Download Frequent and histological type-specific inactivation of 14-3

ã
Oncogene (2002) 21, 2418 ± 2424
2002 Nature Publishing Group All rights reserved 0950 ± 9232/02 $25.00
www.nature.com/onc
Frequent and histological type-speci®c inactivation of 14-3-3s in human
lung cancers
Hirotaka Osada*,1, Yoshio Tatematsu1, Yasushi Yatabe2, Taku Nakagawa1, Hiroyuki Konishi1,
Tomoko Harano1, Ekmel Tezel1, Minoru Takada3 and Takashi Takahashi1
1
Division of Molecular Oncology, Aichi Cancer Center Research Institute, 1-1 Kanokoden, Chikusa-ku, Nagoya 464-8681, Japan;
Department of Pathology and Molecular Diagnostics, Aichi Cancer Center Hospital, 1-1 Kanokoden, Chikusa-ku, Nagoya 4648681, Japan; 3Pulmonary Medicine, Rinku General Medical Center, Izumisano-shi, Osaka 598-8577, Japan
2
One isoform of the 14-3-3 family, 14-3-3s, plays a
crucial role in the G2 checkpoint by sequestering Cdc2cyclinB1 in the cytoplasm, and the expression of 14-3-3s
is frequently lost in breast cancers. This loss of
expression is thought to cause a G2 checkpoint defect,
resulting in chromosomal aberrations. Since lung cancers
frequently carry numerous chromosomal aberrations, we
examined the DNA methylation status and expression
level of the 14-3-3s gene in 37 lung cancer cell lines and
30 primary lung tumor specimens. We found that small
cell lung cancer (SCLC) cell lines frequently showed
DNA hypermethylation (9 of 13 lines, 69%), and
subsequent silencing of the 14-3-3s gene. Among nonsmall cell lung cancers (NSCLC), large cell lung cancer
cell lines showed frequent hypermethylation and silencing
of 14-3-3s (4 or 7 lines, 57%). In contrast, in other
NSCLC cell lines, hypermethylation occurred very rarely
(1 of 17 lines, 6%). All eight primary SCLC specimens
examined also showed a loss or signi®cant reduction in
14-3-3s expression in vivo, while a loss or reduction of
14-3-3s expression was very rare in primary NSCLC
specimens (1 of 22 tissues, 5%). This is the ®rst
description that indicates lung cancers frequently show
signi®cant inactivation of the 14-3-3s gene mainly due to
DNA hypermethylation in SCLC, but rarely in NSCLC,
suggesting involvement of the 14-3-3s gene in lung
tumorigenesis in a histological type-speci®c manner.
Oncogene (2002) 21, 2418 ± 2424. DOI: 10.1038/sj/
onc/1205303
Keywords: lung cancer; 14-3-3s; methylation; MSP
Lung cancer currently claims more than 160 000 lives
annually as the number one cause of cancer deaths in
the United States (Minna et al., 1997), while it has also
become the leading cause of cancer death in Japan,
with over 50 000 fatalities annually. A better understanding of the molecular pathogenesis of this disease
is urgently required to develop a preventative or
*Correspondence: H Osada; E-mail: [email protected]
Received 6 September 2001; revised 3 January 2002; accepted 8
January 2002
therapeutic breakthrough to drastically reduce the
number of deaths. Molecular biological studies have
provided clear evidence of multi-step accumulations of
multiple genetic and epigenetic alterations in both
tumor suppressor genes and dominant oncogenes
(Sekido et al., 1998). Lung cancer cells have also been
frequently shown to carry structural and numerical
changes in chromosomes (Testa, 1996). Proper cellcycle checkpoints are thought to maintain the genomic
integrity, and their abrogation contributes to genomic
instability (Dhar et al., 2000). Recently, we found that
chromosomal instability is a common feature of lung
cancer cell lines in association with the presence of
signi®cant aneuploidy (Haruki et al., 2001), and that
lung cancers frequently carry defects in the G1 and
mitotic checkpoints, which may be correlated with
chromosomal aberrations (Takahashi et al., 1989,
1999).
The 14-3-3 proteins function as adaptor proteins
recognizing phospho-serine motifs, and regulate the
interactions and subcellular localization of signaling
molecules. Recent evidence demonstrated that 14-3-3s
protein plays a crucial role in the G2 checkpoint by
sequestering Cdc2 ± cyclinB1 in the cytoplasm (Chan et
al., 1999), and that the expression of 14-3-3s is
frequently lost in breast cancers (Ferguson et al.,
2000). We therefore speculated that 14-3-3s inactivation might also occur in lung cancers, which frequently
carry numerous chromosomal aberrations. We report
here, for the ®rst time, that in lung cancers, the 14-3-3s
gene is frequently inactivated due to hypermethylation
in a histological type-speci®c manner.
