Download Auxin Metabolism and Function in the Multicellular Brown Alga

Auxin Metabolism and Function in the Multicellular
Brown Alga Ectocarpus siliculosus1[W]
Aude Le Bail, Bernard Billoud, Nathalie Kowalczyk, Mariusz Kowalczyk, Morgane Gicquel,
Sophie Le Panse, Sarah Stewart, Delphine Scornet, Jeremy Mark Cock,
Karin Ljung, and Bénédicte Charrier*
CNRS-Université Pierre et Marie Curie, UMR 7139 Marine Plants and Biomolecules (A.L.B., B.B., N.K., M.G.,
S.S., D.S., J.M.C., B.C.), and Platform of Cytology, CNRS FR2424 (S.L.P.), Station Biologique de Roscoff, 29682
Roscoff cedex, France; and Department of Forest Genetics and Plant Physiology, Umeå Plant Science Centre,
Swedish University for Agricultural Sciences, S–901 83 Umea, Sweden (M.K., K.L.)
Ectocarpus siliculosus is a small brown alga that has recently been developed as a genetic model. Its thallus is filamentous,
initially organized as a main primary filament composed of elongated cells and round cells, from which branches differentiate.
Modeling of its early development suggests the involvement of very local positional information mediated by cell-cell
recognition. However, this model also indicates that an additional mechanism is required to ensure proper organization of the
branching pattern. In this paper, we show that auxin indole-3-acetic acid (IAA) is detectable in mature E. siliculosus organisms
and that it is present mainly at the apices of the filaments in the early stages of development. An in silico survey of auxin
biosynthesis, conjugation, response, and transport genes showed that mainly IAA biosynthesis genes from land plants have
homologs in the E. siliculosus genome. In addition, application of exogenous auxins and 2,3,5-triiodobenzoic acid had different
effects depending on the developmental stage of the organism, and we propose a model in which auxin is involved in the
negative control of progression in the developmental program. Furthermore, we identified an auxin-inducible gene called
EsGRP1 from a small-scale microarray experiment and showed that its expression in a series of morphogenetic mutants was
positively correlated with both their elongated-to-round cell ratio and their progression in the developmental program.
Altogether, these data suggest that IAA is used by the brown alga Ectocarpus to relay cell-cell positional information and
induces a signaling pathway different from that known in land plants.
Brown algae are multicellular organisms that belong
to the phylum Heterokontophyta, which also includes
the oomycetes. The divergence between heterokonts
and other phyla comprising multicellular organisms,
such as Opisthokonta (metazoa and fungi), Viridiplantae, and the red algal lineage, is dated to more than
1,000 million years ago (Yoon et al., 2004). On the one
hand, brown algae share several obvious features with
land plants, such as the presence of a cell wall, although with a different composition (Kloareg and
Quatrano, 1988), and similar growth metabolism and
response (i.e. photosynthesis and phototropism). On
the other hand, brown algae share subcellular features
with animal cells, such as the presence of centrosomes
(Katsaros et al., 2006), and some aspects of their
metabolism (production of eicosanoid oxylipins; Ritter
et al., 2008). Brown algae are coastal organisms, re1
This work was supported by the French Ministry of National
Education and Research (to A.L.B.) and the French Groupement
d’Intérêt Scientifique “Europole Mer.”
* Corresponding author; e-mail [email protected].
The author responsible for distribution of materials integral to the
findings presented in this article in accordance with the policy
described in the Instructions for Authors (www.plantphysiol.org) is:
Bénédicte Charrier ([email protected]).
[W]
The online version of this article contains Web-only data.
www.plantphysiol.org/cgi/doi/10.1104/pp.109.149708
128
quiring strong attachment or adherence to rocks or
other substrates (other algae, etc.) in order to survive.
Their economic potential is important in some areas of
the globe, with Asia considering them as a central part
of their diet (wakame, kombu) and Europe using them
as a source of fertilizers, cosmetics, pharmacological
products, and defense elicitors (Klarzynski et al., 2000;
Abad et al., 2008; Holtkamp et al., 2009).
Diverse morphologies are observed in brown algae,
from crust-like forms to the large thallus blades found
in giant kelps. Fucales have long been good models for
investigating brown alga and land plant embryogenesis. Given its large size and its ease of manipulation,
the Fucales zygote has been particularly amenable to
cytological and pharmacological experiments (Kropf,
1997). Polarization of the zygote after fertilization
involves several subcellular components (cell wall,
microtubules, centrioles, and actin; for review, see
Kropf, 1992) and is affected by auxin, which alters the
polarity of the embryo and its developmental pattern
(Basu et al., 2002; Sun et al., 2004). However, Fucus is
not amenable to genetic studies, limiting its utility in
further investigations of the processes controlling
morphogenesis in brown algae.
Recently, Ectocarpus siliculosus (order Ectocarpales)
was chosen as a genetic and genomic model of brown
algae (Peters et al., 2004). It is a small macroscopic
filamentous alga that grows in temperate regions
Plant PhysiologyÒ, May 2010, Vol. 153, pp. 128–144, www.plantphysiol.org Ó 2010 American Society of Plant Biologists
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.
Auxin in the Brown Algal Model Ectocarpus siliculosus
throughout the globe, and knowledge on this organism has been compiled over the last two centuries
(Charrier et al., 2008). Its relatively small (200 Mb) genome has been sequenced and annotated (http://www.
genoscope.cns.fr/spip/Ectocarpus-siliculosus,740.html).
Unlike Fucus, fertilization is isogamous in E. siliculosus,
which entails little, if any, parental influence on the
development of the zygote (Stern, 2006). For organisms with isogamous fertilization, the perception of
physical factors such as gravity and light is determinant for organismal development (Cove, 2000). However, the perception of these factors is diminished in a
marine environment, making the embryonic developmental mechanisms in E. siliculosus a particularly
pertinent issue worthy of investigation.
E. siliculosus develops uniseriate filaments, resulting
in one of the simplest architectures of multicellular
organisms. Its sporophyte body is composed of two
mains parts: the prostrate body (Fig. 1, A–C) and the
upright body (Fig. 1, D–E). The prostrate body is made
of crawling filaments composed of two cell types.
Elongated (E) cells are localized at the apices, where
they ensure the apical growth by cell division and
elongation. They then progressively differentiate centripetally to produce the second cell type, the round
(R) cells, thereby generating filaments with E cells on
the edges and R cells in the center (Fig. 1B; Le Bail
et al., 2008a). Then, secondary growth axes develop,
preferentially in the center of the primary filament and
on the R cells (Fig. 1C; Le Bail et al., 2008a). Upright
filaments then develop from the prostrate body and
ultimately differentiate into sporangia (Fig. 1, D and
E). This early developmental pattern is subject to a
significant level of stochasticity in terms of the proportion and position of the two cell types along the
filament, leading to a morphologically heterogeneous
population. Nevertheless, the pattern is controlled by
biological mechanisms, because statistical studies
have identified several intrinsic constraints leading
to a characteristic architecture (Le Bail et al., 2008a).
Furthermore, modeling of these development steps
indicates that local positional information, corresponding to the cell identity of the two neighboring
cells, is sufficient to account for most features of this
early differentiation pattern (Billoud et al., 2008). More
precisely, based on observations, it has been postulated that the presence of an R cell in the immediate
neighborhood is necessary to allow E-to-R cell differentiation. However, spontaneous differentiation of an
isolated R cell in the center of the filament is sometimes observed. This cannot be accounted for by the
model and implies that local positional information,
while being the main mechanism controlling cell differentiation in the early stages, operates in synergy
with an integrated mechanism involving the perception of the overall body organization.
Despite the absence of characterized algal mutants
impaired in phytohormone biosynthesis or signaling,
several types of phytohormones (auxins, cytokinins,
and abscisic acid) have been reported to be present in
brown algae and to interfere with their development
(for review, see Tarakhovskaya et al., 2007). Thus, we
sought to investigate the possible role of phytohormones in the development of E. siliculosus.
In this paper, we present data that suggest that auxin
plays a role as a signaling molecule controlling the
progression of development in this macroalga, and we
address the issue of its conservation in eukaryotes, a
topic of increasing interest in the plant community
(Lau et al., 2008, 2009).
Figure 1. Morphology of the E. siliculosus sporophyte. The body of the
E. siliculosus sporophyte is composed
of two main parts: (1) the prostrate
body attached to the substratum, corresponding to the vegetative phase;
and (2) the upright body, corresponding to filaments growing vertically in
seawater and ultimately differentiating
sporangia. The prostrate body (PB)
originates from germinating zygotes
(or mitospores or unfertilized gametes;
A), which produce a uniseriate filament composed of two cell types (B):
E cells located at the apices and R cells
at the center. About 10 d after germination (dag), the primary filament differentiates secondary prostrate axes
(C). Upright filaments (UF) differentiate
from the prostrate body, and these are
composed of squared, large cells (D),
ultimately developing sporangia (E).
Plant Physiol. Vol. 153, 2010
129
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.
Le Bail et al.
RESULTS
Presence of Auxin Compounds in E. siliculosus and
Possible Metabolic Pathways
Axenic filaments of E. siliculosus sporophytes were
collected, and the levels of several auxin compounds
were measured by both liquid chromatography-mass
spectrometry and gas chromatography-mass spectrometry. Table I shows that E. siliculosus contains
low but significant amounts of auxin indole-3-acetic
acid (IAA), indole-3-carboxylic acid (ICA), and indole3-propionic acid (IPA), with IAA being the most
abundant (3.6 ng g21). No other free indoles (especially
IAA catabolites, 4-chloroindole-3-acetic acid, indole-3butyric acid [IBA], and indole-3-acetamide [IAM])
were detected in algal tissues. In addition, alkaline
hydrolysis did not reveal any IAA conjugates, nor
were any detected by direct measurement.
