Deoxyribonucleic Acid Base Composition of Acetic
... Estimation of D N A base composition by thermal denaturation. DNA was isolated according to the method of Marmur (1961). Thermal denaturation was followed at 260 m p in a Beckman spectrophotometer (model DU) as described by Marmur & Doty (1962). To protect the photocell and the slit of the monochrom ...
... Estimation of D N A base composition by thermal denaturation. DNA was isolated according to the method of Marmur (1961). Thermal denaturation was followed at 260 m p in a Beckman spectrophotometer (model DU) as described by Marmur & Doty (1962). To protect the photocell and the slit of the monochrom ...
Chapter 17 From Gene to Protein Multiple-Choice Questions
... 7) Using RNA as a template for protein synthesis instead of translating proteins directly from the DNA is advantageous for the cell because A) RNA is much more stable than DNA. B) RNA acts as an expendable copy of the genetic material. C) only one mRNA molecule can be transcribed from a single gene, ...
... 7) Using RNA as a template for protein synthesis instead of translating proteins directly from the DNA is advantageous for the cell because A) RNA is much more stable than DNA. B) RNA acts as an expendable copy of the genetic material. C) only one mRNA molecule can be transcribed from a single gene, ...
FEMS Microbiology Letters
... metabolism (Hartmann & Zimmer, 1994), and this metabolic flexibility lends itself to a wide variety of possible biotechnological and environmental applications. Indeed, Azospirillum not only contributes to improved yields of economically significant agronomical plants, but these bacteria also have p ...
... metabolism (Hartmann & Zimmer, 1994), and this metabolic flexibility lends itself to a wide variety of possible biotechnological and environmental applications. Indeed, Azospirillum not only contributes to improved yields of economically significant agronomical plants, but these bacteria also have p ...
Emmission Spectroscopy
... absorption of light), mechanical (friction), or chemical mechanism. Photoluminescence: Generation of luminescence through excitation of a molecule by ultraviolet or visible light photons. Divided into two categories: fluorescence and phosphorescence, depending upon the electronic configuration of th ...
... absorption of light), mechanical (friction), or chemical mechanism. Photoluminescence: Generation of luminescence through excitation of a molecule by ultraviolet or visible light photons. Divided into two categories: fluorescence and phosphorescence, depending upon the electronic configuration of th ...
Quantitative RT–PCR Platform to Measure Transcript Levels of C
... array is available for the transcriptome analysis of bread wheat; however, quantitative reverse transcription–PCR (qRT–PCR) is estimated to be at least 100-fold more sensitive than DNA arrays in detecting transcripts (Czechowski et al. 2004). Gene expression quantification by qRT–PCR requires effici ...
... array is available for the transcriptome analysis of bread wheat; however, quantitative reverse transcription–PCR (qRT–PCR) is estimated to be at least 100-fold more sensitive than DNA arrays in detecting transcripts (Czechowski et al. 2004). Gene expression quantification by qRT–PCR requires effici ...
Journal of Applied Phycology
... DNA digested with BglII was ligated to BamHI digested pUC19. The clones were screened by carrying out PCR with two consensus recA primers (A: 5' CTCCATGCGATCGCCGAAGT 3' and B: 5' GGTITGGATGCGGCGGATATCTA 3') which were based on the conserved amino acid sequences LHAIAEV and LDIRRIQT in the Anabaena v ...
... DNA digested with BglII was ligated to BamHI digested pUC19. The clones were screened by carrying out PCR with two consensus recA primers (A: 5' CTCCATGCGATCGCCGAAGT 3' and B: 5' GGTITGGATGCGGCGGATATCTA 3') which were based on the conserved amino acid sequences LHAIAEV and LDIRRIQT in the Anabaena v ...
The methylcitric acid pathway in Ralstonia eutropha
... Typhimurium and high sequence similarity. (ii) For the translational product of acnM the function of a 2-methyl-cis-aconitic acid hydratase (94 726 Da) is proposed. This protein and also the ORF5 translational product are essential for growth on propionic acid, as revealed by the propionic-acid-nega ...
... Typhimurium and high sequence similarity. (ii) For the translational product of acnM the function of a 2-methyl-cis-aconitic acid hydratase (94 726 Da) is proposed. This protein and also the ORF5 translational product are essential for growth on propionic acid, as revealed by the propionic-acid-nega ...
Counting Small RNA in Pathogenic Bacteria
... key insights into how messenger RNA (mRNA) are produced,1 the regulatory role of long noncoding RNA,2 and determination of cell fate by spatial patterning. One key method used to obtain single cell expression data is singlemolecule fluorescence hybridization (smFISH), a technique first introduced for ...
