Download Protection of Drosophila chromosome ends with minimal telomere

Protection of Drosophila chromosome ends with minimal telomere capping
Raphaëlle Dubruille and Benjamin Loppin
Centre de Génétique et de Physiologie Moléculaire et Cellulaire, CNRS UMR 5534, Université
Claude Bernard Lyon 1, Université de Lyon, 69100 Villeurbanne, France
Keywords: Drosophila melanogaster, telomere, capping protein, male germline, spermatogenesis.
Corresponding author: Benjamin Loppin
Centre de Génétique et de Physiologie Moléculaire et Cellulaire, CNRS UMR 5534, Université
Claude Bernard Lyon 1, 16 rue Raphaël Dubois Bat G. Mendel 69100 Villeurbanne, France
Phone: +33 472 447 926
E-mail: [email protected]
Journal of Cell Science
Accepted manuscript
© 2015. Published by The Company of Biologists Ltd.
JCS Advance Online Article. Posted on 23 April 2015
Accepted manuscript
Journal of Cell Science
Abstract
In Drosophila, telomere capping proteins have the remarkable capacity to recognize
chromosome ends in a sequence-independent manner. This epigenetic protection is essential
to prevent catastrophic ligations of chromosome extremities. Interestingly, capping proteins
occupy a large telomere chromatin domain of several kilobases whose functional relevance to
end protection is unknown. Here, we investigated the role of the large capping domain by
manipulating HOAP capping protein expression in the male germ cells where telomere
protection can be challenged without compromising viability. We show that the exhaustion of
HOAP results in a dramatic reduction of other capping proteins at telomeres, including K81,
which is essential for male fertility. Strikingly however, we demonstrate that, although
capping complexes are barely detected in HOAP-depleted male germ cells, telomere
protection and male fertility are not dramatically affected. Our study thus demonstrates that
efficient protection of Drosophila telomeres can be achieved with surprisingly low amounts of
capping complexes. We propose that these complexes prevent fusions by acting at the very
extremity of chromosomes, reminiscent of the protection conferred by extremely short
telomeric arrays in yeast or mammalian systems.
Introduction
Telomeres are specialized structures that organize extremities of linear chromosomes in a way
that prevent their recognition as DNA double-strand breaks (DSBs) by the DNA repair machinery.
Another important function of telomeres is to counteract the gradual erosion of chromosomes that
naturally occurs over cell divisions and results from the incomplete replication of DNA ends
(reviewed in Fulcher et al. 2013). In the vast majority of eukaryotes, including human and yeasts,
telomeres consist in arrays of variable length (from several hundred base pairs in yeast to 5-60 kb in
mammals) of small G-rich DNA repeats that are added by the enzymatic complex telomerase
(reviewed in Jain and Cooper 2010). These DNA repeats are specifically recognized and bound by
capping protein complexes that inhibit the processing of chromosome extremities by the nonhomologous end-joining (NHEJ) repair pathway (reviewed in Oganesian and Karlseder 2009). In
mammals, for instance, TRF1/TRF2 recognize the TTAGGG repeats and interact with other capping
proteins of the Shelterin complex (reviewed in Palm and de Lange 2008; Stewart et al. 2012; Lu et al.
2013).
Dipterans represent an exception in metazoa as they lack telomerase (Mason et al. 2008;
Villasante et al. 2008). Telomere elongation thus uses different mechanisms such as homologous
recombination or transposition of telomere-specific retrotransposons. In Drosophila melanogaster,
terminal sequences contain an array – called the HTT array - of complete and incomplete copies of
Accepted manuscript
Journal of Cell Science
three non-LTR retrotransposons (Het-A, TAHRE and TART) (reviewed in Pardue and DeBaryshe
2011), that has been estimated to vary in length from ca. 20 to 150 kb (Capkova Frydrychova et al.
2008). Drosophila chromosome ends are also bound by a protective protein complex that constitutes
a functional analog of the mammalian Shelterin complex (Raffa et al. 2011; 2013). This capping
complex includes the fast evolving, non conserved proteins HP1/ORC-associated protein (HOAP),
HipHop, Verrocchio (Ver) and Modigliani (Moi), which are called Terminin proteins, and the
conserved Heterochromatin Protein 1a (HP1a) (Raffa et al. 2011; 2013). Whereas HP1a localizes not
only at telomeres but also throughout heterochromatin and at many euchromatic loci, Terminin
proteins are specifically enriched at telomeres throughout the cell cycle and are involved in
chromosome end protection. Capping proteins are essential for viability and loss-of-function mutants
usually die during larval stages, displaying chromosome end-to-end fusions at high frequency in
rapidly dividing cells (Fanti et al. 1998; Cenci et al. 2003; Raffa et al. 2009; 2010; Gao et al. 2010).
In addition, and despite the fact that HOAP, HipHop, Ver and Moi are not conserved outside
Drosophilidae and closely related Diptera, these proteins share some properties with their
mammalian or yeast counterparts (Cenci et al. 2005). For instance, Ver and Moi localize exclusively
at the tip of the chromosome end where Ver would bind the single stranded DNA 3’-overhang
through its OB-fold domain, in a way similar to POT1 in mammals (Raffa et al. 2010; 2013). By
contrast, HOAP, HipHop and HP1a form a complex that localizes not only in the direct vicinity of
the chromosome extremities, where HOAP interacts directly with Moi (Raffa et al. 2009), but also
occupies a relatively large terminal region of at least 10 kb (Gao et al. 2010). Importantly, unlike
their mammalian counterparts, Drosophila capping proteins all share the remarkable property of
recognizing chromosome ends independently of the underlying DNA sequence (Perrini et al. 2004;
Cenci et al. 2005; Pimpinelli 2006; Rong 2008; Raffa et al. 2013). Indeed, chromosomes with a
terminal deletion that completely removes the HTT array can be generated and maintained through
generations (Levis 1989; Ahmad and Golic 1998; Gao et al. 2010). Remarkably, such chromosomes
accumulate an apparently normal amount of capping proteins at their extremity (Gao et al. 2010).
Similarly, no change in the level of capping is observed on chromosomes with naturally longer HTT
arrays (Gao et al. 2010). Hence, while the size of the capping domain in organisms with telomerase is
directly linked to the length of terminal DNA repeats, the establishment of a functional cap in
absence of telomerase remains poorly understood. Several studies have nevertheless established that
some actors of the DNA damage response (DDR), including the conserved Mre11-Rad50-Nbs
complex and the ATM and ATR checkpoint kinases, are required for preventing telomere fusions and
for the initial recruitment of HOAP on chromosome ends (Ciapponi et al. 2004; Bi et al. 2005;
Oikemus et al. 2006; Ciapponi et al., 2006). It has been proposed that the spreading of capping
complexes toward the centromere would follow this initial recruitment of a protective cap at the
Accepted manuscript
Journal of Cell Science
extremity (Pimpinelli 2006; Gao et al. 2010), although the mechanism that regulates the size of the
capping domain is currently unknown. Moreover, the relative contribution of this large domain to
telomere protection is unclear.
Among the functionally characterized capping proteins, HOAP and HipHop play a pivotal role
in establishing a functional telomere. They are interdependent for their stability (Gao et al. 2010) and
HOAP is required for the localization of Ver, Moi and HP1a at telomeres. However, the fact that
these proteins are essential for viability is a serious limitation for their functional analysis during cell
proliferation and differentiation. Spermatogenesis represents a powerful system for functional
analysis of capping genes in vivo. Their invalidation in the male germline does not compromise
viability and post-meiotic spermatids are an abundant source of synchronized, differentiated nuclei
that are particularly tractable for telomere imaging. Furthermore, the existence of a male germlinespecific HipHop paralog, K81, provides a unique opportunity to manipulate capping complex
assembly throughout spermatogenesis (Dubruille et al. 2010; Gao et al. 2011; Dubruille and Loppin
2011).
By specifically reducing the expression of HOAP in the male germline, we show that this
protein plays a central role in determining the size of the capping domain. Surprisingly, we
demonstrate that the amount of capping proteins at telomeres can be dramatically decreased without
severely disrupting chromosome end protection and male fertility.
Results
HipHop and K81 successively contribute to telomere protection in male germ cells
We have recently discovered that in the male germline, HipHop, is replaced by K81 in
spermatid nuclei (Dubruille et al. 2010). At fertilization, K81 is transmitted to the zygote, where it is
required to protect paternal telomeres during the first division. Interestingly, while K81 is absolutely
necessary for telomere protection at fertilization, it does not seem to be required during
spermatogenesis (Dubruille et al. 2010; Gao et al. 2011). Indeed, no chromosomal defects have been
observed in the male germline of K81 mutant males (Fuyama 1984; Yasuda et al. 1995), suggesting
that other types of capping complexes, probably involving HipHop, could be required in these cells.