The localization of IAA within the filaments of E.
siliculosus was determined by immunolocalization at
the early stages of development. Compared with the
negative control (Fig. 2A), immunolocalization of the
a-tubulin protein showed homogeneous distribution
within the whole filament (Fig. 2B). In contrast, IAA
seemed to be preferentially localized in the apices of
the filaments, with a lower concentration in the central
cells (Fig. 2, C and D).
As IAA was present in E. siliculosus sporophytes, we
investigated the possibility of a biosynthetic pathway
operating in E. siliculosus. Knowledge of its genomic
sequence allowed the search for homologs of genes
encoding enzymes involved in IAA biosynthesis in
land plants (for review, see Woodward and Bartel,
2005). Considering the phylogenetic distance between
land plants and brown algae (Baldauf, 2008), the
significance of E values was difficult to estimate.
Nevertheless, Figure 3 and Table II show that homologs of several enzymes of the Trp-dependent pathway
were found in the genome of this alga, with similar
sequences forming in several cases a bidirectional best
hit (BBH), which is a good indication of orthology
(Overbeek et al., 1999). In addition, we searched for
conserved functional domains by systematically com-
Table I. Auxin compounds detected in the E. siliculosus
sporophyte tissues
GC-MS, Gas chromatography-mass spectrometry; LC-MS, liquid
chromatography-mass spectrometry; NQ, not quantified (detected
below the level of quantification).
Compound
LC-MS Transition
LC-MS Level
GC-MS Transition
GC-MS Level
/
/
/
/
/
/
3.66 6 0.26
2.80 6 0.32
0.59 6 0.10
NQ
NQ
0.71 6 0.16
CAS No.
pg mg21
IAA
87-51-4
ICA
771-50-6
IPA
830-96-6
190.09
261.12
176.07
245.12
204.10
275.13
130.07
202.11
118.07
216.08
130.07
202.11
Figure 2. Immunolocalization of IAA along the filaments of E. siliculosus. IAA was immunolocalized in very young sporophytic organisms
(10 d old; blue-purple color; see “Materials and Methods”). A, Negative
control corresponding to the omission of the primary antibody. B,
a-Tubulin immunolocalization showing overall labeling. C, IAA immunolocalization showing the absence of IAA in the center of the filaments, corresponding mainly to R cells (stars). D, Detail of a filament
apex after IAA immunolabeling, showing the absence of labeling in
the central R cells. In these cells, the chloroplast is particularly visible
as a golden brown area. Bars = 50 mm.
paring the sequence signatures in Arabidopsis (Arabidopsis thaliana) proteins with their counterparts in E.
siliculosus (Table II).
Among the enzymes involved in the terminal steps
of IAA biosynthesis, myrosinase and AAO1 displayed
significant similarities with E. siliculosus proteins.
However, the similarity with nitrilase and CYP71A13
was lower. Enzymes synthesizing Trp (IGPS, TSA1,
and TSB1) also seemed well conserved, and more
interestingly, Trp decarboxylase and YUCCA of the
TAM pathway had homologs in the E. siliculosus
genome that were supported by a BBH. The cytochrome P450 monooxygenases CYP79B2, CYP79B3,
and CYP83B1 were moderately conserved. Less conservation was observed for the enzymes of two additional alternative pathways, the IPA and the IAM
pathways. In agreement with the lack of indole-3
pyruvic acid in E. siliculosus filaments, no reliable
homologs of Trp aminotransferases (TAA1-like genes;
Stepanova et al., 2008) or of IPA decarboxylase were
found. The lack of Trp monooxygenase homologs
corroborates the absence of IAM in E. siliculosus.
However, a putative IAM hydrolase (AMI1 homolog)
was found at a low significance level. Altogether, these
data support the existence of a Trp-dependent IAA
biosynthesis pathway in E. siliculosus, with the TAM
and IAOx subpathways being the most probable ones
(Fig. 3).
Very low conservation with IAA conjugation enzymes having sugar or amino acid moieties (GH3
family, ILL, ICR, ILR; Table II) was found, which is in
130
Plant Physiol. Vol. 153, 2010
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.
Auxin in the Brown Algal Model Ectocarpus siliculosus
Figure 3. Indole compounds and putative enzymes involved in the synthesis of IAA in E. siliculosus. Substrates (black) and
enzymes (blue) of the four biosynthetic pathways known or predicted in land plants (Woodward and Bartel, 2005; Nafisi et al.,
2007; Sugawara et al., 2009) are presented. The indole product quantified in E. siliculosus sporophytes is framed in red.
Putatively conserved enzymes inferred from genome sequence analysis of E. siliculosus are indicated by red dots. A yellow star
indicates a BBH (see “Materials and Methods”).
accordance with the lack of detectable IAA-conjugated
compounds in the E. siliculosus extracts. In contrast,
the machinery used for IAA conversion into IBA in the
peroxisome of land plants is significantly represented
in E. siliculosus, at least at the genome level.
An in silico search for homologs of IAA transporters
in E. siliculosus revealed a lack of conservation of the
auxin efflux transporter PIN and the auxin influx
transporter AUX1. The same result was obtained for
the ABP1 glycoprotein located in the endoplasmic reticulum membrane. On the contrary, the multidrug resistance protein ABCB19 (also named MDR1, MDR11,
and PGP19; Titapiwatanakun et al., 2009) had two
matches with very significant similarity (BLAST P = 0).
In E. siliculosus, a large family codes for these transporters (103 members), and 18 of them display significant similarity with ABCB19 (P , 10230; Table II;
Supplemental Table S1).
Finally, despite the fact that a complete suite of
Cullin, ASK1, and RUB1-associated proteins (SCF
complex) and its regulators (CAND1, SGT1b) seemed
to be conserved, no IAA-specific F-box protein TIR1
homolog was detected (Table II). Furthermore, no
significant similarity was found with the transcription
factors of the auxin-response factor (ARF) and the
AUX/IAA families.
Auxin Modifies the Branching Pattern in
E. siliculosus Sporophytes
The effect of auxin on the growth and development
in E. siliculosus was tested at different stages of its life
cycle. E. siliculosus development follows a complex
heteromorphic haplodiploid life cycle (Müller, 1967).
Diploid sporophytes produce both meiospores (from a
meiotic event) and mitospores, which ensure vegetative propagation. Mobile meiospores generate independent male or female gametophytes (dioecism),
which, once sexually mature, produce isogamous
mobile gametes that fuse in the environment. Nevertheless, both female and male unfertilized gametes are
able to germinate and generate an organism with the
same morphology as the diploid sporophyte. This
haploid organism does not produce cells that can fuse,
and it is called a parthenosporophyte.
Auxin compounds had no effect on meiospore germination. In contrast, the application of IAA (50 mM)
on mitospores prevented germination by 100%. Partial
Plant Physiol. Vol. 153, 2010
131
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.
Le Bail et al.
Table II. Sequence conservation between Arabidopsis and E. siliculosus
Proteins of Arabidopsis involved in the different steps of auxin synthesis and function were used to query the whole proteome of E. siliculosus. For
each function, only the best-matching pairs are reported (the complete analysis results are available as Supplemental Table S1). The Ath in Esi
column shows the BLAST E values for the search of Arabidopsis proteins within the E. siliculosus proteome. A second BLAST search was performed
for each best-matching protein of E. siliculosus in the complete proteome of Arabidopsis. The E value for this reverse BLAST query is reported in the
column Esi in Ath in cases when the best hit is the initial Arabidopsis protein (the sequence pair is a bidirectional best hit). The EST column shows
whether an EST for the E. siliculosus sequence is known. The Conserved Domains column gives the domains shared by the E. siliculosus and
Arabidopsis similar proteins, found by InterProScan in the following databases: Gene3D, HAMAP, Pfam, PIRSF, PRINTS, ProSite, Panther,
Superfamily, and TIGR, for which entries begin with G3DSA, MF, PF, PIRSF, PR, PS, PTHR, SSF, and TIGR, respectively.
Function
IAA biosynthesis
IGPS
Arabidopsis UniProt Entry
Accession No.
Identifier
BLAST E Value
Protein in
E. siliculosus
Ath in Esi
Esi in Ath
EST
Conserved Domains
+
G3DSA:3.20.20.70; PF00218;
PTHR22854:SF2
G3DSA:3.40.50.1100;
MF_00131; MF_00133;
PF00290; PF00291;
PS00168; PTHR10314:SF3;
SSF51366; SSF53686;
TIGR00262; TIGR00263
G3DSA:1.20.1340.10;
G3DSA:3.40.640.10;
G3DSA:3.90.1150.10;
PF00282; PR00800;
PTHR11999:SF11; SSF53383
G3DSA:3.50.50.60;
PIRSF000332;
PTHR23023:SF4; SSF51905
G3DSA:1.10.630.10; PF00067;
PR00385; PR00463; PS00086;
PTHR19383:SF143; SSF48264
G3DSA:1.10.630.10; PF00067;
PR00385; PR00463; PS00086;
PTHR19383:SF143; SSF48264
G3DSA:3.40.640.10; PF00155;
PR00753; SSF53383;
PTHR11751
G3DSA:3.20.20.80; PF00232;
PR00131; PTHR10353:SF6;
SSF51445
G3DSA:3.60.110.10; PF00795;
PTHR23088; PS50263;
SSF56317
G3DSA:1.10.150.120;
G3DSA:3.10.20.30;
G3DSA:3.30.365.10;
G3DSA:3.30.390.50;
G3DSA:3.30.465.10;
G3DSA:3.90.1170.50;
PF00111; PF00941; PF01315;
PF01799; PF02738; PF03450;
PS00197; PS51085;
PS51387; PTHR11908;
SSF47741; SSF54292;
SSF54665; SSF55447;
SSF56003; SSF56176
PS00571; PTHR11895
P49572
TRPC_ARATH
Esi0000_0449
5 3 10–36
TSA1
TSB1
Q42529
Q0WUI8
Q42529_ARATH
Q0WUI8_ARATH
Esi0036_0051a
Esi0036_0051a
8 3 10–41
1 3 10–137
4 3 10–137
Trp
decarboxylase
Q8RY79
TYDC1_ARATH
Esi0099_0045
4 3 10–94
1 3 10–88
+
YUCCA
Q9LMA1
FMO1_ARATH
Esi0350_0023
1 3 10–46
1 3 10–48
+
CYP79B2/3
Q501D8
C79B3_ARATH
Esi0063_0068
7 3 10–14
+
CYP71A13
CYP83B1 (SUR2)
O49342
O65782
C71AD_ARATH
C83B1_ARATH
Esi0063_0067
Esi0063_0067
3 3 10–17
1 3 10–24
+
C-S lyase (SUR1)
Q9SIV0
Q9SIV0_ARATH
Esi0002_0157
2 3 10–20
+
Myrosinase
P37702
MYRO_ARATH
Esi0176_0045
2 3 10–81
+
Nitrilase
P32961
NRL1_ARATH
Esi0003_0068
9 3 10–15
+
AAO1
Q7G193
ALDO1_ARATH
Esi0058_0108
6 3 10–107
+
Q9FR37
Q9SB62
Q9FR37_ARATH
Q9SB62_ARATH
Esi0082_0071
None
9 3 10–14
+
P54969
P54970
ILL1_ARATH
ILL2_ARATH
None
None
IAM hydrolase
TAA1
IAA metabolism
ILL1
ILL2
+
(Table continues on following page.)