The DNA methylation status of the 14-3-3s gene in
13 SCLC and 24 NSCLC (adeno 9, squamous 6,
Adenosquamous 2, large 7) cell lines was studied using
the bisul®te conversion and methylation-speci®c PCR
techniques (MSP) (Figure 1) (Ferguson et al., 2000).
The incidence of hypermethylation was dramatically
di€erent depending upon the histological type. Five
(38%) of 13 SCLC cell lines showed methylationspeci®c PCR ampli®cation (Figure 1, lane M) without
unmethylated products (Figure 1, lane U), suggesting
complete hypermethylation. In addition, four SCLC
cell lines (31%) showed PCR products both with
methylation-speci®c and non-methylation-speci®c pri-
14-3-3s inactivation in SCLC
H Osada et al
2419
Figure 1 Methylation speci®c-PCR (MSP) of the 14-3-3s gene in lung cancer cell lines. Genomic DNA of lung cancer cell lines
was treated with the sodium bisul®te conversion technique essentially as described (Clark et al., 1994), and ampli®ed with PCR
using primers speci®c for the methylated allele (sense; 5'-TGGTAGTTTTTATGAAAGGCGTC (+135/+157), anti-sense; 5'CCTCTAACCGCCCACCACG (+220/+238)) or the unmethylated allele (sense; 5'-ATGGTAGTTTTTATGAAAGGTGTT
(+134/+157), anti-sense; 5'-CCCTCTAACCACCCACCACA (+220/+239)) (Ferguson et al., 2000). SCLC and large cell
carcinoma cell lines frequently showed hypermethylation patterns, which were rarely observed in other NSCLC cell lines. PCR
product with methylation-speci®c or unmethylated allele-speci®c primers are shown in lane M or U of each cell line. The ®ndings of
MSP analysis of each cell line are also indicated below the gel (+, complete methylation; +, partial methylation; 7, unmethylated).
(Ad, adenocarinoma; Sq, squamous carcinoma; AdSq, adenosquamous carcinoma; La, large cell carcinoma; Sm, small cell lung
cancer)
mers, suggesting `partial' methylation. In total, nine
SCLC cell lines (69%) demonstrated hypermethylation
of the 14-3-3s gene. The other four SCLC cell lines
showed unmethylated patterns. In addition to the
SCLC lines, large cell lung cancer lines among NSCLC
cell lines also frequently showed hypermethylation
(three complete and one partial methylation in seven
cell lines, 57%). In contrast, only one cell line of 17
other NSCLC cell lines showed partial DNA methylation (6%).
To con®rm quantitatively the correlation between
14-3-3s expression and DNA methylation status, the
14-3-3s expression was studied by Northern and
Western blot analyses (Figure 2). A loss or signi®cant
reduction in 14-3-3s transcripts was observed in all six
SCLC lines with hypermethylation, while two SCLC
lines without DNA methylation showed abundant gene
transcripts (Figure 2a). In addition, all four large cell
carcinoma cell lines with hypermethylation showed a
loss of 14-3-3s transcripts (Figure 2b). Only two of
eight (25%) NSCLC lines (ACC-LC-176 and 73),
excluding large cell carcinoma cell lines, showed only
a moderate reduction in 14-3-3s transcripts, while the
other six NSCLC cell lines (75%) showed abundant 143-3s transcripts (Figure 2b).
A signi®cant reduction in 14-3-3s expression was
also detected at the protein level (Figure 2c). Similar to
the ®ndings of Northern analysis, all six cell lines of
SCLC with hypermethylation showed a loss or
signi®cant reduction of 14-3-3s protein. In contrast,
two SCLC cell lines without DNA methylation showed
abundant 14-3-3s proteins. Large cell carcinoma cell
lines with hypermethylation also showed a loss of 14-33s proteins.
