Download Human Evolution

Human Evolution
Chapter 16
Evolution
Evolution simply means change over time
• Geneticists define evolution as:
Changing allele frequencies
• Most scientist’s agree with Darwin’s
mechanism of how evolution happens:
Survival of the fittest – those with the best
alleles have the most offspring survive
• “Natural Selection”
Evolution
The origin and changing of groups
or organisms over time caused by
their interactions with the natural
world
Evolution:
Evolution is both:
A scientific fact:
- Repeatedly tested and not been refuted
- “Confirmed to such a degree that it would be
perverse to withhold provisional consent"
- Stephen J. Gould
And a scientific theory:
- A hypothesis that simply and elegantly
explains the observations, that predicts
phenomena, and that withstands many
potential falsifications
Evolution:
Evolution is a fact in the sense that life
changing through time has been proven:
In nature today, the characteristics of species are
changing, and new species are arising.
The fossil record is the primary factual evidence
for evolution in times past
Evolution is well documented by further evidence
from many scientific disciplines:
Comparative anatomy, geology, genetics,
molecular biology, zoology and studies of viral
and bacterial diseases.
Evolution:
Evolution is also a theory:
An explanation for the observed changes in
life through Earth history
Has been tested numerous times without
being refuted
and
Predicts something about the natural world
that can be measured/checked
How Evolution Happens?
Theory is derived from Charles Darwin
• Process of “Natural Selection”
• Natural Selection:
– Survival of the Fittest (alleles)
– Whatever adaptations are better suited to
the environment then go on to become the
most prevalent adaptations
– Decent with modification (of allele freq’s)
Process of Natural Selection:
1. Organisms are always varied
2. When the environment that organisms
live in changes some organisms are
better “adapted” to handle the change
3. Better adapted animals are more
successful
4. More successful means having more
offspring survive
5. More offspring then pass down beneficial
adaptations (increase allele frequency)
Changing Allele Frequency
More offspring then pass down more of the
beneficial alleles:
• Increase or decrease in allele frequency
• Effect is seen in a change in the
phenotype frequencies
– Since phenotypes are encoded by alleles
• Eventually may lead to speciation:
– When organisms become so different that
they actually form a new species
Speciation
Three main ways that speciation can occur:
1. Allopatric
•
•
•
Geographical isolation
Differences in alleles that are selected
Different alleles due to genetic drift
2. Sympatric
•
No geographical isolation
3. Parapatric
•
Two diverging species geographically touch
but do not overlap
Speciation Debate
There are some interesting debates about
some of the details of evolution:
• Some believe that speciation events
happen at a steady rate over time
• Others believe that species remain
unchanged over long periods of time –
then speciation happens suddenly
• Punctuated Equilibrium
Examples – Changing Alleles
• Moths
• Diversity of finch beak shapes
and sizes
• Changes in hominids (our ancestors and us)
Human Origins
• Evidence is combined from
• Fossils:
– Whatever is fossilized
– Uranium dating
• Molecular evolution:
– Comparing genomic differences/similarities
– Chromosome patterns
– DNA or Protein sequences
Human Origins
Humans started diverging from apes about 5
or 6 Million Years Ago (MYA)
• Hominids separated from other primates
– Ancestors of humans only
• Genus Australopithecus first:
– Around 4 MYA
• Genus Homo came last:
– Around 2 MYA
Human Origins
Genus Homo came last:
– Around 2 MYA
1. Homo habilis
– First used tools, cave dwellers
2. Homo erectus
– Used advanced tools, fire, complex society
– Had skull shaped for possibility of speech
3. Neanderthals and Cro-Magnons diverge
along two separate paths
Human Origins
Neanderthals and Cro-Magnons diverge
along two separate paths:
• Common ancestor between two lived
around 600 to 700 thousand years ago
• Neanderthals:
– Prominent brow, shorter compact body
– Evidence suggests most likely different
species
•
Cro-Magnon:
– Homo sapiens’ direct ancestor
Human Origins – Summary:
Know the types of evidence:
– Fossils
– Molecular
Know in general the differences between:
• Australopithecus vs. Homo
• Homo habilis vs. Homo erectus
• Neanderthals vs. Cro-Magnon
Basic timeline in MYA
Molecular Evolution
Using molecular biology to provide
information about evolutionary history
Comparing:
1. Genomes
2. Chromosome banding patterns
3. Sequences
More that is shared, more closely related
• Build evolutionary tree
Comparing Genomes
Align the entire genome between different
organisms
• Or align pieces of genome
• Either way; some areas are “conserved”
• There must be some selective pressure on
these regions of the genome to remain
constant over time and evolution
• Usually genes and regulatory sequences
Comparing Genomes
Zoom in closer…
Comparing Chromosomes
Looking at similarities in chromosome
banding pattern
Comparing Chromosomes
• Finding synteny between different
organisms
• Synteny = whole regions of chromosomes
that are completely identical between two
different species:
– Order of the genes exact
– Regulatory regions positions exact
– However, non coding regions may be varied
(no selective pressures)
Comparing Chromosomes
Human Chromosomes
1
2
3
4 5
6
7 8
9 10 11 12 13 14 15 16 17 18 19 20 21 22 X
Mouse Chr. 17
large stretches
of synteny
Mouse Chr. 8
small regions
of synteny
Comparing
Chromosomes
Human chromosomes
with mouse pieces
labeled
Comparing Sequences
Analyze the exact sequence of either DNA or
proteins between species
• Most proteins are very similar even in very
diverse organisms
• Protein function has been conserved during
evolution
• Certain genes don’t exist in lower
organisms – can you think of some?
