. Granucci, G. Penna, L. Adorini,
V. S. Zimmermann, J. Davoust, and P. Ricciardi-Castagnoli. 1997. Maturation
stages of mouse dendritic cells in growth factor-dependent long-term cultures.
J. Exp. Med. 185:317.
28. Granucci, F., F. Petralia, M. Urbano, S. Citterio, F. Di Tota, L. Santambrogio, and
P. Ricciardi-Castagnoli. 2003. The scavenger receptor MARCO mediates cytoskeleton rearrangements in dendritic cells and microglia. Blood 102:2940.
29. Burns, S., S. J. Hardy, J. Buddle, K. L. Yong, G. E. Jones, and A. J. Thrasher.
2004. Maturation of DC is associated with changes in motile characteristics and
adherence. Cell Motil. Cytoskeleton 57:118.
30. Delaire, S., C. Billard, R. Tordjman, A. Chedotal, A. Elhabazi, A. Bensussan, and
L. Boumsell. 2001. Biological activity of soluble CD100. II: soluble CD100,
similarly to H-SemaIII, inhibits immune cell migration. J. Immunol. 166:4348.
31. Holmes, S., A. M. Downs, A. Fosberry, P. D. Hayes, D. Michalovich,
P. Murdoch, K. Moores, J. Fox, K. Deen, G. Pettman, T. Wattam, and C. Lewis.
2002. Sema7A is a potent monocyte stimulator. Scand. J. Immunol. 56:270.
32. Gardner, J. D., D. C. Tscharke, P. C. Reading, and G. L. Smith. 2001. Vaccinia
virus semaphorin A39R is a 50 –55 kDa secreted glycoprotein that affects the
outcome of infection in a murine intradermal model. J. Gen. Virol. 82:2083.
33. Igakura, T., J. C. Stinchcombe, P. K. Goon, G. P. Taylor, J. N. Weber,
G. M. Griffiths, Y. Tanaka, M. Osame, and C. R. Bangham. 2003. Spread of
HTLV-I between lymphocytes by virus-induced polarization of the cytoskeleton.
Science 299:1713.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017