Five cell lines of SCLC or large cell carcinoma
showed a `partial methylation' pattern on MSP study,
Oncogene
14-3-3s inactivation in SCLC
H Osada et al
2420
Figure 2 Expression analysis and summary of inactivation of the 14-3-3s gene in SCLC and NSCLC cell lines. Northern blot
analysis was performed using 5 mg of total RNA according to the standard procedure (Osada et al., 1996). The 397 bp RT ± PCR
product was generated by RT ± PCR using primers (sense; 5'-CCTGCTGGACAGCCACCTCA, anti-sense; 5'TGTCGGCCGTCCACAGTGTC), and was used as a probe for 14-3-3s mRNA after sequence veri®cation. Ten mg of cell lysate
was applied to SDS ± PAGE and transferred to Immobilon P (Millipore). Western blot analysis was performed with anti-human 143-3s antibody (N-14) (Santa Cruz Biotechnology) and with anti-lamin B antibody (C-20) as an internal control (Santa Cruz
Biotechnology). (a) 14-3-3s transcripts were frequently lost in SCLC lines, consistent with the DNA methylation status. (b) NSCLC
lines showed abundant expression of the 14-3-3s gene, excluding large cell carcinoma cell lines with DNA methylation. (c)
Alterations in 14-3-3s protein expression are also correlated with DNA methylation and transcriptional alterations. The 14-3-3s
protein is hardly detected in SCLC and large cell carcinoma cell lines with DNA methylation. The results of MSP analysis are
shown (+, +, 7) as in Figure 1
which might indicate clonal heterogeneity or the
presence of both methylated and unmethylated alleles
in the whole population. To clarify this issue, we
performed sequencing analysis of cloned PCR products
corresponding to the region with 7 CpG sites which we
studied with MSP analysis. The methylation status of
each CpG site in the cloned PCR products is shown in
Figure 3. The SCLC cell lines with the MSP pattern of
Oncogene
`complete methylation' showed that almost all CpG
sites were methylated (methylation rate; 96%), while in
the SCLC cell lines showing the `unmethylated' MSP
pattern almost all CpG sites were unmethylated
(0*6%), supporting the results of MSP study. In the
SCLC cell lines with the MSP pattern of `partial
methylation', all alleles were methylated, although the
methylation rate was slightly reduced (68*89%), and
14-3-3s inactivation in SCLC
H Osada et al
2421
Figure 3 Sequencing analysis of DNA methylation of lung cancer cell lines. Genomic DNA treated with the sodium bisul®te
conversion was ampli®ed with PCR using primers for 14-3-3s gene corresponding to just outside the region studied in MSP analysis
(F2; 5'-GAAYGTTATGAGGATATGGTAG (+119/+140), R2; 5'-TAAACAACACCCTCCAAACAAC (+239/+260)). The
PCR products were cloned into pBluescript II (Stratagene) and sequenced with ABI 3100 sequencer (Applied Biosystems). The
methylation status of the seven CpG sites of each cloned PCR product was shown (open circle; unmethylated, closed circle;
methylated). In ®ve cell lines of SCLC or large cell carcinoma showing a `partial methylation' pattern in the MSP study, most CpG
sites were methylated, although the methylation rate was slightly less (68*89%) than that in the SCLC lines with `complete
methylation' (96%). In contrast, the SCLC lines with an unmethylated MSP pattern and QG56 (squamous carcinoma) were almost
completely unmethylated. The results of MSP analysis are indicated (M+, M+, M7) as in Figure 1
several unmethylated CpG sites were randomly
dispersed. The ®rst and second CpG sites and sixth
and seventh CpG sites corresponded to forward and
reverse MSP primers, respectively. In some PCR
clones, these pair of CpG sites were unmethylated.
Those partially methylated DNA templates can be
ampli®ed by unmethylated allele-speci®c primers as
well as methylation-speci®c primers (data not shown).
Therefore, the MSP pattern of `partial methylation'
simply indicated a slight reduction of methylation rate
in comparison with the MSP pattern of `complete
methylation', and did not imply clonal heterogeneity
or presence of both methylated and unmethylated
alleles.
The expression levels of the 14-3-3s gene in 30
primary tumor specimens were immunohistochemically
studied using anti-14-3-3s antibodies (Figure 4). The
marked histological type-speci®c alterations in 14-3-3s
expression were also observed in primary specimens as
well as in cell lines. Seven of eight SCLC cases
(87.5%) showed a complete loss of staining for the 143-3s protein (Figure 4a,b, closed arrow) in contrast to
the strong staining of normal bronchial epithelium
(Figure 4a,b, open arrowheads). Only one case of
SCLC showed 14-3-3s expression, but the intensity of
the immunohistochemical staining was signi®cantly
reduced (data not shown). Therefore, all eight SCLC
tissue samples showed alterations in 14-3-3s expression (Figure 4d). Of 22 NSCLC cases, only one (large
cell cancer) (5%) showed reduced expression of the
14-3-3s protein (data not shown). The other 21
NSCLC showed abundant expression of the 14-3-3s
protein along with normal bronchial epithelium
(Figure 4c,d).
