Download Exam 3 Review B - Iowa State University

BIO 313 Exam 3 Review B
Supplemental Instruction
Iowa State University
Leader:
Course:
Instructor:
Date:
Laura
Bio 313
Dr. Rodermel
10/25/15
1. Which of the following is not required to splicesome-mediated splicing
a. Branch point
b. 3’ consensus sequence
c. snRNPs
d. 5’ UTR
2. What component of mRNA contributes to the stability of the mRNA and facilitates
binding of ribosome to mRNA
a. 5’ cap
b. PolyA tail
c. RNA editing
d. RNA splicing
3. If you have 4 exons, how many lariats would form? What is responsible for the lariat?
a. 3, splicesome
b. 3, mRNA
c. 6, splicesome
d. 6, mRNA
4. How many amino acids would be expressed if the mRNA sequence is 54 bases long?
a. 20
b. 16
c. 12
d. 18
5. All are true about alternative splicing except
a. Helps produce a mature RNA
b. Is unable to get rid of exons
c. Allows for increased complexity
d. Requires two or more 3’ cleavage sites
6. An inherited factor for a trait is known as
a. Exon
b. Intron
c. Gene
d. Protein
7. The one gene, one enzyme hypothesis is
a. One gene encodes for a single exon
b. One gene encodes for a single polypeptide
c. One based can change a protein
d. One codon codes for one amino acid
1060 Hixson-Lied Student Success Center  515-294-6624  [email protected]  http://www.si.iastate.edu
8. The following amino acid could be categorized as
a.
b.
c.
d.
Polar, positively charged
Polar, uncharged
Non-polar, aromatic
Non-polar, aliphatic
9. Which one of the following properties would belong to the previous amino acid
a. Hydrophobic
b. Hydrophilic
c. Contains a ring
d. Forms a hydrogen bond
10. Amino acids are joined together by ______ bonds to form a __________
a. Hydrogen, primary structure
b. Covalent, tertiary structure
c. Peptide, polypeptide
d. Aminoacyl, tRNA
11. Which is not true about tertiary structure of proteins?
a. Folds spontaneously
b. Uses hydrogen bonds
c. Uses more than one amino acid
d. Uses hydrophobic interactions
12. If humans had a doublet code but retained the four bases, how many amino acids would
be possible?
a. 20
b. 64
c. 16
d. 12
13. A codon is
a. One of the three nucleotides that encode an amino acid
b. Three nucleotides that encode an amino acid
c. Three amino acids that encode a nucleotide
d. One of four bases in DNA
14. Through wobble, a single ________ can pair with more than one _________
a. Codon, anticodon
b. Group of three nucleotides in DNA, codon in mRNA
c. tRNA, amino acids
d. Anticodon, codon
15. The concept that an amino acid can be specified by more than one codon is known as
a. Colinearity
b. Degeneracy
c. Isoaccepting
d. Synonymity
16. This helps set the reading frame for translation
a. Shine-Dalgarno sequence
b. Kozak sequence
c. Initiation codon
d. 5’ cap
17. Which of the following meets the requirement set by Crick for the adaptor molecule?
a. Splicesome
b. Ribosome
c. tRNA
d. mRNA
18. The arm of tRNA that binds the amino acid is
a. DHU
b. TC arm
c. Anticodon arm
d. Acceptor arm
19. Which of the following doesn’t bind to the small subunit of the ribosome during initiation
a. IF-1
b. IF-2
c. IF-3
d. mRNA
20. What is the proper way to refer to the directionality of a protein?
a. 5’  3’
b. 3’  5’
c. C  N
d. N  C
21. Chemical linkage of tRNA charging is known as
a. Translation
b. Elongation
c. tRNA charging
d. Splicesome mediated splicing
22. If EF-Ts were mutated what would be its effect?
a. No protein produced
b. Translocation would not take place
c. The mRNA would be unable to locate the ribosome
d. New charged tRNAs would not be added to the A site
23. Which of the following is not used in tRNA charging?
a. GTP
b. ATP
c. Aminoacyl tRNA synthetases
d. AMP
24. The following nucleotide sequence codes for what polypeptide sequence?
5’ – AUGGGUAUCUCACGUACGAUCCGAAGGUAG – 3’
a.
a.
b.
c.
fMet- gly-ile-ser-arg-thr-ile-arg-ser-stop
fMet-gly-ile-ser-arg-thr-ile-arg-arg-stop
Met- gly-ile-ser-arg-thr-ile-arg-ser
Met- gly-ile-ser-arg-thr-ile-arg-arg
25. In a polyribosome, the polypeptides associated with which ribosomes will be the longest?
a. Those at the 5’ end
b. Those at the 3’ end
c. Those in the middle of the mRNA
d. All polypeptides will be the same length
26. Describe the function of CAP-binding proteins in initiation of translation
27. Draw a ribosome with all the sites labeled:
28. What is the similarities and difference between RF2 and RF3?
29. What are the three post-translational modifications?
a.
b.
c.
30. What are the targets for the following antibiotics?
a. Tetracycline
b. Neomycin
c. Choramphenicol
d. Streptomycin
e. Puromycin
31. Fill out the following table:
Stage of Translation
Initiation
Elongation
Termination
Requirements