132
Plant Physiol. Vol. 153, 2010
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.
Auxin in the Brown Algal Model Ectocarpus siliculosus
Table II. (Continued from previous page.)
Function
Arabidopsis UniProt Entry
Accession No.
Identifier
BLAST E Value
Protein in
E. siliculosus
Ath in Esi
Esi in Ath
6 3 10–102
EST
Conserved Domains
+
G3DSA:1.10.540.10;
G3DSA:1.20.140.10;
G3DSA:2.40.110.10;
PF01756; PF02770;
PTHR10909:SF11; SSF47203;
SSF56645
G3DSA:1.10.540.10;
G3DSA:1.20.140.10;
G3DSA:2.40.110.10;
PF00441; PF02770;
PF02771; PS00072;PS00073;
PTHR10909:SF10;
SSF47203; SSF56645
G3DSA:1.10.1040.10;
G3DSA:3.40.50.720;
G3DSA:3.90.226.10;
PF00378; PF00725;
PF02737; PTHR23309;
SSF48179; SSF51735;
SSF52096
PF02535
PF00676; PTHR11516:SF4;
SSF52518
PF00108; PF02803;
PIRSF000429;
PS00098; PS00099;
PS00737; PTHR18919:SF15;
SSF53901; TIGR01930
PTHR10130
G3DSA:1.10.8.60;
G3DSA:3.40.50.300;
PF00004; PS00674;
PTHR23077:SF9;
SM00382; SSF52540
G3DSA:2.130.10.10;
PF00400; PR00320;
PS00678; PS50082;
PS50294; PTHR22850:SF4;
SM00320; SSF50978
PF04695
G3DSA:1.10.540.10;
G3DSA:1.20.140.10;
G3DSA:2.40.110.10;
PF00441; PF02770; PF02771;
PTHR10909; SSF47203;
SSF56645
ILL3
ILL4
ILL5
ICR1
ICR2
ICR3
ACX1
O81641
O04373
Q9SWX9
Q8LE98
Q9ZQC5
Q9LSS5
Q9ZQP2
ILL3_ARATH
ILL4_ARATH
ILL5_ARATH
ICR1_ARATH
ICR2_ARATH
ICR3_ARATH
ACO12_ARATH
None
None
None
None
None
None
Esi0493_0006
2 3 10–101
ACX4
Q96329
ACOX4_ARATH
Esi0005_0083
2 3 10–36
AIM1
Q9ZPI6
Q9ZPI6_ARATH
Esi0063_0042
2 3 10–93
3 3 10–82
+
IAR1
IAR4
Q9M647
Q8H1Y0
IAR1_ARATH
ODPA2_ARATH
Esi0005_0095
Esi0122_0080
1 3 10–12
3 3 10–86
6 3 10–16
6 3 10–91
2
+
KAT1
Q8LF48
THIK1_ARATH
Esi0320_0011
1 3 10–80
2 3 10–14
+
PEX5
PEX6
O82467
Q8RY16
O82467_ARATH
O48676_ARATH
Esi0002_0040
Esi0016_0105
2 3 10–62
2 3 10–94
1 3 10–65
+
+
PEX7
Q9XF57
Q9XF57_ARATH
Esi0120_0004
8 3 10–41
PEX14
IBR3
Q9FE40
Q67ZU5
Q9FE40_ARATH
Q67ZU5_ARATH
Esi0063_0064
Esi0223_0017
9 3 10–9
1 3 10–106
None
Esi0109_0017
Esi0109_0017
0
0
IAA transport
PIN1-7
MDR1
MDR1
6 components
Q9ZR72
AB1B_ARATH
Q9LJX0
AB19B_ARATH
+
2
4 3 10–8
+
+
+
PF00005; PF00664; PS00211;
PS50893; PS50929; SM00382;
PTHR19242:SF96; SSF52540;
SSF90123
(Table continues on following page.)
Plant Physiol. Vol. 153, 2010
133
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.
Le Bail et al.
Table II. (Continued from previous page.)
BLAST E Value
Accession No.
Identifier
Q9SRU2
Q9SRU2_ARATH
Esi0038_0043
Q9FZ33
AXR4_ARATH
None
Q8RWQ8
O65674
FBX14_ARATH
ASK12_ARATH
Esi0053_0061
Esi0046_0039
2 3 10–11
5 3 10–38
9 3 10–35
2
+
Cullin
Q8LGH4
Q8LGH4_ARATH
Esi0207_0055
0
0
+
Cullin
Q9C9L0
Q9C9L0_ARATH
Esi0245_0022
0
0
+
RBX1A
Q940X7
RBX1A_ARATH
Esi0079_0058
6 3 10–26
3 3 10–26
+
RCE2
Q9ZU75
UB12L_ARATH
Esi0007_0140
1 3 10–48
2 3 10–48
+
SGT1b
Q9SUT5
Q9SUT5_ARATH
Esi0014_0174
1 3 10–25
ECR1
O65041
UBA3_ARATH
Esi0069_0046
1 3 10–62
ULA1
P42744
ULA1_ARATH
Esi0358_0003
7 3 10–34
CSN5
Q9FVU9
CSN5A_ARATH
Esi0055_0013
3 3 10–47
4 3 10–47
+
CAND1
O64720
O64720_ARATH
Esi0168_0022
0
0
+
None
Esi0079_0037
Esi0079_0037
Esi0079_0037
None
7 3 10–9
2 3 10–6
1 3 10–5
BIG
AXR4
Auxin signaling: SCF
TIR1
ASK1
Transcription factors
Aux/IAA
ARF9
ARF10
ARF11
ARF
a
Arabidopsis UniProt Entry
Protein in
E. siliculosus
Function
29 family members
Q9XED8
ARFI_ARATH
Q9SKN5
ARFJ_ARATH
Q9ZPY6
ARFK_ARATH
20 other family members
EST
Ath in Esi
Esi in Ath
1 3 10238
3 310238
2
+
1 3 10–62
+
+
Conserved Domains
PF00569; PS01357;PS50135;
PS51157; PTHR21725;
SM00291
G3DSA:3.30.710.10;
PF01466; PF03931;
PIRSF028729; PTHR11165;
SM00512; SSF54695;
SSF81382
G3DSA:1.10.10.10;
G3DSA:1.20.1310.10;
G3DSA:4.10.1030.10;
PF00888;
PF10557; PS01256; PS50069;
SM00182; SSF46785;
SSF74788; SSF75632;
PTHR11932:SF22
G3DSA:1.10.10.10;
G3DSA:1.20.1310.10;
PF00888; PF10557;
PS50069; PTHR11932:SF23;
SM00182; SSF46785;
SSF74788; SSF75632
G3DSA:3.30.40.10;
PF00097; PS50089;
PTHR11210:SF2;
SM00184; SSF57850
G3DSA:3.10.110.10;
PF00179; PS00183; PS50127;
PTHR11621:SF17;
SM00212; SSF54495
G3DSA:1.25.40.10;
G3DSA:2.60.40.790;
PF04969; PF05002;
PS50005; PS50293;
PS51048; PS51203;
PTHR22904:SF10;
SM00028; SSF48452
G3DSA:3.40.50.720;
PF00899; PS00865;
PTHR10953:SF6; SSF69572
G3DSA:3.40.50.720;
PTHR10953; SSF69572
PF01398;
PTHR10410:SF6;
SM00232; SSF102712
G3DSA:1.25.10.10;
PF08623; PTHR12696;
SSF48371
2
In E. siliculosus, a single gene encodes a long protein that corresponds to both TSA1 (N-terminal half) and TSB1 (C-terminal half).
134
Plant Physiol. Vol. 153, 2010
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.
Auxin in the Brown Algal Model Ectocarpus siliculosus
inhibition of germination (60%) was obtained with
2-methoxy-3,6-dichlorobenzoic acid (dicamba; 50 mM),
and the spores that did germinate showed severe
growth inhibition. Concentrations of IAA and dicamba
1 and 2 orders of magnitude lower had no effect on
germination. The other auxin compounds tested altered
the development of young sporophytes without affecting their growth. Application of 50 mM 1-naphthalene
acetic acid (NAA) at early stages modified both cell
types and cell positions along the filament and filament polarization (Fig. 4A). While control specimens
were composed of R cells clustered in the center of the
filament and E cells in the apices, treated organisms
displayed abnormal cell shapes. Furthermore, overall
disorganization of the filament architecture was observed, with the initiation of numerous branching points
and unusual localization of E cells. Similar effects were
observed with IBA (50 mM), but at a weaker intensity,
and with 2-phenyl-acetic acid (PAA; 50 mM), which
produced very long cells in the apices (Fig. 4A). No
modification was observed in response to 4-chlorophenoxyacetic acid, 2,4-dichlorophenoxyacetic acid, and
the auxin transport inhibitors 2,3,5-triiodobenzoic acid
(TIBA) and N-1-naphthylphthalamic acid (NPA). Therefore, while IAA and dicamba mainly inhibited germination and growth, NAA, IBA, and PAA modified the
architecture of E. siliculosus at early developmental
stages by changing cell patterning, filament polarization, and inducing numerous ectopic branches.