Next, we also studied the DNA methylation status of
primary SCLC tissue specimens using the MSP
technique, and found that some (8/24, 33%), not all,
SCLC tissue specimens without 14-3-3s expression
showed a methylation pattern (data not shown). We
further examined the precise in vivo status of DNA
methylation in primary SCLC tissues using microdissected specimens to obtain pure tumor cells. In two
microdissected SCLC specimens, one SCLC tissue
(L421) clearly showed the complete methylation
pattern, while the other SCLC tissue (L662) showed
nearly complete unmethylated pattern (Figure 4e),
although in both tissues a loss of 14-3-3s expression
was clearly detected with immunohistochemical analysis (Figure 4a,b). We also found unexpectedly that
normal lung tissues also showed a hypermethylation
pattern (Figure 4f). Immunohistochemical staining
showed abundant expression of 14-3-3s proteins in
the bronchial epithelium; while non-epithelial cells did
not. Consistent with this observation, bronchial
epithelia showed unmethylated patterns, while nonepithelial tissues (stroma) showed complete hypermethylation patterns (Figure 4f). We remarked that
the methylation of non-epithelial cells in normal
mammary tissue was also recently reported (Umbricht
et al., 2001).
This study demonstrated for the ®rst time frequent
and histological type-speci®c inactivation of the 14-33s gene in lung cancers. Although genetic alterations of
14-3-3s gene in lung cancers has not been reported to
Oncogene
14-3-3s inactivation in SCLC
H Osada et al
2422
date (Nomoto et al., 2000), recent reports showed that
the expression of 14-3-3s is frequently lost in breast,
gastric, and hepatocellular carcinomas (Ferguson et al.,
2000; Suzuki et al., 2000; Iwata et al., 2000; Umbricht
et al., 2001). We found that expression of the 14-3-3s
gene was frequently lost in SCLC and large cell
Figure 4 Immunohistochemical analysis (IHC) and methylation of primary lung tumor specimens. A panel of 30 lung tumors
consisting of eight small cell carcinomas, 13 adenocarcinomas, seven squamous carcinomas, and two large cell carcinomas, were
examined in this study. Sections 3 mm thick from 10% formalin-®xed, paran-embedded specimens were prepared for IHC analysis.
The standard avidin ± biotin ± peroxidase complex method was performed, using polyclonal anti-14-3-3s antibodies (a ± c).
Microwave treatment in citrate bu€er (pH 6.8) was used for antigen retrieval. Non-neoplastic bronchial epithelial cells served as
internal controls for antigen preservation. (a and b) Both primary SCLC specimens, L421 with methylation (a) and L662 without
methylation (b), showed loss of 14-3-3s expression (arrow), while normal bronchial epithelia showed abundant expression (open
arrowheads). A loss of 14-3-3s expression was similarly observed in almost all SCLC specimens. (c) IHC of a primary squamous
carcinoma tissue specimen. Almost all NSCLC specimens showed abundant expression of 14-3-3s proteins (arrow) similar to normal
bronchial epithelium (open arrowhead). (d) The ®ndings of IHC analysis of primary lung cancer specimens. All SCLC cases showed
alterations in 14-3-3s expression in contrast to NSCLC cases. (e) Sequencing analysis of DNA methylation of primary SCLC
specimens. DNA methylation status in two microdissected specimens of SCLC (L421 and L662) was studied as in Figure 3. L421
showed hypermethylation, while in L662 the 14-3-3s gene was almost completely unmethylated, although both specimens showed
the loss of 14-3-3s expression on IHC study (a and b). (f) MSP analysis of normal lung tissues. Normal bronchial epithelial cells
showed unmethylated patterns, while non-epithelial cells (stroma) showed complete methylation patterns, resulting in a partial
methylation pattern for the entire lung (normal lung). We also found that primary NSCLC tissues frequently showed a `partial
methylation' pattern because of the contamination of non-epithelial tissues (data not shown). The immortalized normal bronchial
cell line BEAS2B showed unmethylated patterns
Oncogene
14-3-3s inactivation in SCLC
H Osada et al
carcinomas, while other NSCLC did not show a loss of
14-3-3s expression. Therefore, these ®ndings suggest
that inactivation of 14-3-3s may play a crucial role in
SCLC and large cell carcinoma pathogenesis.