To gain insight into the respective contribution of HipHop and K81 in telomere protection
during spermatogenesis, we first analyzed their expression dynamics in the male germline. We used
previously characterized transgenic flies expressing GFP fusion proteins under the regulation of their
own promoter (Dubruille et al. 2010). The 5’hiphop-GFP::hiphop transgene was introduced in an
otherwise lethal trans-heterozygous hiphop mutant background to avoid competition with the
endogenous protein. In these rescued animals, GFP::HipHop protein was detected as discrete foci, in
the nuclei of germline stem cells (GSCs) and their progeny, spermatogonial cells (see Fig. 1A for a
Accepted manuscript
Journal of Cell Science
schematic description of Drosophila spermatogenesis; Fig. 1B,B’,D). Then, the intensity of
GFP::HipHop foci decreased progressively in dividing spermatogonia. In primary spermatocytes, a
weak staining often persisted as 2 foci (Fig. 1E). Then, GFP::HipHop became undetectable
throughout meiosis and in spermatid nuclei (Fig. 1F,G).
For GFP::K81, very weak signals were occasionally detected in GSCs and the more apical
spermatogonia (Fig. 1C,C’,H). Then, the signals increased in late spermatogonia and in primary
spermatocytes, forming several GFP foci in each nucleus (Fig. 1I). Finally, GFP::K81 brightly
decorated telomeres during meiotic divisions and in spermatid nuclei, as previously reported (Fig. 1J,
K) (Dubruille et al. 2010; Dubruille and Loppin 2011). Thus, these paralogs displayed
complementary expression patterns, suggesting that, in contrast to the post-meiotic function of K81,
HipHop is required for telomere protection in early male germ cells. To address this question, we
chose to knockdown HipHop in the male germline by RNA interference using the UAS/GAL4
system. We generated transgenic flies expressing a small hairpin RNA targeting hiphop that were
crossed to flies bearing a nos-Gal4 transgene, that drives expression of GAL4 in GSCs and early
spermatogonia (White-Cooper 2012). The hiphop knockdown males were totally sterile (Table 1).
They had severely atrophied testes that were almost systematically devoid of germ cells (97.6%,
n=84; Fig. 2A-D). This phenotype, which is characteristic of testes in which GSCs have been
genetically ablated (Castrillon et al. 1993; Gönczy and DiNardo 1996; Kauffman et al. 2003), was
also obtained when a shRNA targeting the GFP coding sequence was expressed in the germline of
GFP::hiphop rescued males (Table 1 and not shown). Our results thus demonstrate that HipHop is
necessary for the survival of GSCs.
Interestingly, a single copy of a 5’hiphop-GFP::K81 transgene [which allows expression of
GFP::K81 under the control of the hiphop promoter (Dubruille et al. 2010) and is not targeted by
hiphop shRNAs] partially rescued the fertility of the hiphop knockdown flies (Table 1). Accordingly,
we observed that 33% of the 5’hiphop-GFP::K81, nos-Gal4/UAS-sh-hiphop flies had testes that
appeared normal in shape and size (n=60) and contained germ cells (Fig. 2E). These results
demonstrate that K81 can partially replace HipHop during the division of early male germ cells.
Low levels of capping proteins are sufficient to protect telomeres during spermatogenesis
The observed functional redundancy between HipHop and K81 suggests that K81 ensures
telomere capping in spermatocytes when HipHop is no longer detected. However, as mentioned
above, K81 null mutants do not show any defects during spermatogenesis (Fuyama 1984; Yasuda et
al. 1995), opening the possibility that low, residual amount of HipHop could protect telomeres during
meiotic divisions. To more generally test the adaptability of telomeres to limiting amount of capping
proteins, we turned to HOAP, an interactor of HipHop encoded by the caravaggio (cav) gene. In
Accepted manuscript
Journal of Cell Science
contrast to hiphop, cav has a much stronger expression in testis (Flybase) and does not have a male
germline specific paralog in D. melanogaster (Dubruille et al. 2012). Using an anti-HOAP antibody,
we indeed observed bright HOAP foci in all germ cell nuclei during pre-meiotic and meiotic stages
(Fig. 3C,D). We also observed HOAP foci in spermatid nuclei (Fig. 3E), as previously described
(Dubruille et al. 2010), suggesting that this capping protein is required to protect telomeres at all
stages of spermatogenesis. As cav is essential for viability, we designed a partial rescue strategy to
stably and specifically reduce its expression in the male germline. We generated flies expressing a
GFP::HOAP fusion protein under the control of the hiphop promoter (5’hiphop-GFP::cav; Fig. 3A).
We reasoned that this transgene, introduced in a cav null mutant background, would restore HOAP
expression in somatic cells, but would limit cav expression to GSCs and proliferative spermatogonia
in testes.
As expected, the 5’hiphop-GFP::cav transgene fully rescued the lethality of cav mutants. We
obtained 39.6% of the rescued 5’hiphop-GFP::cav; cav1/Df(3R)Exel6198 genotype (designated as
Rescav for simplicity, see Materials and Methods and Fig. 3A) over the 33% expected Mendelian
ratio (n=416). GFP::HOAP was normally observed at somatic telomeres of 5’hiphop-GFP::cav
animals, such as in salivary gland polytene chromosomes (Fig. 3F). In addition, adult Rescav males
had testes of normal size, indicating that telomere protection was not compromised, at least in early
male germ cells. However, semi-quantitative RT-PCR analysis confirmed the severe reduction of cav
transcripts in Rescav testes compared to the wild-type control (Fig. 3B). Accordingly, in testes of
adult Rescav males, GFP::HOAP could not be detected above background in spermatocytes or
spermatid nuclei using either anti-GFP or anti-HOAP antibodies (Fig. 3G-J).
Surprisingly, however, the fertility of Rescav males was only slightly affected by the observed
reduction of HOAP levels at telomeres in the male germline (Table 1). In somatic cells, HOAP is
critical for the recruitment or the stabilization of other capping proteins at telomeres (Raffa et al.
2009, Gao et al. 2010; Raffa et al. 2010). We thus wondered whether the accumulation of the capping
proteins HP1a and K81, that are present in spermatocytes and early spermatids (Dubruille et al.
2010), could be affected in germ cells of Rescav males. We thus systematically analyzed the level of
these capping proteins in Rescav spermatid nuclei by quantification of immunofluorescence signals.
To exclude any impact of nuclear condensation on antibody accessibility, we only considered
spermatid nuclei at the canoe stage and distinguished in the analyses those that were negative or
positive for Mst77F, a sperm-specific nuclear protein incorporated at the histone-to-protamine
transition (Rathke et al. 2010). Using an anti-HOAP specific antibody, we first confirmed the severe
reduction of HOAP at spermatid telomeres in Rescav males. While HOAP foci were readily detected
in control spermatid nuclei before and after the histone-to-protamine transition, HOAP was barely
detectable in Rescav spermatids at both stages (Fig. 4). We then analyzed HP1a and K81
Accepted manuscript
Journal of Cell Science
accumulation using respectively, an anti-HP1a antibody and the 5’K81-GFP::K81 transgene that was
introduced in the Rescav background. Strikingly, both the size and intensity of HP1a and GFP::K81
foci were also drastically reduced in spermatids of Rescav males (Fig. 4).
Thus, the reduction of HOAP levels in Rescav males has a general effect on the accumulation
of the capping proteins HP1a and K81 at spermatid telomeres. However, we know that at least the
capping function of K81 is absolutely required for male fertility, by preventing fusion of paternal
telomeres at fertilization (Loppin et al. 2005; Dubruille et al. 2010; Gao et al. 2011). Our analysis
thus demonstrates that the very limited quantity of K81 present at telomeres in Rescav post-meiotic
male germ cells is sufficient to ensure efficient protection of paternal chromosomes during zygote
formation.
Sensitized telomere protection in Rescav males unveils a protective role of K81 in meiosis
Although the reduction of capping protein recruitment at telomeres in Rescav testes had no
significant impact on spermatogenesis and fertility, we nevertheless occasionally noticed the
presence of spermatid nuclei connected by a chromatin thread. This indicated that telomeres
occasionally fused before or during meiotic divisions, thus suggesting that telomere capping was
sensitized in Rescav male germline. To test this hypothesis, we challenged telomere capping by
knocking down other capping genes in the Rescav background. Strikingly, in Rescav males that were
homozygous for a null allele of K81 (K812), spermatogenesis appeared severely disorganized, with
the majority of spermatid nuclei failing to differentiate normally (Fig. 5B). They were notably
connected by gigantic chromatin threads of several tens of µm (Fig. 5G-J). Moreover, we could
frequently observe chromatin bridges in telophase of meiosis (Fig. 5E), likely resulting from the
fusion of uncapped telomeres. The chromatin threads connecting spermatid nuclei probably resulted
from the stretch of unbroken chromatin bridges that were formed during male meiosis II, as similarly
reported by Titen and colleagues (Titen et al. 2014).