When applied at later stages (20 d after germination), 50 mM IAA induced an increase in the rate of prostrate branching compared with controls, and 50 mM
TIBA induced earlier and more frequent differentiation of upright reproductive filaments (Fig. 4B).
Because IAA seemed localized preferentially in the
apical E cells, we investigated the impact of E cells on
central R cell fate, and vice versa, in the presence and
absence of auxin. Thus, E cell extremities were ablated
and separated from the central R cells, and each
section was grown in artificial seawater (ASW). E
and R sections were grown for 1 week with or without
IAA or NAA (5 mM each, R sections only), and the
morphology of the resulting organisms was observed
1 week later. For the E sections, spontaneous differentiation of R cells in the center of the section was
observed, thereby reconstituting filament organization
similar to controls without ablation (data not shown).
In the R sections, E cells regenerated at the extremities
of the sections (Fig. 5, control), both in the absence or
presence of exogenous auxins. Thus, both E and R
sections were able to readjust their differentiation
program to regenerate the missing cells and reform a
normally structured filament. However, the branching
pattern observed from the R sections differed depending on the supply of NAA (Fig. 5). On average, 4.6
lateral branches were produced on the primary filaments in the control medium, while 1.8 were produced
in the presence of NAA, which is similar to the
branching rate of intact filaments at the same stage.
Therefore, when added at the ablation time, NAA
significantly inhibited lateral branching (x2 test, P =
1.6 3 1029). IAA showed similar but weaker effects
(data not shown).
In all these experiments, differences between the
response to IAA and NAA were observed. These
molecules have different physicochemical properties,
and their transport or diffusion in the organism is
known, at least in land plants, to require different
Figure 4. Effects of auxin compounds on the development of E. siliculosus sporophytes. Different auxin compounds were
applied to E. siliculosus spores at germination time (A) or 20 d after germination (B). The effects on morphology were observed
2 weeks later. Application of 50 mM NAA on mitospores resulted in the differentiation of cells with an abnormal shape. Growth
polarity was also affected. Application of IBA led to a similar effect, yet weaker, and PAA produced organisms with very long
terminal cells and an altered branching pattern. When auxin compounds were added later during development (at 20 d after
germination), the observed effects were different. While IAA increased the production of prostrate filaments, TIBA induced the
differentiation of upright filaments (UF) earlier than in the control.
Plant Physiol. Vol. 153, 2010
135
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.
Le Bail et al.
Figure 5. Impact of NAA on branching. Pieces of
filaments containing only R cells were isolated and
grown in the presence or absence of 5 mM NAA
(right). The developmental pattern of the filaments
was observed 1 week after ablation, and the number
of secondary filaments was counted (see text) and
compared with the number obtained from intact
filaments (left).
processes (Yamamoto and Yamamoto, 1998; Woodward
and Bartel, 2005). A lower penetration of exogenous
IAA compared with NAA through the E. siliculosus cell
wall may explain why NAA had more effects on E.
siliculosus development. Moreover, the sensitivity of
cells to IAA may be higher, explaining why spores,
which lack cell walls, died upon application of IAA
while they germinated with NAA at the same concentration.
Morphogenetic Mutants Are Altered in the Auxin
Perception and Signaling Pathway
To demonstrate the role of auxin in the developmental pattern of E. siliculosus sporophytes, we analyzed four mutants impaired in cell differentiation
generated by UV-B mutagenesis on mitospores. The
mutant asparagus (asp) looked quite similar to the wild
type (Fig. 6A), but both its branching pattern and its
cell distribution were different. Fewer secondary filaments were produced (Fig. 6B), and the E cell proportion measured between the two- and 10-cell stages
was higher than in the wild type (Fig. 6, A and C),
suggesting that the E-to-R cell differentiation process
had been altered. On the other hand, the mutants
baguette (bag), grissini1 (gri1), and gri2 developed a
prostrate body very different from the wild type (Fig.
6). All three mutants displayed altered growth polarity, with cells dividing in several axes, especially in
gri1, where the body looked like a callus (Fig. 6A). The
E cell identity was lost in gri1 and gri2 (both 0% E cells)
and was strongly reduced in bag (24% E cells; Fig. 6, A
and C). Their developmental program was characterized by an extremely early emergence of upright
filaments in the bag and gri1 mutants and by a high
abundance of secondary prostrate filaments in gri2
(Fig. 6B).
To investigate whether these morphological alterations were related to auxin metabolism, these mutants
were treated with 50 mM IAA, NAA, and TIBA. Modifications of the developmental pattern were observed
in gri1 and gri2 mutants only. While in gri1, NAA and,
to a lesser extent, IAA reduced the emergence of
upright filaments, in gri2, less and longer secondary
prostrate filaments grew (Fig. 7). TIBA slightly increased the differentiation of sporangia in gri1, while it
had no noticeable effects in gri2. Therefore, gri1 and
gri2 were able to respond to auxin, in contrast to asp
and bag, which were insensitive to it.
Quantifying the amount of auxin in these mutants
would be helpful to better decipher the link between
the phenotype and auxin metabolism. However, because gri1 and gri2 grew slowly, the amount of biological material was too small to quantify IAA in them.
Therefore, we searched for auxin-inducible genes,
which could be used as auxin-reported genes. A smallscale microarray experiment was performed with
RNAs extracted from tissues treated with 50 mM
NAA for 30 min or 3 h. Out of 24 ESTs initially
selected from the microarray data as being either upregulated or down-regulated by the NAA treatment,
the overexpression of only one, named EsGRP1, was
confirmed by quantitative real-time PCR.
PCR amplification of 3 kb upstream of the EsGRP1
EST (located in the 3# untranslated region) led to the
identification of an open reading frame. In the deduced protein sequence, two main domains shared
similarity with extensin and Gly-rich proteins (Fig. 8).
The central part of the protein sequence contained a
series of 8.5 adjacent repeats of 32 amino acids
sharing similarity with extensin from Zea diploperennis
(UniProt-KB accession no. Q41719; lalign local alignment, E = 1.5 3 10234). In the C-terminal part of the
sequence, 10 repeated Gly-rich sequences were clustered, separated by several hydrophilic sequences of
eight to 19 amino acids. In land plants, extensins are
Hyp-rich proteins present in the extracellular matrix,
where they are thought to play a role in plant cell wall
136
Plant Physiol. Vol. 153, 2010
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.
Auxin in the Brown Algal Model Ectocarpus siliculosus
Figure 6. Morphology of the morphogenesis mutants. Phenotypes of the four mutants asp, bag, gri1, and gri2 compared with the
wild type (WT). The phenotypes are shown 5 (A) and 15 (B) d after germination. UF, Upright filaments. Bars = 15 mm in A and
50 mm in B. C, Proportion of R cells. Both R cells and E cells were counted in 36 sporophytes from the two- to the 10-cell stage,
and the ratio of the total number of each cell type was calculated (no. of cells . 200).
stiffness (Kieliszewski and Lamport, 1994), and Glyrich proteins are secreted proteins involved in adhesion and extension of differentiating vascular cells
(Ringli et al., 2001).
A kinetics study in response to NAA showed that
the transcript level of EsGRP1 was more than four
times higher than the control 30 min after the addition
of NAA, and it slowly decreased to its basal level after
24 h (Fig. 9A). In the mutant asp, the EsGRP1 transcript
level was higher than in the wild type, while levels in
bag, gri1, and gri2 mutants were significantly reduced
(Fig. 9B).
Figure 7. Response of E. siliculosus morphogenesis gri1 and gri2 mutants to auxin compounds. Fifty micromolar IAA, NAA, and
TIBA were applied to gri1 and gri2 cultures. The morphology was observed 14 d later and compared with the control cultures
(1024 M NaOH for IAA and NAA and 0.1% dimethyl sulfoxide [DMSO] for TIBA). In gri1, upright branching was reduced upon
application of IAA and inhibited in response to NAA. In response to TIBA, no significant change in morphology was observed. In
gri2, IAA and NAA reduced the number of short secondary filaments and induced the growth of longer filaments. Bars = 50 mm.
Plant Physiol. Vol. 153, 2010
137
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.
Le Bail et al.
Figure 8. Structure of the EsGRP1 protein. Four functional domains are identified in the peptide sequence of EsGRP1 predicted
from the genome sequence. The signal peptide (amino acids 1–27) can be used to address the protein to the membrane. The
extensin-like domain (amino acids 115–384) is made of 8.5 repeats (shown as boxes a–i) of a 32-amino acid module. Every three
modules, the sequence contains an RGD motif (marked as vertical lines). The complete sequence of the repeats is shown below,
with the RGD motif shaded. The alignment of the first module with one of the eight repeats of the Pro-rich extensin motif of
Z. diploperennis (Q41719) shows a partial sequence similarity. The TNFR region (amino acids 406–444) matches with Prosite
pattern PS00652, which is found in tumor necrosis factors and nerve growth factors. However, in tumor necrosis factor and nerve
growth factor proteins, this pattern is present in three or four copies, usually located in the N-terminal part of the protein, which is
not the case in EsGRP1. The Gly-rich region (amino acids 477–860, with the Gly residues marked as vertical lines) is made of 10
approximate repeats (boxes a–j). The complete sequence of this region is shown below the map, with the Gly residues shaded.