The 14-3-3s gene is reported to be induced after
DNA damage in a p53-dependent manner (Hermeking
et al., 1997), and to play a role in the G2 checkpoint by
sequestering the Cdc2/cyclinB1 complex (Chan et al.,
1999). Experimental inactivation of the 14-3-3s gene
causes a G2 checkpoint defect, and results in
accumulation of chromosomal aberrations (Dhar et
al., 2000). Indeed, we recently found that SCLC cell
lines frequently showed a defect of G2 checkpoint
(Konishi et al., 2002), which might be attributable to a
loss of 14-3-3s expression. The G2 checkpoint defect
may lead to chromosomal aberrations, and increase the
sensitivity to the DNA damaging events. In this
context, it is of interest that SCLC is highly sensitive
to irradiation and chemotherapeutic agents. It will also
be intriguing to investigate the integrity of G2
checkpoint in large cell carcinomas lacking 14-3-3s
expression.
Histological type-speci®c methylation of the 14-3-3s
gene suggests that the pathogenesis of SCLC and
possibly a fraction of large cell carcinoma may be
based on unique tumorigenetic steps, di€erent from
other NSCLC. The well-known growth inhibitory
pathway of p16INK4A ± cyclinD/Cdk4 ± Retinoblastoma
(RB) was frequently disrupted in lung cancers in a
histological type-speci®c manner. The p16INK4A gene
was frequently inactivated in NSCLC, mainly by
hypermethylation of its promoter region, while RB,
instead of p16INK4A, was frequently disrupted in SCLC
(Kelley et al., 1995). A histological type-speci®c
alteration was also noted in the KRAS gene.
Activating mutations of the KRAS gene occur mainly
in adenocarcinomas, occasionally in other NSCLC, but
very rarely in SCLC (Tsuchiya et al., 1995). Alternatively, the histological type-speci®c methylation of
the 14-3-3s gene suggests that SCLC and a fraction of
large cell carcinoma develop along unique di€erentiation, di€erent from other NSCLC. In this context,
almost all SCLC and some large cell carcinomas show
neuroendocrine features (Travis et al., 1991), suggesting a possible correlation between 14-3-3s inactivation
and neuroendocrine di€erentiation.
In the study of cell lines, the clear correlation
between hypermethylation and silencing of 14-3-3s was
observed. However, in the analysis of microdissected
specimens of primary SCLC tissues, one SCLC tissue
showed an unmethylated pattern despite complete loss
of 14-3-3s expression in the immunohistological
analysis, suggesting that DNA methylation-independent mechanism may also be involved in the loss of 143-3s expression in primary tumors. In this regard, we
have shown that an alteration of the chromatin
structure plays a signi®cant role in the extinction of
transforming growth factor-b type II receptor expression in lung cancers (Osada et al., 2001). It is possible
that, in the established cell lines, the silencing of the 143-3s gene might have been enforced by hypermethylation, because all cell lines without 14-3-3s expression
showed hypermethylation. Possible methylation-independent mechanisms in primary tumors remains to be
elucidated to better understand the regulation of 14-33s expression.
In summary, we have shown for the ®rst time that
14-3-3s is frequently inactivated in SCLC and large cell
carcinomas mainly by DNA hypermethylation. Histological type-speci®c inactivation of the 14-3-3s gene
suggests that its biological role in carcinogenesis di€ers
among SCLC, large cell carcinoma, and other NSCLC,
and that diverse cell cycle checkpoint impairments may
be involved in lung cancers, possibly in a histological
type-speci®c manner. Clari®cation of the biological
signi®cance of the 14-3-3s gene and its inactivation in
SCLC may provide important clues for a better
understanding of SCLC, and development of new
therapeutic approaches for SCLC, the most aggressive
type of lung cancer.
2423
Acknowledgments
This work was supported in part by a Grant-in-Aid for the
Second Term Comprehensive Ten-Year Strategy for Cancer Control and a Grant-in-Aid for Cancer Research from
the Ministry of Health, Labour, and Welfare, Japan; as
well as a Grant-in-Aid for Scienti®c Research (C) from the
Ministry of Education, Science, Sports and Culture, Japan.
We would also like to thank Drs CC Harris (National
Cancer Institute), LJ Old (Memorial Sloan Kettering
Cancer Center), M Akiyama (Radiation E€ect Research
Foundation), and Y Hayata (Tokyo Medical University)
for their generous gifts of cell lines.
