* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download UNIT ONE Exam Review 2013 - Mr. Lesiuk
DNA supercoil wikipedia , lookup
Epigenomics wikipedia , lookup
Non-coding DNA wikipedia , lookup
Genetic drift wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Genetic engineering wikipedia , lookup
Polymorphism (biology) wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Designer baby wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Group selection wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Koinophilia wikipedia , lookup
Adaptive evolution in the human genome wikipedia , lookup
Helitron (biology) wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
History of genetic engineering wikipedia , lookup
Population genetics wikipedia , lookup
UNIT ONE: ADAPTATION AND EVOLUTION REVIEW * Answer each question on a separate piece of paper, when you can answer all questions without any hesitation you can consider yourself well prepared for the Unit Exam. 1. List the 7 main characteristics common to life. (Hint: R.H. CAGER) 2. Define and give examples of homeostasis. 3. Describe what “Abiogenesis” means and give the other more common name for this theory. 4. Describe the experiment that each scientist conducted: - Redi - Needham - Spallanzani - Pasteur 5. List the two main principles of the “Cell Theory” *Be capable of identifying all the parts of compound light microscope. 6. Give the function of each structure below: - Revolving Nose Piece - Condenser Diaphragm 7. What is meant by the “limit of resolution”? 8. For each power listed, give the power of the ocular lens, the power of the objective lens, and the total power (For a standard scope)- Low Power - High Power -Medium Power 9. What is the total power of a microscope with an ocular (15X) and an objective (20X)? 10. How many millimeters are in a cm? How many um in a millimeter, how many um in a cm? 11. The field of view is 4.5 mm, how many um is this? 12. If the field of view is 2.2 mm, how many um long is the specimen to the right? 13. What is the drawing magnification for the drawing to the right? 14. What are the basic building blocks for each of the following: a) Proteins b) DNA 15. List the three major nutrient groups. 16. How many different amino acids are there? 17. Write out the proper name of DNA. 18. What three molecules bond together to make up a single nucleotide? 19. What term is used to most accurately describe the shape of a DNA molecule? 20. DNA is usually found wrapped around small proteins called Histones, this then forms a long string called what? 21. This string like substance bunches up to form X-shaped structures just before cell division. What are these X-shaped structures called? 22. How many of these X-shaped structures are found in a human diploid cell, how about in a haploid human cell? 23. Describe what a gene is? 24. Compare and contrast Purines vs. Pyrimidines. 25 Name the four different nitrogenous bases, and classify which category they fit in 26. What type of bond forms between complimentary bases? 27. For the following strand of DNA, give the complimentary strand: ______________________________________________ ACGTTTAGCCGATTAAGAGCATA 28. Describe the process of replication, and where does it take place? 29. During protein synthesis, Translation and Transcription takes place, describe what each process is and where each takes place. 30.Using a phylogenetic tree, how closely related is the "cytochrome C" of a dog and a pig? 31. Which shows the closest genetic relationship? Pig Donkey Pig Dog or Horse Dog 32. Which is most closely related? Silkworm Fruit fly Fruit fly Hornworm or Hornworm Silkworm 33. List and describe at least 5 studies/topics that provide evidence to support evolution. 34. List and describe the three main categories of “Adaptations” 35. Give an example of all three for the following: A) An animal B) A plant 36. What is the name of the theory that Darwin used to explain evolution, what is its more common name? 37. What is the name of the theory that Lamarck used to explain evolution? 38. Compare and contrast each theory. 39. Describe the contributions of each: - Charles Lyell - Thomas Malthus - Artificial Selection 40. List the main factors that must be established for Natural Selection to work. 41. List the three main ways that Natural Selection can change a population and draw a graph for to represent each type of selection 42. Describe the case of natural selection known as "Industrial Melanism". 43. Who is the father of genetics? 44. Define the following: A) Phenotype B) Allele C) Genotype D) Meiosis E) Homozygous F) Segregation G) Heterozygous I) Crossover 45. What two processes are most responsible for creating variation in a population? 46. Do punnett squares to show the F1 Generation for each cross. A) Heterozygous Black Rabbit X Heterozygous Black Rabbit B) Heterozygous Tall Pea Plant X Homozygous recessive 47. What type of crossing must have taken place to produce an F1 Generation consisting of 50% white rabbits to 50% Black rabbits, let black be dominant. 48. For the following data – give the A) Allelic Frequency, B) Genotypic Ratio and C) Phenotypic Ratio. - Allow B (Black fur coat) to be dominant to b (white fur) BB Bb bb Bb Bb BB Bb bb BB bb Bb Bb Bb bb Bb Bb bb Bb Bb Bb bb BB BB BB bb 49. Describe what “Genetic Equilibrium” is and list the 5 conditions that must be maintained for GE to be maintained. 50. Describe what each is and give an example of how each could change the allelic frequencies in a gene pool. A) Differential Migration B) Genetic Drift 51. Compare and contrast the two categories of evolution: Divergence vs. Convergence. 52. What category would “adaptive radiation” fit into, and describe at least one example of adaptive radiation. 53 Define the following: A) Species D) Niche B) Population E) Analogous Structures C) Speciation F) Homologous Structures 54. Describe the difference in views between Gradualism and Punctuated Equilibrium STUDY HARD - BE PREPARED