Each repeat can be divided into two parts: the first eight to 19 amino acid residues correspond to a complex pattern, which can
appear in more or less complete forms; the remaining 17 to 27 amino acid residues are mainly Gly.
A summary of the data obtained with the mutants is
presented in Figure 10.
DISCUSSION
Role of Auxin in E. siliculosus Development
Some studies have already investigated the role of
auxin in brown alga development. At the embryo
stages, exogenous application of IAA has been shown
to reduce cell polarization in Fucus vesiculosus (order
Fucales) and to induce numerous ectopic rhizoid differentiations when grown in the dark (Basu et al.,
2002). In this study, exogenous NAA also induced body
polarity impairment and numerous ectopic branches
when applied at the germination stage in E. siliculosus.
Therefore, in both algal models, exogenous auxin
applied before the division of the initial cell triggers
general disorganization of the growing thallus.
In our experiments, when auxin was applied later
during the development of E. siliculosus, different
developmental responses were observed. Because
cells acquire either an E or an R identity immediately
after the first division, we investigated the effects of
auxin on these differentiated cells. Our approach of
isolating R or E sections from the rest of the primary
filament helped better understand how cell fate is
dictated and how auxin may regulate morphogenetic
patterns in early developmental stages. In normal
growth medium, ablated R cell fragments were able
to reconstitute the initial filament with the correct
developmental pattern. More specifically, in response
to ablation, the resulting apical R cell reinitiated cell
division toward both extremities of the filament while
maintaining initial growth polarity. In addition, the
daughter cells acquired the E cell identity. Interestingly, in intact filaments, R cells divide very rarely at
this stage, and the differentiation of R to E cells is
never observed (Billoud et al., 2008; Le Bail et al.,
2008a). Therefore, this indicates that following ablation, R cells modify their identity and behavior to
follow the intrinsic developmental program. In the
brown alga Pelvetia compressa (order Fucales), ablation
experiments at the two-cell embryo stage showed that
cell lineage is already established at this stage (Kropf
et al., 1993). However, the identity of the cell seems to
depend on molecular determinants present in its cell
wall, because additional experiments performed on
the brown alga Fucus spiralis show that remnants of
cell wall from the ablated cell dictate cell fate to the
new cell growing in contact with it (Berger et al., 1994).
In E. siliculosus, R cell fragments were cut from within
a larger R zone, thereby precluding contact with
remnant cell walls from excised E cells. Therefore,
cell fate in E. siliculosus is completely independent of
the presence of E cell determinants, contrary to what
has been observed in the Fucales. These differences in
the mechanisms and determinants of cell fate may be
138
Plant Physiol. Vol. 153, 2010
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.
Auxin in the Brown Algal Model Ectocarpus siliculosus
Figure 9. Transcript levels of EsGRP1. The levels of transcripts of
EsGRP1 were quantified by real-time reverse transcription-PCR on
three independent biological replicates. Each transcript level was
normalized to EsEF1a transcripts, as recommended by Le Bail et al.
(2008b), and averaged (SD indicated). Asterisks indicate P , 0.05 with a
t test. A, In response to NAA. Mature sporophytes were incubated for
24 h in 50 mM NAA, and tissues were collected at different times. After
averaging, the transcript levels were normalized to the T0 value. B, In
morphological mutants. WT, Wild type.
related to differences in body architecture between the
species, as both Fucus and Pelvetia develop threedimensionally growing thalli while Ectocarpus is composed of uniseriate filaments. This determination
process was independent of the addition of exogenous
auxin and may rely on local positional information as
suggested by Billoud et al. (2008; Fig. 11).
In contrast, auxin seems to negatively control the
progression in the developmental program. At the
early prostrate stage, ablated R cell fragments induced
the growth of more branches than in intact filaments.
Addition of NAA to these fragments resulted in reduced branching, suggesting that auxin inhibits
branching in the intact filament. In situ immunolocalization experiments showed that actively proliferating
apices of the filaments did have higher concentrations
of IAA. Similar results have been obtained in filaments
of the bryophyte Physcomitrella patens, where the expression of GH3::GUS and DR5::GUS transgenes indicates higher concentrations of auxin in the young,
actively growing cells of the protonemal filaments
(Bierfreund et al., 2003), similarly located at the apices
(Cove et al., 2006). Therefore, a possible scenario in
agreement with the data from the ablation experiment
is that, in an intact filament, there is an IAA gradient
that reaches its maximum at both extremities of the
filament, where E cells are located. As the organism
grows, central cells move farther from the IAA source,
progressively differentiate into R cells in response to
the decrease in IAA concentration, and ultimately
initiate branching. Hence, only the apical position
and a high IAA content in E cells would result in the
developmental pattern observed in culture, as proposed in the model in Figure 11. The analysis of
mutants provides support for this scenario, where
the higher the percentage of E cells, the higher the
EsGRP1 transcript levels are and the lower the rate of
emergence of prostrate filaments is. This is well illustrated in the mutant asp, which contains 83% of E cells,
overexpresses EsGRP1, and displays a lower branching rate, contrary to gri2, which has an extremely high
number of secondary axes borne on a callus body
made of only R cells expressing a very low level of
EsGRP1 transcripts (Fig. 10). In response to auxin, gri2
decreases its rate of branching, providing evidence
that auxin negatively controls hyperbranching of prostrate filaments. The asp mutant was insensitive to the
auxin treatment, possibly due to overinduction of its
auxin signaling pathway (potentially due to an overaccumulation of IAA), which is concordant with the
overexpression of EsGRP1.
At mature vegetative stages (approximately 20–40 d
after germination), addition of exogenous auxin on
wild-type cultures triggered an increase in the emergence of prostrate filaments, while addition of TIBA
increased the emergence of upright filaments. This is
an indication that auxin may negatively control the
transition from the branching of prostrate filaments to
the branching of upright filaments and that this effect
relies on auxin transport within the prostrate body
(Fig. 11). Again, the observation of mutants supports
this hypothesis. The two mutants bag and gri1 dis-
Figure 10. Summary of the phenotypic characterization of the mutants
asp, bag, gri1, and gri2. The mutant phenotypes are summarized in
terms of the proportion of E cells, branching features, response to auxin,
and EsGRP1 transcript levels. For the branching features, note that it
describes both prostrate filaments (gray) and upright filaments (white).
R cells are shown as black ovals. WT, Wild type.
Plant Physiol. Vol. 153, 2010
139
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.
Le Bail et al.
Figure 11. Model for the role of auxin in the development of the E. siliculosus sporophyte. Cells positioned at the apices of the filament acquire the
E identity. A higher concentration of auxin is present
in these cells, which prevents them from differentiating into R cells and/or inducing branching. As the
filament grows, subapical E cells get localized farther
from the apex and perceive lower auxin concentrations, which progressively induce their differentiation
into R cells as well as branching. Later, auxin maintains its control on the progression of the life cycle by
negatively controlling the emergence of the upright
filament and thereby the shift to the reproductive
phase. Auxin control would then depend on active
transport, allowing the apices to maintain control on
distant tissues.
played a pronounced reduction in the vegetative
phase, since upright filaments and sporangia differentiate as soon as the prostrate body is composed of a
few cells (10 d old). Most or all of the cells of prostrate
bodies are of the R type, which again was correlated
with a reduction in EsGRP1 transcript levels. While bag
was insensitive to auxin treatment, gri1 responded by
decreasing the number of upright filaments, somehow
reverting the effect of the mutation by slowing down
the emergence of upright filaments (Fig. 11). The
absence or the weak effect of TIBA on the development
of these mutants may be due to the fact that they were
still in an early growth stage, despite their advanced
morphological features.
Altogether, these results support a role of auxin as an
inhibitor of the progression of the developmental
programs in E. siliculosus, as illustrated in our model
in Figure 11. Interestingly, in the brown alga Laminaria
japonica, which is phylogenetically closely related to
the Ectocarpales (Phillips et al., 2008), auxin levels are
lower in the reproductive tissues than in the vegetative
tissues, and the formation of sori is delayed in response
to 50 mM IAA (Kai et al., 2006). This illustrates that the
developmental role of auxin observed in E. siliculosus
may be common to other complex brown algae.
Synthesis and Transport of Auxin in E. siliculosus
The model illustrated in Figure 11 is based on a high
concentration of IAA in the apical E cells and on a
diffusion of IAA along the primary filament in early
developmental stages relayed by active transport toward the more distant tissues in later stages.
The synthesis of auxin by brown algae is an old and
controversial issue. Despite the fact that several phy-
tohormones have been shown to be present in brown
algae (for review, see Tarakhovskaya et al., 2007),
studies on nonaxenic cultures raised the concern that
auxin detected in algal extracts was of bacterial origin
(Bradley, 1991). Here, using a combination of liquid
chromatography, gas chromatography, and mass spectrometry on axenic cultures, we showed that IAA was
present in low, but significant, amounts in E. siliculosus
sporophytes. IPA and ICA, likely to be decarboxylated
degradation products of IAA (Ljung et al., 2002), were
also detected. The levels of IAA quantified in E.
siliculosus were similar to those found in the brown
alga F. vesiculosus (Basu et al., 2002). No auxin-associated
compound was detected other than these three. They
are either absent from E. siliculosus cells or only
transiently accumulated, in which case they will
probably remain elusive until an IAA biosynthesis
mutant is identified. The identification of homologs of
IAA biosynthesis enzymes suggests that other auxinassociated compounds are transiently present. Accordingly, we identified sequences in the E. siliculosus
genome with similarities to several enzymes of the
TAM and IAOx Trp-dependent IAA biosynthesis
pathway.
Unlike Arabidopsis, which maintains about 99% of
its IAA in conjugated forms (Woodward and Bartel,
2005), no IAA conjugate was detected in E. siliculosus
sporophytes. This is in agreement with previous studies that have shown that brown algae do not store IAA
compounds as amino acid or sugar conjugates (Basu
et al., 2002). Likewise, no significant conservation of
the conjugation enzymes (IAA glucosyltransferases,
IAA aminotransferases, etc.) was detected in the genome. However, significant conservation of homologs
of IBA-metabolic genes was observed, which may
140
Plant Physiol. Vol. 153, 2010
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.