We also observed chromatin bridges, albeit at a lower frequency, when Rescav males had a
single copy of K81. A quantification of this phenotype confirmed that Rescav; K812/+ testes
contained significantly more abnormal nuclei than Rescav testes (Fig. 5L). Accordingly, Rescav;
K812/+ males had a reduced fertility compared to control flies (Rescav; Table 1). Taken together,
these results demonstrate that, in the Rescav background, K81 is required for telomere protection
during male meiosis. As we hypothesized above, the fact that no defects are observed in meiosis in
K81 mutant males suggested that HipHop efficiently protects telomeres until completion of male
meiosis. Interestingly, when we combined Rescav with the hiphop1 null allele, we also observed a
significant increase of abnormal spermatid nuclei compared to Rescav testes (Fig. 5L). This confirms
that HipHop is also involved in telomere protection during male meiosis in the Rescav background.
Accepted manuscript
Journal of Cell Science
These genetic interactions between Rescav and K81/hiphop show that a further decrease of
capping protein expression in the Rescav background destabilizes capping complexes and impairs
chromosome protection during meiosis. We thus tested, in this context, a partial loss of other capping
genes, ver and moi, that are essential to prevent telomere fusions in somatic cells and for viability
(Raffa et al. 2009; 2010). We introduced the ver2 mutant allele in the Rescav background and
examined whole mount testes of these flies. Interestingly, we again observed the presence of many
spermatids with giant chromatin threads. The quantification of abnormal spermatid nuclei in these
flies revealed a phenotype similar to that of Rescav, K812/+ and Rescav, hiphop1/+ males (Fig. 5L).
This implies that Ver, like HipHop, is involved in telomere protection in the male germline at least
until completion of meiosis. In contrast, however, combining the moi1 null allele with Rescav did not
aggravate the Rescav phenotype (Fig. 5L). This result suggests that either Moi is not required for
telomere protection in the male germline or that Moi is not limiting in this context. The fact that, in
larval salivary glands, Ver and Moi are interdependent for their localization at telomere supports the
latter hypothesis (Raffa et al. 2010).
Taken together, our results show that during male meiosis, telomere protection relies on
capping complexes that contain HipHop or K81, and at least the proteins HOAP and Ver.
Forcing hiphop expression in spermatids increases capping complex recruitment at telomeres
Our analysis of Rescav males showed that reducing HOAP expression level dramatically
decreases the level of capping proteins present at telomeres. We wondered, whether, on the opposite,
it would be possible to increase the amount of capping proteins recruited at telomeres. Interestingly,
in the course of our experiments, we noticed in a particular genotype that HOAP foci in young
spermatid nuclei appeared brighter and larger than in control flies (Fig. 6A). These flies bear two
copies of a 5’K81-GFP::hiphop transgene, which drives ectopic expression of a GFP::HipHop fusion
protein in spermatids (Dubruille et al. 2010). To confirm our observation, we quantified HOAP
signals in spermatid nuclei. We and others previously observed that telomeres cluster in spermatid
nuclei and in various somatic cell types (Dubruille et al. 2010; Wesolowska et al. 2013). We thus first
evaluated the clustering in spermatid nuclei of 5’K81-GFP::hiphop flies by counting the number of
foci in individual nuclei. We did not observe any statistically significant changes of the clustering
between 5’K81-GFP::hiphop flies and control flies (Fig. 6B). To nevertheless exclude any clustering
effect, we quantified the total area and the mean intensity of all HOAP foci detected in individual
nuclei (Fig. 6C, top panels). This analysis confirmed that both the area and intensity of HOAP foci
were higher in spermatids of 5’K81-GFP::hiphop males compared to control males. We then asked
whether the increase of HOAP levels affected the recruitment of other capping proteins. We thus
quantified HP1a and GFP::HipHop signals, which appeared indeed significantly higher than in
Accepted manuscript
Journal of Cell Science
control flies (GFP::HipHop signals were compared to GFP::K81 expressed with the same promoter;
Fig. 6C middle and bottom panels). These results thus demonstrate that in flies expressing high levels
of GFP::HipHop in post-meiotic stages, capping complexes are more abundant at telomeres.
Discussion
A capping complex switch during spermatogenesis
We have previously shown that the male germline-specific capping protein K81 localizes at
telomeres in spermatids and is essential for the protection of sperm telomeres at fertilization
(Dubruille et al. 2010). However, despite its essential role for male fertility through a paternal effect,
spermatogenesis itself, including meiotic divisions, occurs normally in K81 null mutant males
(Fuyama 1984; Yasuda et al. 1995). Here, we show that telomere protection in male germ cells relies
on two types of capping complexes, each involving one of the HipHop and K81 paralogs. The onset
of spermatogenesis requires HipHop, which is expressed in GSCs and is critical for their survival,
demonstrating that this ubiquitous capping protein is essential to protect telomeres in these cells. The
requirement of HipHop in GSCs is thus similar to its role in somatic cells. In proliferative
spermatogonia and in spermatocytes, our data show that a gradual switch between somatic-like and
male germline-specific complexes occurs, leading to the complete replacement of HipHop by K81 in
post-meiotic cells. Although K81 is specialized in the capping of sperm chromosomes, it has been
previously reported that K81 is efficiently targeted to somatic telomeres (Dubruille et al. 2010) where
it can achieve at least some level of protection (Gao et al. 2011). Our observation that K81 expression
in GSCs partially restores testicular development and fertility of nos-Gal4/UAS-sh-hiphop flies
further supports the ability of K81 to form functional capping complexes outside the sperm
chromatin environment.
The fact that the HipHop/K81 switch occurs gradually in dividing cells suggests that HipHop is
progressively diluted as K81 is loaded on telomeres during each cell cycle. Although the precise
dynamics of capping protein loading on telomeres is currently unknown, it is tempting to speculate
that the recruitment of capping protein complexes is coupled with DNA replication as new
chromosome extremities are produced. Supporting this assumption, we have previously shown that,
in fertilized eggs, HipHop is not detected in the decondensing male pronucleus, but is subsequently
present at paternal telomeres when the apposed pronuclei initiate the first zygotic replication
(Dubruille et al. 2010). A coupling of DNA replication with capping protein recruitment would
explain why K81, which function is essential in post-meiotic nuclei, is loaded during pre-meiotic
stages.
Accepted manuscript
Journal of Cell Science
Telomere protection with a minimal amount of capping
The most surprising result of our study is the finding that the amount of capping proteins
present at telomeres can be severely reduced without dramatically impairing chromosome end
protection. Indeed, K81, HOAP and HP1a are barely detected in spermatid nuclei of Rescav males,
which are nevertheless fertile. This implies that the residual amount of K81 in Rescav spermatid
nuclei is sufficient to protect paternal chromosomes at fertilization. Moreover, the relatively low
number of spermatid nuclei that are connected by a chromatin thread in Rescav testes demonstrates
that telomeres are efficiently protected during male meiosis, despite the fact that HOAP is barely
detected at this stage. Finally, we also propose that, in absence of K81, residual levels of HipHop can
ensure telomere protection in meiosis. Using chromosomes with terminal deletion that removed the
HTT array allowing ChIP analyses, Gao et al. (2010) previously showed that HipHop-HOAP-HP1a
capping complexes bind a large region (≥ 10 kb) of terminal chromatin. The current model suggests
that the recruitment of Terminin complexes on chromosome extremities is mediated by some actors
of the DDR such as the MRN complex and the ATM and ATR-ATRIP kinases (Raffa et al. 2011).
Following this initial recruitment, other HipHop-HOAP-HP1a capping complexes would spread on a
broader terminal region (Gao et al. 2010). The fact that in Rescav males, telomere protection is
globally not disrupted implies that the presence of small amount of Terminin complexes is sufficient
to efficiently inhibit their recognition as DNA DSBs. Although we could not investigate the
chromatin occupancy of the HOAP, K81 and HP1a proteins in Rescav males, we hypothesize that the
few capping complexes concentrate within the last base pairs of the DNA molecule.
