* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Human Evolution
Artificial gene synthesis wikipedia , lookup
Metagenomics wikipedia , lookup
Point mutation wikipedia , lookup
Polymorphism (biology) wikipedia , lookup
Human genome wikipedia , lookup
Transitional fossil wikipedia , lookup
Population genetics wikipedia , lookup
Genome evolution wikipedia , lookup
Adaptive evolution in the human genome wikipedia , lookup
Human Evolution Chapter 16 Evolution Evolution simply means change over time • Geneticists define evolution as: Changing allele frequencies • Most scientist’s agree with Darwin’s mechanism of how evolution happens: Survival of the fittest – those with the best alleles have the most offspring survive • “Natural Selection” Evolution The origin and changing of groups or organisms over time caused by their interactions with the natural world Evolution: Evolution is both: A scientific fact: - Repeatedly tested and not been refuted - “Confirmed to such a degree that it would be perverse to withhold provisional consent" - Stephen J. Gould And a scientific theory: - A hypothesis that simply and elegantly explains the observations, that predicts phenomena, and that withstands many potential falsifications Evolution: Evolution is a fact in the sense that life changing through time has been proven: In nature today, the characteristics of species are changing, and new species are arising. The fossil record is the primary factual evidence for evolution in times past Evolution is well documented by further evidence from many scientific disciplines: Comparative anatomy, geology, genetics, molecular biology, zoology and studies of viral and bacterial diseases. Evolution: Evolution is also a theory: An explanation for the observed changes in life through Earth history Has been tested numerous times without being refuted and Predicts something about the natural world that can be measured/checked How Evolution Happens? Theory is derived from Charles Darwin • Process of “Natural Selection” • Natural Selection: – Survival of the Fittest (alleles) – Whatever adaptations are better suited to the environment then go on to become the most prevalent adaptations – Decent with modification (of allele freq’s) Process of Natural Selection: 1. Organisms are always varied 2. When the environment that organisms live in changes some organisms are better “adapted” to handle the change 3. Better adapted animals are more successful 4. More successful means having more offspring survive 5. More offspring then pass down beneficial adaptations (increase allele frequency) Changing Allele Frequency More offspring then pass down more of the beneficial alleles: • Increase or decrease in allele frequency • Effect is seen in a change in the phenotype frequencies – Since phenotypes are encoded by alleles • Eventually may lead to speciation: – When organisms become so different that they actually form a new species Speciation Three main ways that speciation can occur: 1. Allopatric • • • Geographical isolation Differences in alleles that are selected Different alleles due to genetic drift 2. Sympatric • No geographical isolation 3. Parapatric • Two diverging species geographically touch but do not overlap Speciation Debate There are some interesting debates about some of the details of evolution: • Some believe that speciation events happen at a steady rate over time • Others believe that species remain unchanged over long periods of time – then speciation happens suddenly • Punctuated Equilibrium Examples – Changing Alleles • Moths • Diversity of finch beak shapes and sizes • Changes in hominids (our ancestors and us) Human Origins • Evidence is combined from • Fossils: – Whatever is fossilized – Uranium dating • Molecular evolution: – Comparing genomic differences/similarities – Chromosome patterns – DNA or Protein sequences Human Origins Humans started diverging from apes about 5 or 6 Million Years Ago (MYA) • Hominids separated from other primates – Ancestors of humans only • Genus Australopithecus first: – Around 4 MYA • Genus Homo came last: – Around 2 MYA Human Origins Genus Homo came last: – Around 2 MYA 1. Homo habilis – First used tools, cave dwellers 2. Homo erectus – Used advanced tools, fire, complex society – Had skull shaped for possibility of speech 3. Neanderthals and Cro-Magnons diverge along two separate paths Human Origins Neanderthals and Cro-Magnons diverge along two separate paths: • Common ancestor between two lived around 600 to 700 thousand years ago • Neanderthals: – Prominent brow, shorter compact body – Evidence suggests most likely different species • Cro-Magnon: – Homo sapiens’ direct ancestor Human Origins – Summary: Know the types of evidence: – Fossils – Molecular Know in general the differences between: • Australopithecus vs. Homo • Homo habilis vs. Homo erectus • Neanderthals vs. Cro-Magnon Basic timeline in MYA Molecular Evolution Using molecular biology to provide information about evolutionary history Comparing: 1. Genomes 