Auxin in the Brown Algal Model Ectocarpus siliculosus
account for the conversion of IAA into IBA for storage
in peroxisomes. However, these enzymes may not be
specific to IBA transport and b-oxidation (Woodward
and Bartel, 2005), as confirmed by the absence of a
detectable level of IBA in E. siliculosus.
In summary, the E. siliculosus genome contains homologs of most genes involved in the Trp-dependent
IAA biosynthesis TAM and IAOx pathways, suggesting that E. siliculosus synthesizes its own IAA. Our
chemical data and genome analysis do not lend support to the hypothesis that IAA conjugates are synthesized and stored. Conversely, the detection of ICA
and IPA supports an alternative hypothesis that has
been proposed for photosynthetic organisms with
simple architecture (Cooke et al., 2002), whereby IAA
homeostasis is ensured by the regulation of IAA
biosynthesis/degradation processes.
Tissue patterning in response to an IAA gradient
raises the puzzling issue of how the gradient is
established. Our survey of the E. siliculosus genome
does not support the conservation of land plant IAA
influx (AUX1) and efflux (PIN) proteins, which may
participate in polarized transport. However, certain
similarities with Arabidopsis remain. E. siliculosus
possesses a putative homolog of BIG, a calossin-like
family protein involved in the auxin control on PIN
endocytosis (Paciorek et al., 2005). In addition, E.
siliculosus has several ABCB efflux IAA transporters,
which participate in the polarized transport of IAA
and stabilize PIN1 (Friml, 2009; Titapiwatanakun et al.,
2009). In E. siliculosus, the auxin transport inhibitor
TIBA affected the late developmental stages. Similarly,
in Fucus distichus, both TIBA and NPA were shown to
alter the developmental pattern of the embryo by
inducing branched rhizoids (Basu et al., 2002). However, the inhibitory effect of NPA and TIBA may not be
strictly specific to PIN proteins, as these molecules act
more generally on actin cytoskeleton dynamics, to
which vesicle-mediated PIN recycling is particularly
sensitive (Dhonukshe et al., 2008). Therefore, the simple architecture of E. siliculosus may be attributable to
basic IAA diffusion from the apical IAA-synthesizing
cells. The physicochemical characteristics of IAA are
compatible with this type of diffusion process (Cooke
et al., 2002), and in F. distichus, molecules as large as
10 kD are able to move through the embryonic cells in
both directions along the polar axis (Bouget et al.,
1998), providing evidence for symplastic transport in
brown algae. Interestingly, E. siliculosus cells possess
plasmodesmata (Charrier et al., 2008), which may
allow auxin to freely diffuse from cell to cell. Alternatively, another, yet-to-be-identified type of IAA efflux
transporter that has no sequence conservation with
PIN proteins may have evolved in brown algae.
Whatever the mode of transport of IAA through the
filament, our data show that E. siliculosus responds to
it, both in terms of morphology and gene expression.
However, the signaling mechanism does not appear to
be similar to the mechanism known in land plants
(Parry and Estelle, 2006; Kepinski, 2007). The ubiquitous proteins of the SCF complex are well conserved,
but we could not identify any specific component of
the auxin-responsive machinery in E. siliculosus. In
particular, we did not find any transcriptional inhibitor similar to AUX/IAA. Their specific targeting
factor, namely a protein similar to the F-box partner
TIR1 (or AFB), is also lacking. Therefore, the control of
gene expression in response to IAA in E. siliculosus
must differ from what is known in land plants. The
mechanism alone may be conserved, relying on different transcriptional inhibitors that would be recognized by an IAA-protein complex able to address them
to degradation. It is possible that the primary sequence
and/or three-dimensional structure of the transcription and targeting factors differ extensively from
known proteins, as long as the key features of the
auxin-regulating model are conserved. In particular, it
would be expected that both the transcription factor
and the targeting factor differ from their counterparts
in land plants and coevolve so as to maintain their
interaction. Alternatively, the mechanism of gene activation by auxin may be unique to a given set of
species, along with a specific pathway and machinery.
This could be the case for the whole Heterokontophyta
phylum, as genomic studies performed on unicellular
heterokonts, namely two diatoms (Armbrust et al.,
2004; Bowler et al., 2008), show that there is no conservation of IAA signaling genes known in land
plants. This suggests that an alternative signaling
pathway exists in these microalgae (Lau et al., 2009).
However, the two possible auxin-signaling pathways
proposed for these species involve the proteins ABP1
and IBR5, for which there is no close relative in E.
siliculosus.
In conclusion, previous studies on E. siliculosus
morphogenesis showed that very local positional information, corresponding to cell-cell recognition,
could be a reliable mechanism that would account
Table III. Oligonucleotides used for the quantification of transcripts by real-time reverse transcription-PCR
Oligonucleotides (Eurogentec, purification Selective Precipitation Optimized Process) were designed using the software Primer Express 1.0 (PE
Applied Biosystems). Sequence is indicated from 5# to 3#. NA, Not applicable.
Genes
Genome
Identifier
GenBank Accession
No. (EST)
5# End
3# End
EsGRP1
EsEF1a
Intron
Esi0109_0088
Esi0387_0021
Esi0092_0006
FP280356
FP297312
NA
TAGTGCTTTGCTATGGATATGCTCAAC
GCAAGGGCCTCAGCTCTG
TCATTTTTCATGTGGAGGTCTCTG
TACAACAGGAGTAGGGATACAGATC
ACAAGCCGTCTGGGTATATGTTAGC
GCCAAACAAACAACAACCCTC
Plant Physiol. Vol. 153, 2010
141
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.
Le Bail et al.
for most of the developmental patterns of the early
filament (Billoud et al., 2008). However, this model
required an additional mechanism to completely explain morphogenesis. Results presented in this study
provide support for auxin-mediated, long-range control of the developmental patterning in the brown alga
E. siliculosus. This developmental patterning is based
on the same cellular responses as in land plants: cell
proliferative competence relative to the highest concentrations of auxin and negative branching control
preventing progression in the life cycle. In addition,
we showed that the genome of this alga contains
elements that are similar to the IAA biosynthetic
machinery operating in land plants. The presence of
IAA in brown algae, coupled with the lack of conservation of IAA transport and signaling pathways in E.
siliculosus, sketches the outline of an evolutionary
scenario of IAA as a signaling molecule over the
more than 1 billion years that separate the green plant
and the heterokont lineages. The study of a recently
identified NAA-hypersensitive mutant in E. siliculosus
will help develop the scenario further.
MATERIALS AND METHODS
Culture of Ectocarpus siliculosus
The experiments were carried out using a unialgal laboratory culture of
haploid E. siliculosus parthenosporophyte isolate Ec 32 (Culture Collection of
Algae and Protozoa accession no. 1310/4; origin, San Juan de Marcona, Peru),
which was produced by germination of unfertilized gametes (Le Bail et al.,
2008a). Thalli were grown in 100-mL petri dishes or 10-L containers in
autoclaved ASW (450 mM NaCl, 10 mM KCl, 9 mM CaCl2, 30 mM MgCl2, and 16
mM MgSO4 at pH 7.8) enriched with Provasoli medium (ASWp; Starr and
Zeikus, 1993) in a controlled-environment cabinet at 13°C with a 14:10-h light:
dark cycle (light intensity of 29 mmol photons m22 s21).
Because some of the studied mutants display abnormal sporangia and no
gametophytic state, controlled production of unfertilized gametes or spores
was not possible. Therefore, young organisms (approximately 10 cells) were
obtained by filtrating a mass culture containing individuals at different
developmental stages.
For the ablation experiments, early filaments were cut with a needle into
pieces containing either E cells only or R cells only. Corresponding fragments
were grown in separate petri dishes in ASW. NAA (5 3 1026 M) was added to
half of the petri dishes of each cell type. Filament development was observed
1 week after ablation. The number of branches was counted, and statistical
analyses were performed using Student’s t test. n = 32 for ASW and n = 23 for
ASW + NAA 5 3 1026 M.
Application of Auxin Compounds on
E. siliculosus Tissues
All the phytohormones were purchased from Duchefa Biochemie. NAA
(N0903), IAA (I0901), IBA (I0902), 2,4-dichlorophenoxyacetic acid (D0910),
and dicamba (D0920) were dissolved in 1 N NaOH at an initial concentration
of 0.5 M and then successively diluted in ASW to 5 mM, 500 mM, and 50 mM.
4-Chlorophenoxyacetic acid (C0909) and PAA (P0913) were dissolved in
ethanol at the same concentrations. TIBA and NPA were dissolved in 0.1%
dimethyl sulfoxide. All the auxin compounds, as well as the auxin transport
inhibitors, were used at final concentrations of 50, 5, and 0.5 mM. Final solvent
concentrations (e.g. 1024, 1025, and 1026 N, respectively, for NaOH) were used
as controls. Only concentrations having an effect on E. siliculosus development
are discussed in the text.
For the microarray experiment, RNA was extracted from a sporophyte
culture grown in natural seawater for several weeks. Cultures were then
subdivided into equal amounts and transferred into petri dishes containing
ASWp with shaking. After 48 h of acclimation, the medium was replaced by
either fresh ASWp + NaOH 1024 N (control) or ASWp + NAA 50 mM, grown
with gentle shaking, and collected after 30 min or 3 h. For the expression
kinetics, cultures were prepared as for the microarray experiments, but
samples were collected after 30 min or 1, 6, 12, and 24 h.
Generation and Observation of Mutants
Mutants were produced following 20 min of UV-B irradiation of E.
siliculosus EC 32 unfertilized gametes. Individuals displaying morphogenetic
alterations were screened with a binocular microscope. The stability of the
selected phenotype was checked for at least five parthenogenetic generations.