References
Chan TA, Hermeking H, Lengauer C, Kinzler KW and
Vogelstein B. (1999). Nature., 401, 616 ± 620.
Clark SJ, Harrison J, Paul CL and Frommer M. (1994).
Nucleic Acids Res., 22, 2990 ± 2997.
Dhar S, Squire JA, Hande MP, Wellinger RJ and Pandita
TK. (2000). Mol. Cell. Biol., 20, 7764 ± 7772.
Ferguson AT, Evron E, Umbricht CB, Pandita TK, Chan
TA, Hermeking H, Marks JR, Lambers AR, Futreal PA,
Stampfer MR and Sukumar S. (2000). Proc. Natl. Acad.
Sci. USA, 97, 6049 ± 6054.
Haruki N, Harano T, Masuda A, Kiyono T, Takahashi T,
Tatematsu Y, Shimizu S, Mitsudomi T, Konishi H, Osada
H, Fujii Y and Takahashi T. (2001). Am. J. Pathol., 159,
1345 ± 1352.
Hermeking H, Lengauer C, Polyak K, He TC, Zhang L,
Thiagalingam S, Kinzler KW and Vogelstein B. (1997).
Mol. Cell, 1, 3 ± 11.
Oncogene
14-3-3s inactivation in SCLC
H Osada et al
2424
Oncogene
Iwata N, Yamamoto H, Sasaki S, Itoh F, Suzuki H, Kikuchi
T, Kaneto H, Iku S, Ozeki I, Karino Y, Satoh T, Toyota J,
Satoh M, Endo T and Imai K. (2000). Oncogene, 19,
5298 ± 5302.
Kelley M, Nakagawa K, Steinberg S, Mulshine J, Kamb A
and Johnson B. (1995). J. Natl. Cancer Inst., 87, 756 ± 761.
Konishi H, Nakagawa T, Harano T, Mizuno K, Saito H,
Masuda A, Matsuda H, Osada H and Takahashi T. (2002)
Cancer Res., 62, 271 ± 276.
Minna J, Sekido Y, Fong K and Gazdar A. (1997). Cancer
Principles & Practice of Oncology. Vol 1. Devita Jr, V,
Hellman S & Rosenberg S (eds). Philadelphia: LippincottRaven, pp. 849 ± 857.
Nomoto S, Haruki N, Tatematsu Y, Konishi H, Mitsudomi
T and Takahashi, T. (2000). Genes Chromosomes Cancer,
28, 342 ± 346.
Osada H, Hasada K, Inazawa J, Uchida K, Ueda R,
Takahashi T and Takahashi T. (1996). Biochem Biophys
Res. Commun., 229, 582 ± 589.
Osada H, Tatematsu Y, Masuda A, Saito T, Sugiyama M,
Yanagisawa K and Takahashi T. (2001). Cancer Res., 61,
8331 ± 8339.
Sekido Y, Fong K and Minna J. (1998). Biochim. Biophys.
Acta, 1378, F21 ± F57.
Suzuki H, Itoh F, Toyota M, Kikuchi T, Kakiuchi H and
Imai K. (2000). Cancer Res., 60, 4353 ± 4357.
Takahashi T, Haruki N, Nomoto S, Masuda A, Saji S, Osada
H and Takahashi T. (1999). Oncogene, 18, 4295 ± 4300.
Takahashi T, Nau MM, Chiba I, Birrer MJ, Rosenberg RK,
Vinocour M, Levitt M, Pass H, Gazdar AF and Minna JD.
(1989). Science, 246, 491 ± 494.
Testa J. (1996). Lung cancer: principles and practice. Pass H,
Mitchell J, Johnson D and Turrisi A (eds). Philadelphia:
Lippincott-Raven pp 55 ± 71.
Travis WD, Linnoila RI, Tsokos MG, Hitchcock CL, Cutler
Jr GB, Nieman L, Chrousos G, Pass H and Doppman J.
(1991). Am. J. Surg. Pathol., 15, 529 ± 553.
Tsuchiya E, Furuta R, Wada N, Nakagawa K, Ishikawa Y,
Kawabuchi B, Nakamura Y and Sugano H. (1995). J.
Cancer Res. Clin. Oncol., 121, 577 ± 581.
Umbricht CB, Evron E, Gabrielson E, Ferguson A, Marks J
and Sukumar S. (2001). Oncogene, 20, 3348 ± 3353.