Interestingly, several studies have reported that very short telomeres in human cells and yeast
are efficiently protected. Telomeres with extremely short tracts called “t-stumps” have been
characterized in transformed and cancer cells (Xu and Blackburn 2007). Surprisingly however, these
“t-stumps” do not compromise cell proliferation. In the yeast S. cerevisiae, the characterization of
telomere fusion events revealed that a majority of chromosome end-to-end fusions engaged short
telomeric tracts of less than 100 bp (Chan and Blackburn 2003). Similarly, in cultured human cells,
telomeres become fusogenic when they contain less than ca. 13 repeats, suggesting that 78 base pairs
would be sufficient to recruit Shelterin complexes and efficiently protect chromosome ends (Capper
et al. 2007). Moreover, in vitro studies have demonstrated that seven TTAGGG repeats are bound by
at least one molecule of the human shelterin proteins TRF1 or TRF2 (Xu and Blackburn 2007) and
that a minimum of 12 TTAGGG repeats is required to inhibit the fusion of DNA ends in presence of
TRF2 and RAP1 Shelterin proteins (Bae and Baumann 2007). Thus, in species that rely on
telomerase, an extremely small number of DNA repeats is actually sufficient to prevent end-to-end
fusions. Remarkably, our study supports that, Drosophila telomeres, like their yeast and vertebrate
counterparts, can be protected from telomere fusions with little amount of capping proteins.
Accepted manuscript
Journal of Cell Science
What could be the functions of a large telomeric capping domain?
The fact that telomere protection can be achieved with low amounts of Terminin complexes
raises questions about the role of the relatively large chromatin domain that is occupied by capping
proteins at Drosophila telomeres. In a variety of organisms, neo-telomeres can be formed through a
mechanism called chromosome healing, which consists in the stabilization of chromosome breaks by
the recruitment of capping proteins. In Drosophila, chromosomes with new telomeres have been
recovered in the progeny of wild type males in which chromosome breaks have been induced in the
germline or from irradiated females mutant for the mutator-2 gene (Mason et al. 1984; Levis 1989;
Ahmad and Golic1998; Beaucher et al. 2012; Titen et al. 2014). De novo telomere formation has also
been described in Saccharomyces cerevisiae and in mammalian cells (Kramer and Haber 1993;
Sprung et al. 1999; Diede and Gottschling 1999; Lo et al. 2002; Gao et al. 2008; Kulkarni et al.
2010). Interestingly, in all these systems, including Drosophila, it has been observed that
chromosome healing was facilitated when the break occurred relatively near the natural ends of the
chromosomes (Levis 1989; Tower et al. 1993; Sprung et al. 1999; Diede and Gottschling 1999; Lo et
al. 2002; Capkova Frydrychova et al. 2008; Gao et al. 2008; Kulkarni et al. 2010). Kulkarni and
colleagues demonstrated that de novo telomere formation in human tumor cells was 10 fold less
frequent when the break occurred 100 kb from the extremity compared to 3 kb (Kulkarni et al. 2010).
Importantly, they ruled out the possibility that this was due to the loss of genetic material essential
for cell viability. It has been alternatively proposed that de novo telomere formation could be
facilitated by the availability of capping proteins (Mason et al. 2008; Beaucher et al. 2012). Hence, a
large capping domain might constitute a reserve of capping proteins that could be rapidly mobilized
to stabilize a DNA break occurring in the vicinity of the natural telomere. In addition, this “reserve”
of capping proteins may also be involved in the stabilization of new chromosomal extremities that are
generated when chromosomes replicate or when a telomeric retrotransposon is added to a
chromosome end during telomere elongation.
Capping proteins could also be implicated in the formation and the stabilization of DNA
structures that further protect telomeres. Indeed, in vertebrates, although very short telomeres are still
protected from DNA repair machinery, they are too short to fold into a t-loop (Bae and Baumann
2007), which is thought to participate in the protection of the chromosome extremity (Griffith et al.
1999; de Lange 2004; Giraud-Panis et al. 2013). T-loops are formed by the folding and the
sequestration of the 3’ single-strand DNA overhang in the double strand extremity and is thought to
hide the DNA extremity from the repair machinery (Griffith et al. 1999; Doksani et al. 2013). It has
been shown that the human Shelterin protein TRF2 can induce the formation of t-loops both in vitro
and in vivo (Griffith et al. 1999; Stansel et al. 2001; Amiard et al. 2007; Doksani et al. 2013). The
Accepted manuscript
Journal of Cell Science
ability of Drosophila telomeres to adopt a t-loop structure in vivo remains to be established
(Pimpinelli 2006). However, among the Terminin proteins, Verrocchio contains an OB-fold domain
known to bind single-strand DNA which suggests that Drosophila telomeres terminate with a 3’
single-strand overhang (Raffa et al. 2010). Moreover, the sequence of the telomeric retro-transposon
Het-A is prone to form a DNA structure called G-quadruplex, thought to appear in t-loops (Abad and
Villasante 1999). It would be thus interesting to determine whether HOAP or HipHop may have
biochemical properties similar to those of TRF2.
The telomeric domain occupied by capping complexes is remarkably plastic
While limiting the expression of HOAP severely reduced the level of HP1a and K81 capping
proteins recruited at telomeres, forcing the expression of HipHop in post-meiotic stages, on the
opposite, increased the abundance of HipHop, HOAP and HP1a at chromosome ends. This
observation strengthens the view that HOAP and HipHop/K81 are interdependent for their
localization at telomeres. Furthermore, although we cannot exclude that the density of capping
complexes is higher within the capping domain of the 5’K81-GFP::hiphop spermatid telomeres, we
favor the hypothesis that capping proteins bind to a larger region of terminal chromatin. Indeed, it has
been proposed that in the absence of sequence recognition, capping proteins are recruited through a
spreading mechanism, from the end towards the centromere (Gao et al. 2010). In this model, the
relative availability of key components of the complex, such as HOAP and HipHop, could directly
influence the length of the capping domain. This is also supported by the fact that HOAP is limiting
for the assembly of capping complexes on telomeres as shown using Rescav males.
In mammals, very short tracts of telomeric repeats are sufficient to achieve efficient
chromosome end protection through the recruitment of the Shelterin proteins TRF2 and RAP1 (Bae
and Baumann 2007; Price 2007). Because Drosophila telomeres are epigenetically determined
structures, the sizes of the HTT array and the capping domain are naturally uncoupled (Gao et al.
2010; Raffa et al. 2013). Therefore, a shorter HTT array has no impact on the amount of capping
proteins that are recruited on chromosome termini. Remarkably, our work shows that limiting the
expression of the capping protein HOAP leads to a dramatic decrease of the capping complexes at
telomeres without impairing their protection. This study supports that, despite their divergence,
Drosophila and telomerase-dependent telomeres share the ability to efficiently inhibit chromosome
end fusions when their capping domain is severely reduced. Further studies should aim at
understanding how the size of the fly capping domain is regulated and what could be its functions.
Accepted manuscript
Journal of Cell Science
Materials and Methods
Drosophila genetics
w1118 flies were used as a control. The K812, hiphop1 and hiphopEY7584 alleles and the 5'K81GFP::K81, 5’hiphop-GFP::hiphop, 5’hiphop-GFP::K81 and 5’K81-GFP::hiphop transgenic stocks
were previously described (Dubruille et al. 2010).
The cav1 allele (Cenci et al. 2003) and moi1 and ver2 (l(3)S147910) mutant stocks (Raffa et al.
2009; 2010) are generous gifts from, respectively, Stéphane Ronsseray and Maurizio Gatti. The
ProtB-GFP transgenic strain (Jayaramaiah-Raja and Renkawitz-Pohl 2005) was kindly provided by
Renate Renkawitz-Pohl. Df(3L)BSC776 and Df(3R)Exel6198 deficiencies, UAS-sh-GFP strain (y[1]
sc[*] v[1]; P{y[+t7.7] v[+t1.8]=VALIUM20-EGFP}attP2), nos-GAL4 (w[1118];
P{w[+mC]=GAL4::VP16-nos.UTR}CG6325[MVD1]) were obtained at the Bloomington Drosophila
Stock Center.
The 5'hiphop-GFP::cav and UAS-sh-hiphop transgenic lines were obtained using the phiC31mediated integration system (Bischof et al. 2007). The pValium22-sh-hiphop construct (see below)
was inserted in the P{y[+t7.7]=CaryP}attP2 platform (68A4) and the pW8-attB-5'hiphop-GFP::cav
construct (see below) was inserted in the M{vas-int.Dm}ZH-2A (2A3) and the PBAc{y[+]-attP3B}VK00031 (62E1) platforms. The 5’hiphop-GFP::cav 2A transgene was combined with the cav1
null allele and Rescav males were obtained by crossing virgin 5’hiphop-GFP::cav/5’hiphopGFP::cav; cav1/TM6 females with w; Df(3R)Exel6198/TM6 males.
Fertility test
Male fertility tests were performed as previously described (Dubruille et al. 2010).
Plasmid constructions
To obtain the pW8-attB-5'hiphop-GFP::cav construct, the hiphop coding sequence in the
previously described pW8-attB-5'hiphop-GFP::hiphop construct (Dubruille et al. 2010) was removed
and replaced by a cav coding fragment that was PCR amplified from genomic DNA using the 5'TAGCGGCCGCCATGTCGGGGACGCAAATGTC-3' and 5'GAGGATCCAGAACTAGACAGTGGC-3' primers.