• You would be surprised how many do…
Comparing Sequences
• Between Humans and Chimps proteins
share average of 99 percent of the exact
same amino acids
• Mice and humans have the same number
of genes and are often in the same order –
fair amount of synteny
• 2/3rd of all human genes exist as the same
gene in fruit flies
• Why are we so different then?
– Gene Expression, Alternative Splicing, etc
Animal Models
• Because so many of the genes have
remained constant between different
species…
• What sort of experiments can we do?
– Use animals as genetic models to discover
genes and gene function
– Test out drugs on animals first
– Even use animal parts or proteins
ex – Insulin
Comparing Sequences
• Known as “alignment” – when you try to
line up two sequences of DNA
Alignment 1 of 131 in window
Human July 2005 (hg17)
Chimp Nov. 2003 (panTro1)
Mouse May 2004 (mm5)
Rat Jun. 2003 (rn3)
hg17.chr7
panTro1.chr6
mm5.chr6
rn3.chr4
chr7:127471196-127471526, strand +, size 331
chr6:129885077-129885407, strand +, size 331
chr6:28904572-28904928, strand +, size 357
chr4:56178192-56178473, strand +, size 282
aatctaggtgatgggtatattgtagttcactatagtattgcacacttttctgtatgtttaaa-tttttcat
aatctaggtgatgggtatattgtagttcactatagtattgcacacttttctgtatgtttaaaattttcat
catatgggtaataagta-----taactcactatattatttttcacta-t----tg--tgtttgaaattttcat
catatgggtaataagta-----taattcgt-tatattatt------------tttct-ta-----gaa-tttttcat
Comparing Sequences
• Also can compare protein’s amino acid
sequence
• Bright pink are different amino acids than
human sequence
Hybridization
• Closer the
sequences are, the
better two strands
will “hybridize”
• Attach via
complementary
base pairing
Molecular Clocks
• Because the mutation rate is fairly
constant:
– Around 1 % per 1 Million Years for coding
regions
• Amount of differences between two
species can give an estimate of how
closely related they are
• Compare sequences and calculate an
estimate of evolution between them
Molecular Clocks
• Calculated on Autosomes – gives
information about conservation and
relationship in general
• Calculated on mitochondria – gives
information about maternal lineage:
– Find “Eve”
• Calculated on Y chromosome – gives
information about paternal lineage
– Find “Adam”
Parsimony Analysis
• Parsimony is the idea that the simplest
explanation of a phenomenon is the most
likely.
In building an evolutionary tree:
• Each mutation is a rare event
• Less mutations it takes – more likely that
tree is to be correct
• More mutations it takes – less likely
Parsimony Analysis
Eugenics
Controlling human reproductive choices for
societal goals
• Basically – it’s artificial selection:
– Same as we do to cows, tomatoes, dogs
• What do you know about eugenics?
• What are the pros and cons?
Eugenics
• Been around for thousands of years,
perhaps even since the dawn of civilization
• Sir Francis Galton – 1883 coined the term
“Good in birth”
• Positive Eugenics – trying to select and
breed superior attributes
• Negative Eugenics – trying to stop
(sterilize) individuals with inferior attributes
Eugenics
Examples:
• Caste system in India
• Nazi Germany
• USA:
– Begins around 1890’s with laws against
breeding with certain individuals
– 1956 – Sterilization laws repealed
– 1967 – Laws banning marriages between
different races repealed
Summary
• Be able to define evolution and describe
mechanism of Natural Selection
• Know basics of human origins and
evolution
• Know different methods for using
Molecular Biology to interpret evolutionary
relationships
• Humans can change our own evolution –
through Eugenics
Next Class:
• Read Chapter Seventeen
• Homework – Chapter Sixteen Problems;
– Review: 6, 7, 8, 15, 16, 17, 18
– Applied: 1, 15