Detailed fine-scale observations were performed on an Olympus IX 51
inverted microscope.
Auxin Detection and Quantification
Axenic algal material (50–200 mg) corresponding to mature organisms was
mixed with 1 mL of 50 mM sodium phosphate buffer, pH 7, containing 1 ng
mL21 [indole-13C6]IAA (internal standard), homogenized in Retsch mixer mill,
and extracted for 1 h at 4°C. Samples were then centrifuged, and the resulting
supernatants were transferred to clean tubes and acidified to pH 2.7 with 1 M
hydrochloric acid. Solid-phase extraction was performed using 50-mg BondElut C18 columns (Varian). After application of the samples, columns were
washed with 1 mL of 1% (v/v) formic acid and dried. Compounds of interest
were eluted using 1 mL of acetonitrile containing 0.2% (v/v) formic acid.
Following the solid-phase extraction, samples were vacuum dried, dissolved in 1mL of methanol:acetone mixture (1:9), and reacted with 10 mL of 2 M
trimethylsilyl-diazomethane in hexane for 1 h. The excess of derivatization
reagent was quenched with 10 mL of 2 M acetic acid in n-heptane, and samples
were dried in a stream of nitrogen.
For liquid chromatography, samples were reconstituted in 10 mL of 20%
methanol. Chromatography was performed on a 10- 3 1-mm Thermo
BetaMax precolumn (Thermo Electron) connected to a 50- 3 1-mm Waters
Symmetry Shield C-18 analytical column (Waters). A linear gradient of 20% to
90% methanol containing 0.2% (v/v) formic acid over 20 min at 35 mL min21
flow rate was employed to separate analytes of interest, followed by 5 min of
washing with 100% methanol and a 5-min 20% methanol/0.2% formic acid
equilibration period for each injection. The Waters Quattro Ultima mass
spectrometer was operated in Multiple Reaction Monitoring mode with
electrospray ion source block and desolvation temperatures kept at, correspondingly, 100°C and 290°C. Acquired data were processed using Waters
MassLynx software.
For gas chromatography, samples were dissolved in 25 mL of acetonitrile
and derivatized with 5 mL of N,O-bis(trimethylsilyl)trifluoroacetamide/1%
trimethylchlorosilane at 75°C for 30 min. Separation of the compounds of
interest was achieved using an 80°C to 280°C linear temperature gradient on a
30-m 3 0.25-mm Varian CP-Sil8 CB column, effluent of which was analyzed
by the JEOL JMS-700 magnetic sector mass spectrometer operating in Multiple
Reaction Monitoring mode. The electron-impact ion source and the inlet pipe
were kept at 260°C, and an ionization energy of 70 eV was used. Data were
processed using JEOL XMass software.
In order to release IAA from conjugated forms, samples were treated
beforehand with 7 N NaOH for 24 h.
IAA Immunocytochemical Localization
The protocol was adapted from Avsian-Kretchmer et al. (2002) with
different fixation methods. Sporophytes were grown on coverslips from
germination to the required stage. They were prefixed in 2% (w/v) aqueous
solution of 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (Sigma-Aldrich)
and postfixed in a fresh fixation buffer (47.5% ethanol, 5% acetic acid, and 10%
formaldehyde) during 30 min at room temperature. The fixation buffer was
changed. Tissues were then placed for 5 min in a phosphate-buffered saline
solution (PBS; 2.7 mM KCl, 6.1 mM Na2HPO4, and 3.5 mM KH2PO4, pH 7),
incubated for 45 min in a blocking solution (0.1% [v/v] Tween 20, 1.5% [w/v]
Gly, and 5% [w/v] bovine serum albumin [BSA]), and rinsed in a regular salt
rinse solution (0.1% [v/v] Tween 20, 0.8% [w/v] BSA, and 0.88% [w/v] NaCl)
for 5 min. They were briefly washed in PBS with 0.8% (w/v) BSA. One
hundred microliters of 1:100 (w/v) monoclonal anti-IAA antibody (1 mg
mL21; A0855; Sigma) or monoclonal anti-a-tubulin antibody (1 mg mL21;
T6199; Sigma) was placed on each coverslip and incubated overnight at 4°C.
142
Plant Physiol. Vol. 153, 2010
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.
Auxin in the Brown Algal Model Ectocarpus siliculosus
Three 10-min vigorous washes with high-salt rinse solution (2.9% [w/v] NaCl,
0.1% [v/v] Tween 20, and 0.1% [w/v] BSA) were followed by a 10-min wash
with a regular salt rinse and a brief rinse with 0.8% (v/v) BSA and a rinse in
PBS. One hundred microliters of a 1:100 (v/v) dilution of the 1 mg mL21 antimouse IgG-alkaline phosphatase conjugate (A4312; Sigma) was added to each
slide and incubated for 4 h at room temperature. Five 10-min washes in a
regular salt rinse solution were followed by a brief wash in PBS. Coverslips
were placed in detection buffer (100 mM Tris, pH 9.5, 100 mM NaCl, and 50 mM
MgCl2) during 5 min and then in detection buffer with 350 mL of nitroblue
tetrazolium and 150 mL of 5-bromo-4-chloro-3-indolyl phosphate for 50 mL of
buffer. The reaction was stopped in 10 mM Tris, pH 7.5, and 5 mM EDTA.
Coverslips were then mounted on a slide in Gel-mount (Biomeda) for
microscopic observations.
Microarray
Microarrays were composed of 1,152 PCR products, corresponding to
sporophytic and gametophytic tissues, and are fully described by Peters et al.
(2008). Targets were prepared from RNA extracted from 200 mg of ground
sporophytic material and treated with NAA (see culture conditions), and
RNA was extracted with an extraction buffer (100 mM Tris-HCl, pH 7.5, 1.5 M
NaCl, 2% cetyl-trimethyl-ammonium bromide, 50 mM EDTA, and 50 mM
dithiothreitol) for 1 h with shaking and then with 1 volume of chloroform:
isoamyl alcohol (24:1). Polysaccharides were precipitated in the aqueous
phase with one-fourth volume of 100% ethanol and then extracted with
1 volume of chloroform:isoamyl alcohol. RNAs were precipitated for 2 h with
2.4 M lithium chloride and 1% b-mercaptoethanol and then with a phenolchloroform extraction and alcohol precipitation. Microarray hybridizations
were performed as described by Peters et al. (2008). The data are available at
the Array Express at EMBL-EBI with accession number E-MEXP-1716.
Transcript-Level Quantification by Real-Time PCR
Biological triplicates were prepared from each type of material. Oligonucleotides and RNAs were prepared as described by Peters et al. (2008). The list
of oligonucleotides used is presented in Table III. In addition to DNase-I
treatment, remnants of genomic DNA contaminant were quantified by amplification of an intron and subtracted from the other values. EsEF1a was
chosen as a constitutively expressed gene based on the study by Le Bail et al.
(2008b) and used for transcript-level normalization. The normalized data were
expressed as means 6 SD calculated from the three independent biological
experiments.
Sequence Analyses
Sequences of Arabidopsis (Arabidopsis thaliana) proteins involved in the
different auxin processes were retrieved from the UniProt database release
15.8 (UniProt Consortium, 2009). Their most similar relatives were searched
for within the complete proteome of E. siliculosus (Ectocarpus Genome
Consortium, unpublished data) using BLASTP version 2.2.18 (Altschul
et al., 1997) with a cutoff E value set at 1 3 1025. In order to check for a
BBH, the best hit in E. siliculosus for a given Arabidopsis sequence was used as
a query in a BLASTP search within the whole genome of Arabidopsis. A BBH
was recorded when the best hit for this second search was the starting
Arabidopsis protein. The expression of E. siliculosus proteins was assessed
by the existence of a corresponding EST in the EST databank (Dittami et al.,
2009). Functional domains were identified using the InterProScan software
(Zdobnov and Apweiler, 2001).
Supplemental Data
The following materials are available in the online version of this article.
Supplemental Table S1. Sequence conservation between Arabidopsis and
E. siliculosus.
ACKNOWLEDGMENTS
We are grateful to C. Maisonneuve and L. Dartevelle for maintaining the
E. siliculosus cultures.
Received October 20, 2009; accepted February 17, 2010; published March 3,
2010.
LITERATURE CITED
Abad MJ, Bedoya LM, Bermejo P (2008) Natural marine anti-inflammatory
products. Mini Rev Med Chem 8: 740–754
Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W,
Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs. Nucleic Acids Res 25: 3389–3402
Armbrust EV, Berges JA, Bowler C, Green BR, Martinez D, Putnam NH,
Zhou S, Allen AE, Apt KE, Bechner M, et al (2004) The genome of the
diatom Thalassiosira pseudonana: ecology, evolution, and metabolism.