The pValium22-sh-hiphop construction was obtained by cloning the two annealed primers 5’CTAGCAGTTAAGTTGTGACTAGAGAACAATAGTTATATTCAAGCATATTGTTCTCTAGTC
ACAACTTAGCG-3’ and 5’AATTCGCTAAGTTGTGACTAGAGAACAATATGCTTGAATATAACTATTGTTCTCTAGTCA
CAACTTAACTG-3’ into a pValium22 vector following instructions of the Transgenic RNAi Project
Accepted manuscript
Journal of Cell Science
at Harvard Medical School (http://www.flyrnai.org/TRiP-HOME.html) (Ni et al. 2011). The cloned
DNA fragment encodes a small hairpin that targets a 21nt sequence in the 3’UTR of hiphop.
Reverse-transcription and semi-quantitative PCR
Total RNAs were extracted from 50 pairs of testes using the Trizol method (Invitrogen,
Thermo Fisher Scientific, Waltham, MA). They were then treated with DNase1 (Ambion, Thermo
Fisher Scientific) and reverse transcribed with Superscript II (Invitrogen) and polyA primers. A
control reaction was set up without Superscript. cDNAs were PCR amplified using the following
primers: 5’-ATGTCGGATTCGCCCCATG-3’ and 5’-TAGTGGTTGATTCTTGCTCCTC-3’ for
K81, 5’-AAGATCGTGAAGAAGCGCAC-3’ and 5’-ACTCGTTCTCTTGAGAACGC-3’ for Rp49,
5’-CAAGCGAAAGTCCGAAGAA-3’ and 5’-ACCATTTCTGCTTGGTCCAC-3’ for Su(var)205
and 5’-ATCTGATCTTAGCGGCATCG-3’ and 5’-AGTCCGGATCAGACTCCGTA-3’ for cav.
Immunostaining
Polytene chromosomes
Polytene chromosomes were prepared as previously described (Dubruille et al. 2010) and
stained with a mouse monoclonal anti-GFP antibody (Roche, Basel, Switzerland) at a 1:250 dilution
and an AlexaFluor-conjugated goat anti-mouse secondary antibody (Molecular Probes, Thermo
Fisher Scientific) at a 1:300 dilution.
Squashed and whole mount testes
Squashed and whole mount testes were stained as previously described (Dubruille et al. 2010)
with the following antibodies: mouse IgG1 anti-GFP (1 :100 ; Roche), mouse anti-HP1a (1 :25 ;
DHSB, University of Iowa), mouse IgG2a anti-FasIII (1:50; DSHB), guinea pig anti-HOAP (1 :200)
(Gao et al. 2010) and rabbit anti-Mst77F (1 :1000) (Rathke et al. 2010), rat anti-VASA (1:50;
DHSB), anti-histone (1:1000; Millipore). Secondary antibodies include AlexaFluor goat anti-mouse,
anti-mouse IgG1, anti-mouse IgG2a and anti-rat, anti-rabbit (Molecular Probes or Jackson
Immunoresearch, West Grove, PA) and DyLight donkey anti-guinea pig (Jackson ImmunoResearch).
They were used at a 1 :300 dilution for squashed or 1:1000 for whole mount testes. The Mst77F
immunostaining allowed us to distinguish spermatid nuclei that undergo the histone-to-protamine
transition. All tissues were directly mounted in mounting medium (Dako, Glostrup, Denmark)
containing 5 µg/ml propidium iodide (Sigma-Aldrich, Saint-Louis, MO) or 1 µM DRAQ 5
(BioStatus, Leicestershire, UK).
Accepted manuscript
Journal of Cell Science
Imaging and quantification of fluorescent signals in spermatid nuclei
Single stack images were acquired on a LSM510 confocal microscope (Zeiss, Oberkochen,
Germany) in a 8-bit (for analyses in Fig. 2) or 12-bit mode (for analyses in Fig. 6). For quantification,
optimal settings (laser power, amplifier offset....) were set using the Palette command of the LSM
software to avoid saturation of fluorescence signals. Then, all images were acquired with the same
settings for samples that were compared to each other. Quantifications were done using the ImageJ64
software. First, areas corresponding to nuclei were selected in the red canal using the Threshold and
the Analyze particle commands and the ROI manager. Then, the particles corresponding to HOAP,
HP1a or GFP foci in the nucleus areas were selected in the green canal using a threshold above the
background level and particles were analyzed using the Analyze particle command. Results were
plotted and statistical analyses were performed using the Prism software (GraphPad, La Jolla, CA).
Quantification of chromatin bridges in fly testes
Whole mount testes stained with an anti-histone antibody (Millipore, Billerica, MA) were
observed on a fluorescence microscope (Zeiss). All spermatid nuclei presenting a chromatin thread
were counted. Note that protamine positive nuclei were not taken into account. We used the Prism
software to plot and analyze data.
Acknowledgments
We thank Renate Renkawitz-Pohl, Christina Rathke, Yikang Rong, Stéphane Ronsseray and
Maurizio Gatti for antibodies and/or fly stocks. We also thank the TRiP at Harvard Medical School
(NIH/NIGMS R01-GM084947) and the Bloomington stock center for providing transgenic flies and
plasmid vectors used in this study. We are grateful to Julien Falk for his help in using ImageJ for
quantification analyses and Laure Sapey-Triomphe for her technical assistance. We also thank all
members of B. Loppin’s lab for helpful discussions and feedback on this work. Confocal microscopy
was performed at the Centre Technologique des Microstructures of the University Claude Bernard
Lyon1. This work was supported by the Centre National de Recherche Scientique and a grant from
the Fondation ARC pour la Recherche sur le Cancer to BL (SFI20121205765). RD was supported by
a post-doc fellowship from the Fondation ARC pour la Recherche sur le Cancer.
References
Abad, J. P., and Villasante, A. (1999). The 3' non-coding region of the Drosophila melanogaster
HeT-A telomeric retrotransposon contains sequences with propensity to form G-quadruplex
DNA. FEBS Letters 453, 59–62.
Accepted manuscript
Journal of Cell Science
Ahmad, K., and Golic, K. G. (1998). The transmission of fragmented chromosomes in Drosophila
melanogaster. Genetics 148, 775–792.
Amiard, S., Doudeau, M., Pinte, S., Poulet, A., Lenain, C., Faivre-Moskalenko, C., Angelov,
D., Hug, N., Vindigni, A., Bouvet, P., Paoletti, J., Gilson, E. and Giraud-Panis, M.-J.
(2007). A topological mechanism for TRF2-enhanced strand invasion. Nat. Struct. Mol. Biol.
14, 147–154.
Bae, N. S., and Baumann, P. (2007). A RAP1/TRF2 Complex Inhibits Nonhomologous EndJoining at Human Telomeric DNA Ends. Mol. Cell 26, 323–334.
Beaucher, M., Zheng, X. F., Amariei, F. and Rong, Y. S. (2012). Multiple Pathways Suppress
Telomere Addition to DNA Breaks in the Drosophila Germline. Genetics 191, 407–417.
Bi, X., Srikanta, D., Fanti, L., Pimpinelli, S., Badugu, R., Kellum, R. and Rong, Y.S. (2005).
Drosophila ATM and ATR checkpoint kinases control partially redundant pathways for
telomere maintenance. Proc. Natl. Acad. Sci. USA 102, 15167–15172.
Bischof, J., Maeda, R. K., Hediger, M., Karch, F. and Basler, K. (2007). An optimized
transgenesis system for Drosophila using germ-line-specific φC31 integrases. Proc. Natl. Acad.
Sci. USA 104, 3312–3317.
Capkova Frydrychova, R., Biessmann, H. and Mason, J. M. (2008). Regulation of telomere
length in Drosophila. Cytogenet. Genome Res. 122, 356–364.
Capper, R., Britt-Compton, B., Tankimanova, M., Rowson, J., Letsolo, B., Man, S.,
Haughton, M. and Baird, D.M. (2007). The nature of telomere fusion and a definition of the
critical telomere length in human cells. Genes Dev. 21, 2495–2508.
Castrillon, D. H., Gönczy, P., Alexander, S., Rawson, R., Eberhart, C. G., Viswanathan, S.,
DiNardo, S. and Wasserman, S. A. (1993). Toward a molecular genetic analysis of
spermatogenesis in Drosophila melanogaster: characterization of male-sterile mutants generated
by single P element mutagenesis. Genetics 135, 489–505.
Cenci, G., Ciapponi, L. and Gatti, M. (2005). The mechanism of telomere protection: a
comparison between Drosophila and humans. Chromosoma 114, 135–145.