2. Chromosome banding patterns 3. Sequences More that is shared, more closely related • Build evolutionary tree Comparing Genomes Align the entire genome between different organisms • Or align pieces of genome • Either way; some areas are “conserved” • There must be some selective pressure on these regions of the genome to remain constant over time and evolution • Usually genes and regulatory sequences Comparing Genomes Zoom in closer… Comparing Chromosomes Looking at similarities in chromosome banding pattern Comparing Chromosomes • Finding synteny between different organisms • Synteny = whole regions of chromosomes that are completely identical between two different species: – Order of the genes exact – Regulatory regions positions exact – However, non coding regions may be varied (no selective pressures) Comparing Chromosomes Human Chromosomes 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X Mouse Chr. 17 large stretches of synteny Mouse Chr. 8 small regions of synteny Comparing Chromosomes Human chromosomes with mouse pieces labeled Comparing Sequences Analyze the exact sequence of either DNA or proteins between species • Most proteins are very similar even in very diverse organisms • Protein function has been conserved during evolution • Certain genes don’t exist in lower organisms – can you think of some? • You would be surprised how many do… Comparing Sequences • Between Humans and Chimps proteins share average of 99 percent of the exact same amino acids • Mice and humans have the same number of genes and are often in the same order – fair amount of synteny • 2/3rd of all human genes exist as the same gene in fruit flies • Why are we so different then? – Gene Expression, Alternative Splicing, etc Animal Models • Because so many of the genes have remained constant between different species… • What sort of experiments can we do? – Use animals as genetic models to discover genes and gene function – Test out drugs on animals first – Even use animal parts or proteins ex – Insulin Comparing Sequences • Known as “alignment” – when you try to line up two sequences of DNA Alignment 1 of 131 in window Human July 2005 (hg17) Chimp Nov. 2003 (panTro1) Mouse May 2004 (mm5) Rat Jun. 2003 (rn3) hg17.chr7 panTro1.chr6 mm5.chr6 rn3.chr4 chr7:127471196-127471526, strand +, size 331 chr6:129885077-129885407, strand +, size 331 chr6:28904572-28904928, strand +, size 357 chr4:56178192-56178473, strand +, size 282 aatctaggtgatgggtatattgtagttcactatagtattgcacacttttctgtatgtttaaa-tttttcat aatctaggtgatgggtatattgtagttcactatagtattgcacacttttctgtatgtttaaaattttcat catatgggtaataagta-----taactcactatattatttttcacta-t----tg--tgtttgaaattttcat catatgggtaataagta-----taattcgt-tatattatt------------tttct-ta-----gaa-tttttcat Comparing Sequences • Also can compare protein’s amino acid sequence • Bright pink are different amino acids than human sequence Hybridization • Closer the sequences are, the better two strands will “hybridize” • Attach via complementary base pairing Molecular Clocks • Because the mutation rate is fairly constant: – Around 1 % per 1 Million Years for coding regions • Amount of differences between two species can give an estimate of how closely related they are • Compare sequences and calculate an estimate of evolution between them Molecular Clocks • Calculated on Autosomes – gives information about conservation and relationship in general • Calculated on mitochondria – gives information about maternal lineage: – Find “Eve” • Calculated on Y chromosome – gives information about paternal lineage – Find “Adam” Parsimony Analysis • Parsimony is the idea that the simplest explanation of a phenomenon is the most likely. In building an evolutionary tree: • Each mutation is a rare event • Less mutations it takes – more likely that tree is to be correct • More mutations it takes – less likely Parsimony Analysis Eugenics Controlling human reproductive choices for societal goals • Basically – it’s artificial selection: – Same as we do to cows, tomatoes, dogs • What do you know about eugenics? • What are the pros and cons? Eugenics • Been around for thousands of years, perhaps even since the dawn of civilization • Sir Francis Galton – 1883 coined the term “Good in birth” • Positive Eugenics – trying to select and breed superior attributes • Negative Eugenics – trying to stop (sterilize) individuals with inferior attributes Eugenics Examples: • Caste system in India • Nazi Germany • USA: – Begins around 1890’s with laws against breeding with certain individuals – 1956 – Sterilization laws repealed – 1967 – Laws banning marriages between different races repealed Summary • Be able to define evolution and describe mechanism of Natural Selection • Know basics of human origins and evolution • Know different methods for using Molecular Biology to interpret evolutionary relationships • Humans can change our own evolution – through Eugenics Next Class: • Read Chapter Seventeen • Homework – Chapter Sixteen Problems; – Review: 6, 7, 8, 15, 16, 17, 18 – Applied: 1, 15