* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Genetics: Getting Down to the Basics. Turner syndrome
Extrachromosomal DNA wikipedia , lookup
Saethre–Chotzen syndrome wikipedia , lookup
Genetic engineering wikipedia , lookup
Public health genomics wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Medical genetics wikipedia , lookup
Genomic library wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Segmental Duplication on the Human Y Chromosome wikipedia , lookup
Essential gene wikipedia , lookup
Quantitative trait locus wikipedia , lookup
Human genome wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Nutriepigenomics wikipedia , lookup
History of genetic engineering wikipedia , lookup
Ridge (biology) wikipedia , lookup
Skewed X-inactivation wikipedia , lookup
Genome evolution wikipedia , lookup
Gene expression profiling wikipedia , lookup
Gene expression programming wikipedia , lookup
Minimal genome wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Genomic imprinting wikipedia , lookup
Biology and consumer behaviour wikipedia , lookup
Designer baby wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Microevolution wikipedia , lookup
Y chromosome wikipedia , lookup
Neocentromere wikipedia , lookup
Genome (book) wikipedia , lookup
Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015 Overview         Brief review of clinical features Learning the language: chromosomes, genes What are genes? How does Turner syndrome happen? X-inactivation: is it important? Types of Turner syndrome How to read a karyotype Fun facts about the X chromosome http://musom.marshall.edu/graphicdesign/ibooks/Genetics.html Goodman RM, Gorlin RJ. The Malformed Infant and Child. Oxford University Press. 1983. What are genes?  Genes give instructions to the body to make certain products, structures, etc.  Eg. Hair colour, height, organs  ~30,000 genes in our body  Present in almost every cell  Many genes need to work in pairs, but some only need one functional copy Another way to think about genes…  English alphabet: A, B, C, D, E,…  Example of English sentence: A cat in the hat.  DNA alphabet: C, G, A, T,…  Example of DNA code: CGATTATGTGCATTGCCCCAT… Code for SHOX gene Another way to think about DNA…  Gene working properly. A cat in the hat. A cat in the hat.  Gene with half its function. A cat in the hot. A cat in the hat.  Gene cannot give proper instructions. A cat in the hot. A cat in the hot. With some genes on the X chromosome  Gene working properly. A cat in the hat. A cat in the hat.  Gene cannot function properly. A cat in the hat. But… not enough! This is also called ‘haploinsufficiency’ How does Turner syndrome happen?  Remember high school Biology?  ‘Reproductive cycles of the cell’? What are the chances of this happening in another pregnancy?  Most cases happen by chance; recurrence risk is considered to be low.  For women WITH Turner syndrome, the risk of having children with Turner may be increased depending of the individual karyotype (for those who can conceive naturally) X-inactivation Happens to all individuals with more than one X chromosome  Eg. 46,XX; 47,XXX; 47,XXY  ONLY 1 X chromosome remains completely active  The other X chromosomes becomes permanently inactive *This makes sense if you think about males having only one X chromosome *Some genes stay active on both X chromosomes (or X and Y in males)  (1) How is this important for Turner syndrome?  Some genes stay activated on both chromosomes  If there is only one X chromosome, genes cannot work in pairs properly  This disruption of instructions leads to the symptoms we see in Turner syndrome Important genes on the X chromosome  SHOX: bone development and growth  Xp11: short stature; ovarian delvelopment impaired in approx. 50 %  Xq13, POF, BMP15: ovarian development  Many genes have unknown function ‘Types’ of Turner syndrome     Reminder: There is a lot of variability of symptoms regardless of the type ‘Classic’: Typically individuals who are missing one entire X chromosome ‘Partial’: Individuals with a part of the X chromosome missing, or structural changes of one X chromosome ‘Mosaic’: Individuals with two X chromosomes in some cells, and others with only one X chromosome Examples  45, X  45, X/46, XX  45, X/46,X,r(X)  45,X/46,X,del(Xp)  45, XO  46,X,dup(X) Classic TS Mosaic TS Mosaic TS + Structural variant Structural variant TS Relative Frequencies of Turner Syndrome Karyotypes Standard monosomy 45,X 46 % X mosaicism X/XX, X/XXX 7% Isochromosome Xq 45,X/46,X,i(Xq) 46,X,i(Xq) 18 % Ring 45,X/46,X,r(X) 16 % Deletion Xp 45,X/46,X,del(Xp) 46,X,del(Xp) 5% Structural abnormality of Y 6% Other 2% Jacobs et al. (1997). So… how DO you read a karyotype? Sex chromosomes Total # of chromosomes So… how DO you read a karyotype? Sex chromosomes Mosaicism # of colonies analyzed Total # of chromosomes Description of where the structural change is Abbreviation for structural change Eg. DUP > duplication DEL > deletion IDIC > isodicentric r > ring i > isochromosome Structural changes Structural changes (con’t) Structural changes (con’t) Structural changes (con’t) Fun Facts About the X Chromosome X chromosome represents about 5 % of total DNA  X chromosome likely has 800-900 genes (~30,000 genes in the genome)  75-80 % of cases, the single X chromosome comes from the egg  Males cannot survive without an X chromosome (45,Y does not exist) Thank-you! Bibliography     Alberts B, Johnson A, Lewis J, et al. Molecular Biology of the Cell. 4th edition. New York: Garland Science; 2002. Gardner RJM, Sutherland GR. 3rd edition. Chromosome abnormalities and genetic counseling. Oxford Univeristy Press. 2004. Goodman RM, Gorlin RJ. The Malformed Infant and Child. Oxford University Press. 1983. Zhong Q, Layman LC. Genetic considerations in the patient with Turner syndrome--45,X with or without mosaicism. Fertil Steril. 2012 Oct;98(4):7759.
 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                            