Cenci, G., Siriaco, G., Raffa, G. D., Kellum, R. and Gatti, M. (2003). The Drosophila HOAP
protein is required for telomere capping. Nat. Cell Biol. 5, 82–84.
Accepted manuscript
Journal of Cell Science
Chan, S. W.-L. and Blackburn, E. H. (2003). Telomerase and ATM/Tel1p protect telomeres from
nonhomologous end joining. Mol. Cell 11, 1379–1387.
Ciapponi, L., Cenci, G. and Gatti, M. (2006). The Drosophila Nbs Protein Functions in Multiple
Pathways for the Maintenance of Genome Stability. Genetics 173, 1447–1454.
Ciapponi, L., Cenci, G., Ducau, J., Flores, C., Johnson-Schlitz, D., Gorski, M. M. Engels, W.
R. and Gatti, M. 2004 The Drosophila Mre11/Rad50 Complex Is Required to Prevent Both
Telomeric Fusion and Chromosome Breakage. Curr. Biol. 14, 1360–1366.
de Lange, T., (2004). T-loops and the origin of telomeres. Nat. Rev. Mol. Cell Biol. 5, 323–329.
Diede, S. J. and Gottschling, D. E. (1999). Telomerase-mediated telomere addition in vivo
requires DNA primase and DNA polymerases alpha and delta. Cell 99, 723–733.
Doksani, Y., Wu, J. Y., de Lange, T. and Zhuang, X. (2013). Super-Resolution Fluorescence
Imaging of Telomeres Reveals TRF2- Dependent T-loop Formation. Cell 155, 345–356.
Dubruille, R. and Loppin, B. (2011). Epigenetic maintenance of telomere identity in Drosophila:
Buckle up for the sperm ride. Cell Cycle 10, 1037–1042.
Dubruille, R., Marais, G. A. B. and Loppin, B. (2012). Repeated Evolution of Testis-Specific
New Genes: The Case of Telomere-Capping Genes in Drosophila. Int. J. Evol. Biol. 2012, 1–
11.
Dubruille, R., Orsi, G. A., Delabaere, L., Cortier, E., Couble, P., Marais, G. A. B. and Loppin,
B. (2010). Specialization of a Drosophila capping protein essential for the protection of sperm
telomeres. Curr. Biol. 20, 2090–2099.
Fanti, L., Giovinazzo, G., Berloco, M. and Pimpinelli, S. (1998). The heterochromatin protein 1
prevents telomere fusions in Drosophila. Mol. Cell 2, 527–538.
Fulcher, N., Derboven, E., Valuchova, S. and Riha, K. (2013). If the cap fits, wear it: an
overview of telomeric structures over evolution. Cell. Mol. Life Sci. 5, 847-865.
Fuller, M. T., (1993). Spermatogenesis, pp. 71-146 in The development of Drosophila
melanogaster, edited by M. Bate and A. Martinez-Arias. Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, NY.
Fuyama, Y. (1984). Gynogenesis in Drosophila melanogaster. Jpn. J. Genet. 59, 91–96.
Accepted manuscript
Journal of Cell Science
Gao, G., Cheng, Y., Wesolowska, N. and Rong, Y. S. (2011). Paternal imprint essential for the
inheritance of telomere identity in Drosophila. Proc. Natl. Acad. Sci. USA 108, 4932–4937.
Gao, G., Walser, J.-C., Beaucher, M. L., Morciano, P., Wesolowska, N., Chen, J. and Rong, Y.
S. (2010). HipHop interacts with HOAP and HP1 to protect Drosophila telomeres in a
sequence-independent manner. EMBO J. 29, 819–829.
Gao, Q., Reynolds, G. E., Wilcox, A., Miller, D., Cheung, P., Artandi, S. E. and Murnane, J. P.
(2008). Telomerase-dependent and -independent chromosome healing in mouse embryonic
stem cells. DNA Repair 7, 1233–1249.
Giraud-Panis, M.-J., Pisano, S., Benarroch-Popivker, D., Pei, B., Le Du, M.-H. and Gilson, E.
(2013). One identity or more for telomeres? Front. Oncol. 3, 48.
Gönczy, P. and DiNardo, S. (1996). The germ line regulates somatic cyst cell proliferation and
fate during Drosophila spermatogenesis. Development 122, 2437–2447.
Griffith, J. D., Comeau, L., Rosenfield, S., Stansel, R. M., Bianchi, A., Moss, H. and deLange,
T. (1999). Mammalian telomeres end in a large duplex loop. Cell 97, 503–514.
Jain, D. and Cooper, J. P. (2010). Telomeric Strategies: Means to an End. Annu. Rev. Genet. 44,
243–269.
Jayaramaiah-Raja, S. and Renkawitz-Pohl, R. (2005). Replacement by Drosophila melanogaster
protamines and Mst77F of histones during chromatin condensation in late spermatids and role
of sesame in the removal of these proteins from the male pronucleus. Mol. Cell Biol. 25, 6165–
6177.
Kauffman, T., Tran, J. and DiNardo, S. (2003) Mutations in Nop60B, the Drosophila homolog of
human dyskeratosis congenita 1, affect the maintenance of the germ-line stem cell lineage
during spermatogenesis. Dev. Biol. 253, 189–199.
Kramer, K. M. and Haber, J. E. (1993). New telomeres in yeast are initiated with a highly
selected subset of TG1-3 repeats. Genes Dev. 7: 2345–2356.
Kulkarni, A., Zschenker, O., Reynolds, G., Miller, D. and Murnane, J. P. (2010). Effect of
telomere proximity on telomere position effect, chromosome healing, and sensitivity to DNA
Double-Strand Breaks in a human tumor cell line. Mol. Cell. Biol. 30, 578–589.
Levis, R. W. (1989). Viable deletions of a telomere from a Drosophila chromosome. Cell 58, 791–
Accepted manuscript
Journal of Cell Science
801.
Lo, A. W., Sprung, C. N., Fouladi, B., Pedram, M., Sabatier, L., Ricoul, M., Reynolds, G. E.
and Murnane, J. P. (2002). Chromosome instability as a result of double-strand breaks near
telomeres in mouse embryonic stem cells. Mol. Cell. Biol. 22, 4836–4850.
Loppin, B., Lepetit, D., Dorus, S., Couble, P. and Karr, T. L. (2005). Origin and
neofunctionalization of a Drosophila paternal effect gene essential for zygote viability. Curr.
Biol. 15, 87–93.
Lu, W., Zhang, Y., Liu, D., Songyang, Z. and Wan, M. (2013). Telomeres—structure, function,
and regulation. Exp. Cell Res. 319, 133–141.
Mason, J. M., Frydrychova, R. C. and Biessmann, H. (2008). Drosophila telomeres: an
exception providing new insights. BioEssays 30, 25–37.
Mason, J. M., Strobel, E. and Green, M. M. (1984). mu-2: mutator gene in Drosophila that
potentiates the induction of terminal deficiencies. Proc. Natl. Acad. Sci. USA 81, 6090–6094.
Ni, J.-Q., Zhou, R., Czech, B., Liu, L.-P., Holderbaum, L., Yang-Zhou, D., Shim, H.S., Tao,
R., Handler, D., Karpowicz, P., Binari, R., Booker, M., Brennecke, J., Perkins, L.A.,
Hannon, G.J. and Perrimon, N. (2011). A genome-scale shRNA resource for transgenic
RNAi in Drosophila. Nat. Methods 5, 405-407.
Oganesian, L. and Karlseder, J. (2009). Telomeric armor: the layers of end protection. J. Cell Sci.
122, 4013–4025.
Oikemus, S. R., Queiroz-Machado, J., Lai, K., McGinnis, N., Sunkel, C. and Brodsky, M.
(2006). Epigenetic Telomere Protection by Drosophila DNA Damage Response Pathways.
PLoS Genet. 2, e71.
Palm, W. and de Lange, T. (2008). How Shelterin Protects Mammalian Telomeres. Annu. Rev.
Genet. 42, 301–334.
Pardue, M.-L. and DeBaryshe, P. G. (2011). Retrotransposons that maintain chromosome ends.
Proc. Natl. Acad. Sci. USA 108, 20317–20324.
Perrini, B., Piacentini, L., Fanti, L., Altieri, F., Chichiarelli, S., Berloco, M., Turano, C.,
Ferraro, A. and Pimpinelli, S. (2004). HP1 controls telomere capping, telomere elongation,
and telomere silencing by two different mechanisms in Drosophila. Mol. Cell 15, 467–476.
Accepted manuscript
Journal of Cell Science
Pimpinelli, S. (2006). Drosophila Telomeres, pp. 433-463 Telomeres, edited by T. de Lange, V.
Lundblad, and E. H. Blackburn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
NY.
Price, C. M. (2007). wRAPing up the End to Prevent Telomere Fusions. Mol. Cell 26, 463–464.