Science 306: 79–86
Avsian-Kretchmer O, Cheng J, Chen L, Moctezuma E, Sung ZR (2002)
Indole acetic acid distribution coincides with vascular differentiation
pattern during Arabidopsis leaf ontogeny. Plant Physiol 130: 199–209
Baldauf SL (2008) An overview of the phylogeny and diversity of eukaryotes. J Syst Evol 46: 263–273
Basu S, Sun H, Brian L, Quatrano RL, Muday GK (2002) Early embryo
development in Fucus distichus is auxin sensitive. Plant Physiol 130: 292–302
Berger F, Taylor A, Brownlee C (1994) Cell fate determination by the cell
wall in early Fucus. Dev Sci 263: 1421–1423
Bierfreund NM, Reski R, Decker EL (2003) Use of an inducible reporter
gene system for the analysis of auxin distribution in the moss Physcomitrella patens. Plant Cell Rep 21: 1143–1152
Billoud B, Le Bail A, Charrier B (2008) A stochastic 1D nearest-neighbor
automaton models early development of the brown alga Ectocarpus
siliculosus. Funct Plant Biol 35: 1014–1024
Bouget FY, Berger F, Brownlee C (1998) Positional dependent control of cell
fate in the Fucus embryo: role of intercellular communication. Development 125: 1999–2008
Bowler C, Allen AE, Badger JH, Grimwood J, Jabbari K, Kuo A,
Maheswari U, Martens C, Maumus F, Otillar RP, et al (2008) The
Phaeodactylum genome reveals the evolutionary history of diatom genomes. Nature 456: 239–244
Bradley PM (1991) Plant hormones do have a role in controlling growth
and development of algae. J Phycol 27: 317–321
Charrier B, Coelho SM, Le Bail A, Tonon T, Michel G, Potin P, Kloareg B,
Boyen C, Peters AF, Cock JM (2008) Development and physiology of the
brown alga Ectocarpus siliculosus: two centuries of research. New Phytol
177: 319–332
Cooke TJ, Poli D, Sztein AE, Cohen JD (2002) Evolutionary patterns in
auxin action. Plant Mol Biol 49: 319–338
Cove D (2000) The moss Physcomitrella patens. J Plant Growth Regul 19:
275–283
Cove D, Bezanilla M, Harries P, Quatrano R (2006) Mosses as model
systems for the study of metabolism and development. Annu Rev Plant
Biol 57: 497–520
Dhonukshe P, Grigoriev I, Fischer R, Tominaga M, Robinson DG, Hasek
J, Paciorek T, Petrásek J, Seifertová D, Tejos R, et al (2008) Auxin
transport inhibitors impair vesicle motility and actin cytoskeleton dynamics in diverse eukaryotes. Proc Natl Acad Sci USA 105: 4489–4494
Dittami SM, Scornet D, Petit J, Segurens B, Da Silva C, Corre E, Dondrup
M, Glatting K, Konig R, Sterck L, et al (2009) Global expression
analysis of the brown alga Ectocarpus siliculosus (Phaeophyceae) reveals
large-scale reprogramming of the transcriptome in response to abiotic
stress. Genome Biol 10: R66
Friml J (2009) Subcellular trafficking of PIN auxin efflux carriers in auxin
transport. Eur J Cell Biol 89: 231–235
Holtkamp AD, Kelly S, Ulber R, Lang S (2009) Fucoidans and fucoidanases:
focus on techniques for molecular structure elucidation and modification
of marine polysaccharides. Appl Microbiol Biotechnol 82: 1–11
Kai T, Nimura K, Yasui H, Mizuta H (2006) Regulation of sorus formation
by auxin in Laminariales sporophyte. J Appl Phycol 18: 95–101
Katsaros C, Karyophyllis D, Galatis B (2006) Cytoskeleton and morphogenesis in brown algae. Ann Bot (Lond) 97: 679–693
Kepinski S (2007) The anatomy of auxin perception. Bioessays 29: 953–956
Kieliszewski MJ, Lamport DT (1994) Extensin: repetitive motifs, functional sites, post-translational codes, and phylogeny. Plant J 5: 157–172
Klarzynski O, Plesse B, Joubert JM, Yvin JC, Kopp M, Kloareg B, Fritig B
(2000) Linear beta-1,3 glucans are elicitors of defense responses in
tobacco. Plant Physiol 124: 1027–1037
Kloareg B, Quatrano RS (1988) Structure of the cell-walls of marine algae
and ecophysiological functions of the matrix polysaccharides. Oceanogr
Mar Biol 26: 259–315
Plant Physiol. Vol. 153, 2010
143
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.
Le Bail et al.
Kropf DL (1992) Establishment and expression of cellular polarity in fucoid
zygotes. Microbiol Rev 56: 316–339
Kropf DL (1997) Induction of polarity in fucoid zygotes. Plant Cell 9:
1011–1020
Kropf DL, Coffman HR, Kloareg B, Glenn P, Allen VW (1993) Cell-wall
and rhizoid polarity in Pelvetia embryo. Dev Biol 160: 303–314
Lau S, Jürgens G, De Smet I (2008) The evolving complexity of the auxin
pathway. Plant Cell 20: 1738–1746
Lau S, Shao N, Bock R, Jürgens G, De Smet I (2009) Auxin signaling in
algal lineages: fact or myth? Trends Plant Sci 14: 182–188
Le Bail A, Billoud B, Maisonneuve C, Peters AF, Mark Cock J, Charrier B
(2008a) Early development of the brown alga Ectocarpus siliculosus
(Ectocarpales, Phaeophyceae) sporophyte. J Phycol 44: 1269–1281
Le Bail A, Dittami SM, de Franco P, Rousvoal S, Cock MJ, Tonon T,
Charrier B (2008b) Normalization genes for expression analyses in the
brown alga model Ectocarpus siliculosus. BMC Mol Biol 9: 75
Ljung K, Hull AK, Kowalczyk M, Marchant A, Celenza J, Cohen JD,
Sandberg G (2002) Biosynthesis, conjugation, catabolism and homeostasis of indole-3-acetic acid in Arabidopsis thaliana. Plant Mol Biol 49:
249–272
Müller DG (1967) Generationswechsel, Kernphasenwechsel und Sexualität
der Braunalge Ectocarpus siliculosus im Kulturversuch. Planta 75:
39–54
Nafisi M, Goregaoker S, Botanga CJ, Glawischnig E, Olsen CE, Halkier
BA, Glazebrook J (2007) Arabidopsis cytochrome P450 monooxygenase
71A13 catalyzes the conversion of indole-3-acetaldoxime in camalexin
synthesis. Plant Cell 19: 2039–2052
Overbeek R, Fonstein M, D’Souza M, Pusch GD, Maltsev N (1999) The
use of gene clusters to infer functional coupling. Proc Natl Acad Sci USA
96: 2896–2901
Paciorek T, Zazı́malová E, Ruthardt N, Petrásek J, Stierhof Y, KleineVehn J, Morris DA, Emans N, Jürgens G, Geldner N, et al (2005) Auxin
inhibits endocytosis and promotes its own efflux from cells. Nature 435:
1251–1256
Parry G, Estelle M (2006) Auxin receptors: a new role for F-box proteins.
Curr Opin Cell Biol 18: 152–156
Peters AF, Marie D, Scornet D, Kloareg B, Cock JM (2004) Proposal of
Ectocarpus siliculosus (Ectocarpales, Phaeophyceae) as a model organism
for brown algal genetics and genomics. J Phycol 40: 1079–1088
Peters AF, Scornet D, Ratin M, Charrier B, Monnier A, Merrien Y, Corre E,
Coelho SM, Cock JM (2008) Life-cycle-generation-specific developmental processes are modified in the immediate upright mutant of the
brown alga Ectocarpus siliculosus. Development 135: 1503–1512
Phillips N, Burrowes R, Rousseau F, de Reviers B, Saunders GW (2008)
Resolving evolutionary relationships among the brown algae using
chloroplast and nuclear genes. J Phycol 44: 394–405
Ringli C, Keller B, Ryser U (2001) Glycine-rich proteins as structural
components of plant cell walls. Cell Mol Life Sci 58: 1430–1441
Ritter A, Goulitquer S, Salaün J, Tonon T, Correa JA, Potin P (2008)
Copper stress induces biosynthesis of octadecanoid and eicosanoid
oxygenated derivatives in the brown algal kelp Laminaria digitata. New
Phytol 180: 809–821
Starr RC, Zeikus JA (1993) Utex: the culture collection of algae at the
University of Texas at Austin. J Phycol 29: 1–106
Stepanova AN, Robertson-Hoyt J, Yun J, Benavente LM, Xie D, Dolezal K,
Schlereth A, Jürgens G, Alonso JM (2008) TAA1-mediated auxin
biosynthesis is essential for hormone crosstalk and plant development.
Cell 133: 177–191
Stern CD (2006) Evolution of the mechanisms that establish the embryonic
axes. Curr Opin Genet Dev 16: 413–418
Sugawara S, Hishiyama S, Jikumaru Y, Hanada A, Nishimura T, Koshiba
T, Zhao Y, Kamiya Y, Kasahara H (2009) Biochemical analyses of indole3-acetaldoxime-dependent auxin biosynthesis in Arabidopsis. Proc Natl
Acad Sci USA 106: 5430–5435
Sun H, Basu S, Brady SR, Luciano RL, Muday GK (2004) Interactions
between auxin transport and the actin cytoskeleton in developmental
polarity of Fucus distichus embryos in response to light and gravity. Plant
Physiol 135: 266–278
Tarakhovskaya ER, Maslov YI, Shishova MF (2007) Phytohormones in
algae. Russ J Plant Physiol 54: 163–170
Titapiwatanakun B, Blakeslee JJ, Bandyopadhyay A, Yang H, Mravec J,
Sauer M, Cheng Y, Adamec J, Nagashima A, Geisler M, et al (2009)
ABCB19/PGP19 stabilises PIN1 in membrane microdomains in Arabidopsis. Plant J 57: 27–44
UniProt Consortium (2009) The Universal Protein Resource (UniProt).
Nucleic Acids Res 37: D169–D174
Woodward AW, Bartel B (2005) Auxin: regulation, action, and interaction.
Ann Bot (Lond) 95: 707–735
Yamamoto M, Yamamoto KT (1998) Differential effects of 1-naphthaleneacetic acid, indole-3-acetic acid and 2,4-dichlorophenoxyacetic acid on
the gravitropic response of roots in an auxin-resistant mutant of
Arabidopsis, aux1. Plant Cell Physiol 39: 660–664
Yoon HS, Hackett JD, Ciniglia C, Pinto G, Bhattacharya D (2004) A
molecular timeline for the origin of photosynthetic eukaryotes. Mol Biol
Evol 21: 809–818
Zdobnov EM, Apweiler R (2001) InterProScan: an integration platform
for the signature-recognition methods in InterPro. Bioinformatics 17:
847–848
144
Plant Physiol. Vol. 153, 2010
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.