Raffa, G. D., Cenci, G., Ciapponi, L. and Gatti, M. (2013). Organization and evolution of
Drosophila terminin: similarities and differences between Drosophila and human telomeres.
Front. Oncol. 3, 112.
Raffa, G. D., Ciapponi, L. Cenci, G. and Gatti, M. (2011). Terminin: a protein complex that
mediates epigenetic maintenance of Drosophila telomeres. Nucleus 2, 383–391.
Raffa, G. D., Raimondo, D., Sorino, C., Cugusi, S., Cenci, G., Cacchione, S., Gatti, M. and
Ciapponi, L. (2010). Verrocchio, a Drosophila OB fold-containing protein, is a component of
the terminin telomere-capping complex. Genes Dev. 24, 1596–1601.
Raffa, G. D., Siriaco, G., Cugusi, S., Ciapponi, L., Cenci, G., Wojcik, E. and Gatti, M. (2009).
The Drosophila modigliani (moi) gene encodes a HOAP-interacting protein required for
telomere protection. Proc. Natl. Acad. Sci. USA 106, 2271–2276.
Rathke, C., Barckmann, B., Burkhard, S., Jayaramaiah-Raja, S., Roote, J. and RenkawitzPohl, R. (2010). Distinct functions of Mst77F and protamines in nuclear shaping and chromatin
condensation during Drosophila spermiogenesis. Eur. J. Cell Biol. 89, 326–338.
Rong, Y. S. (2008). Telomere capping in Drosophila: dealing with chromosome ends that most
resemble DNA breaks. Chromosoma 117, 235–242.
Sprung, C. N., Reynolds, G. E., Jasin, M. and Murnane, J. P. (1999). Chromosome healing in
mouse embryonic stem cells. Proc. Natl. Acad. Sci. USA 96, 6781–6786.
Stansel, R. M., de Lange, T. and Griffith, J. D. (2001). T‐ loop assembly in vitro involves
binding of TRF2 near the 3′ telomeric overhang. EMBO J. 20, 5532–5540.
Stewart, J. A., Chaiken, M. F., Wang, F. and Price, C. M. (2012). Maintaining the end: roles of
telomere proteins in end-protection, telomere replication and length regulation. Mut. Res. 730,
12–19.
Titen, S. W. A., Lin, H.-C., Bhandari, J. and Golic, K. G. (2014) Chk2 and P53 Regulate the
Transmission of Healed Chromosomes in the Drosophila Male Germline. PLoS Genet. 10,
Accepted manuscript
Journal of Cell Science
e1004130.
Tower, J., Karpen, G. H., Craig, N. and Spradling, A. C. (1993). Preferential transposition of
Drosophila P elements to nearby chromosomal sites. Genetics 133, 347–359.
Villasante, A., de Pablos, B., Méndez-Lago, M. and Abad, J. P. (2008). Telomere maintenance
in Drosophila: rapid transposon evolution at chromosome ends. Cell Cycle 7, 2134–2138.
Wesolowska, N., Amariei, F. L. and Rong, Y. S. (2013.) Clustering and protein dynamics of
Drosophila melanogaster telomeres. Genetics 195, 381–391.
White-Cooper, H. (2012). Tissue, cell type and stage-specific ectopic gene expression and RNAi
induction in the Drosophila testis. Spermatogenesis 2, 11–22.
Xu, L. and Blackburn, E. H. (2007). Human cancer cells harbor T-stumps, a distinct class of
extremely short telomeres. Mol. Cell 28, 315–327.
Yasuda, G. K., Schubiger, G. and Wakimoto, B. T. (1995). Genetic characterization of
ms(3)K81, a paternal effect gene of Drosophila melanogaster. Genetics 140, 219–229.
Accepted manuscript
Journal of Cell Science
Figure 1: K81 and HipHop show a complementary localization at telomeres in the male
germline. (A) Schematic representation of Drosophila spermatogenesis. Spermatogenesis is
organized in differentiating units called cysts that progress along the axis of the testis (Fuller 1993).
At the apical end of the testis, a group of somatic cells called the hub forms the niche of germline
stem cells (GSCs) and somatic cyst stem cells (not represented on the scheme). The asymetric
division of a GSC produces another GSC and a spermatogonial cell. Spermatogonia undertake four
rounds of mitosis without complete cytokinesis leading to a cyst of sixteen interconnected
spermatocytes. After a growth step, spermatocytes undergo meiotic division in synchrony giving rise
to 64 haploid spermatids. The maturation of spermatids is notably characterized by the elimination of
most histones and their replacement by sperm-specific proteins such as Mst77F and the protaminelike proteins Mst35Ba/b (not shown on the scheme). At the end of spermatogenesis, sperm cells
Accepted manuscript
Journal of Cell Science
individualize and are transferred to the seminal vesicle. (B-K) Confocal images of whole mount
testes from 5’hiphop-GFP::hiphop hiphop1/5’hiphop-GFP::hiphop hiphopEY7584 males (B-B’ and DG) and 5’K81-GFP::K81/5’K81-GFP::K81; K812/K812 males (C-C’ and H-K) to localize HipHop
and K81, respectively . (B-C’) View of the apical tip of testes stained with an anti-Vasa antibody
(blue) to identify germ cells, an anti-GFP antibody (green) and for DNA (red). GFP::HipHop foci are
visible in the nuclei of GSCs and early spermatogonia (B-B’ and the magnification of the islet in D),
while GFP::K81 is barely detected in these cells (C-C’ and the magnification of the islet in H). In
spermatocyte nuclei, only a few GFP::HipHop foci (from 0 to 2) are still visible (E, arrows), while
GFP::K81 decorates all telomeres (I, arrows). During meiosis (F; two anaphases II) and in spermatid
nuclei (G), GFP::HipHop is not detected. On the opposite, bright GFP::K81 foci are visible through
meiosis (J; two metaphases I) and in spermatid nuclei (K). The dashed white lines in E and I
delineate the nucleus. Scale bar: 5 µm.
Accepted manuscript
Journal of Cell Science
Figure 2: hiphop knock-down in the male germline dramatically impairs early spermatogenesis
(A-B) Confocal images showing a pair of testes from a control male (A) and a hiphop knock-down
male (nos-Gal4/UAS-sh-hiphop; B), stained with an anti-histone antibody. The scale is the same for
both images. Note the drastic reduction in size of the hiphop knock-down testes. AT: apical tip; AD:
anterior ejaculatory duct; SV: seminal vesicle. Almost all of hiphop knock-down testes were vestigial
as shown in B (97.6%, n=84). We observed a few testes with a normal shape but with a reduced size
(2.4%, n=84). (C-E) Confocal sections of whole mount testes stained for the hub [Fas III (green)],
stem cells [Vasa (blue)] and DNA (red). Stars indicate the apical tip of the testes. The scale is the
same for all images. About 5% of the testis is visible on the panels C and E, while in D, more than
half of the testis is visible. In the testes from hiphop knock-down males (D), the Vasa staining
appears severely reduced, compared to control testis (C), showing that germ cells are depleted. As
previously reported, hub cells expanded in agametic testes as revealed by the Fas III marker (Gönczy
and DiNardo 1996). This phenotype is partially rescued with a 5’hiphop-GFP::K81 transgene, as
about 33% of the males (5’hiphop-GFP::K81 nos-Gal4/UAS-sh-hiphop) have testes of wild-type
size, in which the hub and germ cells are clearly detected (E). Scale bars are 250 µm in A and B and
10 µm in C and E.
Accepted manuscript
Journal of Cell Science
Figure 3: cav is downregulated in male germ cells of Rescav flies.
(A) A scheme representing the genotype of Rescav males [5’hiphop-GFP::cav/Y;
cav1/Df(3R)Exel6198]. The organization of the 5’hiphop-GFP:cav transgene is represented with
filled and empty boxes corresponding to, respectively, coding exons and UTRs; and with lines for
introns and intergenic regions. The position relative to the ATG of the corresponding gene is
Accepted manuscript
Journal of Cell Science
indicated. This transgene was inserted into the 2A platform on the X chromosome (chr) and
combined with a cav null allele (cav1) and a deficiency that uncovers cav [Df(3R)6198]. (B) RT-PCR
performed on total RNAs from testes of control (w1118) or Rescav flies. Rp49 was used as a control
gene. +: with and -: without reverse transcriptase. The expression level of cav mRNA is reduced in
Rescav testes. The downregulation of cav does not affect the expression of the capping genes, K81
and Su(var)205 (encoding HP1a). (C-E) Confocal images of squashed testes from w1118 males stained
with an anti-HOAP antibody (green) and for DNA (red). (C) A nucleus of a primary spermatocyte
(the white dash line delineates the nucleus); (D) metaphase of meiosis II; (E) a cyst of spermatid
nuclei. (F) A confocal image of squashed salivary glands of a 5’hiphop-GFP::cav third instar larvae
stained with an anti-GFP antibody (green) and for DNA (red). The fusion protein GFP::HOAP
localizes at telomeres of polytene chromosomes. (G-J) Confocal images of squashed testes from
Rescav males stained for HOAP or GFP (green) and for DNA (red). (G) A nucleus of a mature
primary spermatocyte (white dashed line); (H) prophase of meiosis; (I) anaphase of male meiosis II
and (J) nuclei of a cyst of 64 spermatids. In Rescav males, HOAP is undetectable at telomeres
(arrows in I) during meiosis and in spermatid nuclei. Scale bar: 10 µm. bp: base pair.
Accepted manuscript
Journal of Cell Science
Figure 4: The reduction of HOAP in spermatid nuclei affects the localization of K81 and HP1a
at telomeres. (A) Representative confocal images of squashed testes stained for HOAP, HP1a or
GFP (green), anti-Mst77F (blue) and DNA (red). For HOAP and HP1a, flies were w1118 (Control) or
hiphop-GFP::cav/Y; cav1/Df(3R)Exel6198 (Rescav). For GFP::K81, control flies were hiphopGFP::cav/Y; 5'K81-GFP::K81/+; K812 cav1/K812 and Rescav flies were hiphop-GFP::cav/Y; 5'K81-
Accepted manuscript
Journal of Cell Science
GFP::K81/+; K812 cav1/K812 Df(3R)Exel6198. For each staining, spermatid nuclei before and after
the histone-to-protamine transition are visualized by, respectively, the presence or the absence of the
Mst77F staining (blue). Scale bar: 10 µm. (B) Quantification of the fluorescence mean intensity
(graphs on the left) and area (graphs on the right) of particles detected in (A) are represented as
boxplots in which whiskers show minimum and maximum values, boxes show the middle 50% of the
values, and horizontal lines show the median. The dashed red lines show the threshold under which
fluorescence signals were considered as background. Each graph corresponds to the quantification of
a single experiment that was repeated two to three times. The number of nuclei (Nb. nuclei) and
detected particles (Nb. particles) analyzed are shown under the graph. In all experiments, the
fluorescence mean intensity and the area of HOAP, HP1a and GFP::K81 particles were significantly
reduced in the Rescav background compared to control flies. Mann-Whitney test; **** P<0.0001.
a.u: arbitrary unit.
Accepted manuscript
Journal of Cell Science
Figure 5. Loss of K81 in the Rescav background results in chromatin bridges at high frequency
(A-B) Representative images of a testis from a control fly bearing a protB::GFP transgene in a wild
type (A) or in a Rescav; K812/K812 (B) background stained with an anti-histone antibody (red) and
DNA (blue). In Rescav; K812/K812, the cysts of spermatids are disorganized (B). (C-D) Confocal
images of nuclei in testes of wild type flies stained with an anti-histone antibody. (C) Anaphase of
Accepted manuscript
Journal of Cell Science
male meiosis II. (D) A group of young spermatids. (E-K) Examples of chromatin bridges observed in
the Rescav; K812/K812 flies stained with an anti-histone antibody (E-I) or expressing a protB::GFP
transgene (J-K). (E) Telophase of meiosis. Arrows indicate chromosome bridges between haploid
nuclei. (F-H) Young spermatid nuclei presenting chromatin bridges (arrows). Some nuclei present
very long chromatin threads (>50 µm; arrows in G). (I) A larger view of a testis with disorganized
spermatid nuclei that harbor long chromatin threads. (J-K) Chromatin threads observed in spermatid
nuclei that have incorporated protamines (arrows). Scale bars: 10 µm. (L) A quantification of
abnormal spermatid nuclei in the indicated genotypes are represented as a scatter plot in which each
point shows the number of nuclei with a chromatin thread counted in a single testis. Horizontal lines
represent means. The loss of a single copy of K81 or hiphop in the Rescav background results in
chromatin bridges at high frequency. Mann-Whitney test; n.s: non significant; *** P=0.0001; ****
P<0.0001. Note that abnormal spermatid nuclei in Rescav; K812/K812 testes were too numerous for
reliable quantification (>300).
Accepted manuscript
Journal of Cell Science
Figure 6 : The expression of a GFP:HipHop fusion protein in spermatids increases the
recruitment of capping proteins at spermatid telomeres
(A) Representative confocal images of spermatid nuclei in squashed testes stained with anti-HOAP
(green) and anti-Mst77F (blue) antibodies and for DNA (red). Flies were 5’K81-GFP ::K81/5’K81GFP ::K81; K812/K812 (top panel) and 5’K81-GFP::hiphop K812/5’K81-GFP::hiphop K812 (bottom
panel). We show here Mst77F negative nuclei because GFP::HipHop is lost after the histone-toprotamine transition (Dubruille et al. 2010). The settings for the acquisition of both images were the
same. In Mst77F negative spermatid nuclei, telomere foci appear brighter and larger in 5’K81GFP::HipHop, K812 flies. Scale bar: 5 µm. (B) A representative experiment to evaluate the
clustering in spermatid nuclei. Telomere foci were revealed using an anti-HP1a antibody.
The bar histogram represents the percentage of nuclei observed for each category in control flies
(w1118; n=52) or 5’K81-GFP::hiphop K812/5’K81-GFP::hiphop K812 flies (GFP::hiphop; n=67). In
all experiments, telomere clustering in spermatid nuclei was not significantly different (Kolmogorov-
Accepted manuscript
Journal of Cell Science
Smirnov test). (C) Quantification of the total mean intensity of fluorescence (graphs on the left) or
total area (graphs on the right) of telomere foci measured in each analyzed nucleus are represented as
boxplots in which whiskers show minimum and maximum values, boxes show the middle 50% of the
values, and horizontal lines show the median. The dashed red line shows the threshold under which
fluorescence signals were considered as background. For HOAP and HP1a, flies were w1118 (control)
or 5’K81-GFP::hiphop, K812/5’K81-GFP::hiphop, K812 (GFP::hiphop). 5’K81-GFP::K81/5’K81GFP::K81; K812/K812 flies (GFP::K81) were used as control for GFP. Each set of graphs (mean
intensity and area) corresponds to the quantification of a single experiment that was repeated two to
three times. For each staining, the number of individual nuclei analyzed for quantification is written
in the box. In all experiments, the fluorescence intensity mean and total area of telomere foci in
5’K81-GFP::hiphop flies were significantly higher than in control flies. Mann-Whitney test; ****
P<0.0001. a.u.: arbitrary unit
Accepted manuscript
Journal of Cell Science
Table 1 : Fertility tests.
Genotype of males
Number of
Number of
Hatching
eggs
larvae
rate
w/Y
217
193
88.9%
w/Y ; nos-Gal4/+
511
437
86.5%
w/Y ; nos-Gal4/UAS-sh-hiphop
877
1
0%
w/Y ; 5’hiphop-GFP::K81 nos-Gal4 /UAS-sh-hiphop
1629
1062
65.2%
w/Y ; 5’hiphop-GFP::hiphop, UAS-sh-GFP,
891
0
0%
w/Y; 5'K81-GFP::K81/+; K812/ K812
518
477
92.1%
5’hiphop-GFP::cav 2A w/Y ; cav1/+
106
93
87.7%
w/Y ; 5’hiphop-GFP::cav 62E cav1/ Df(3R)Exel6198
284
219
77.1%
5’hiphop-GFP::cav 2A w/Y ; cav1/ Df(3R)Exel6198
763
591
77.5%
5’hiphop-GFP::cav 2A w/Y; 5'K81-GFP::K81/+;
356
280
78.7%
335
31
9.3%
777
315
40.6%
w/Y ; hiphop1 Df(3R)Exel6198/+
553
475
85.9%
5’hiphop-GFP::cav 2A w/Y; cav1/hiphop1
374
228
61.0%
603
330
54.7%
w/Y ; ver2 Df(3R)Exel6198 /+
1122
1058
94%
5’hiphop-GFP::cav 2A w/Y ; cav1 / ver2
238
140
58.8%
w/Y ; moi1 Df(3R)Exel6198/+
222
205
92.3%
5’hiphop-GFP::cav 2A w/Y ; cav1 / moi1
236
208
88.1%
hiphop1/Df(3L)BSC776, nos-Gal4
cav1 K812/ K812
5’hiphop-GFP::cav 2A w/Y; 5'K81-GFP::K81/+;
cav1 K812/Df(3R)6198 K812
5’hiphop-GFP::cav 2A w /Y ; cav1 K812/
Df(3R)Exel6198
Df(3R)6198
5’hiphop-GFP::cav 2A w/Y; cav1 K812/hiphop1
Df(3R)Exel6198
Df(3R)Exel6198
Df(3R)Exel6198