... key insights into how messenger RNA (mRNA) are produced,1 the regulatory role of long noncoding RNA,2 and determination of cell fate by spatial patterning. One key method used to obtain single cell expression data is singlemolecule fluorescence hybridization (smFISH), a technique first introduced for ...
HUMAN PRIMARY CELLS RNA PRODUCTS Total RNA
... human cells. Those cells are isolated from human blood, bone marrow, or umbilical cord blood using Miltenyi’s magnetic automatic cell sorting (MACS) technology. The purity of the cells is analyzed by FACS assay and is higher than 90%. ...
... human cells. Those cells are isolated from human blood, bone marrow, or umbilical cord blood using Miltenyi’s magnetic automatic cell sorting (MACS) technology. The purity of the cells is analyzed by FACS assay and is higher than 90%. ...
Comparison of Amino Acid Sequences of Halloween Genes in
... different orders. A high similarity can be traced within order Lepidoptera. In this paper, I will focus on the Halloween genes that control the ecdysteroid biosynthesis pathway to build up a peak titer of 20E hormone. These genes were selected for amplification in Spodoptera litura and then converte ...
... different orders. A high similarity can be traced within order Lepidoptera. In this paper, I will focus on the Halloween genes that control the ecdysteroid biosynthesis pathway to build up a peak titer of 20E hormone. These genes were selected for amplification in Spodoptera litura and then converte ...
Nitrosation of aspartic acid, aspartame, and glycine ethylester
... Values of 60, 15, and 2 min;respectively, were found at pH 7. It is concluded that rearrangement of the primary N-nitroso product to the ultimate alkylating agent could be rate-limiting. The potential of nitrosated a-amino acids to bind to DN A in vivo was investigated by oral gavage of radiolabelle ...
... Values of 60, 15, and 2 min;respectively, were found at pH 7. It is concluded that rearrangement of the primary N-nitroso product to the ultimate alkylating agent could be rate-limiting. The potential of nitrosated a-amino acids to bind to DN A in vivo was investigated by oral gavage of radiolabelle ...
Document
... The amount of DNA that must be loaded depends on the relative abundance of the target sequence to which hybridization will take place. The detection limit of a radioactive probe with a specific activity of 108 to 109 dpm/µg is about 0.5 pg DNA. Thus, for human genomic DNA, 10mg – equivalent to 1.5 p ...
... The amount of DNA that must be loaded depends on the relative abundance of the target sequence to which hybridization will take place. The detection limit of a radioactive probe with a specific activity of 108 to 109 dpm/µg is about 0.5 pg DNA. Thus, for human genomic DNA, 10mg – equivalent to 1.5 p ...
Characterization of a cDNA Clone Encoding Multiple Copies of the
... of NiCI,-6H,O and 3.5 gm of L-lysine free base in 20 ml H,O; Fredman, 1987; S. B. Fredman, personal communication). This preparation was maintained at room temperature for 18-24 hr before the pipette was removed, and the ganglia were washed in fresh saline. Nickel was precipitated by adding 5-10 dro ...
... of NiCI,-6H,O and 3.5 gm of L-lysine free base in 20 ml H,O; Fredman, 1987; S. B. Fredman, personal communication). This preparation was maintained at room temperature for 18-24 hr before the pipette was removed, and the ganglia were washed in fresh saline. Nickel was precipitated by adding 5-10 dro ...
as PDF
... the other hand has the lowest buffering capacity but provides the best resolution for larger DNA which implies the need for lower voltage and more time with a better product. Lithium Borate (LB) - relatively new buffer and is ineffective in resolving fragments larger than 5 kbp. However, with its lo ...
... the other hand has the lowest buffering capacity but provides the best resolution for larger DNA which implies the need for lower voltage and more time with a better product. Lithium Borate (LB) - relatively new buffer and is ineffective in resolving fragments larger than 5 kbp. However, with its lo ...
Identical Point Mutations of the R-type Pyruvate
... A silent point mutation, "%CC to CCC, was detected in the R-type PK cDNA of PK Fukushima and PK Maebashi. A point mutation, "'AGG to CGG, was also detected in the R-type PKcDNA ofboth PK-Fukushima and PK Maebashi. This mutation does not change an amino acid residue (Ser). We evaluated the existence ...
... A silent point mutation, "%CC to CCC, was detected in the R-type PK cDNA of PK Fukushima and PK Maebashi. A point mutation, "'AGG to CGG, was also detected in the R-type PKcDNA ofboth PK-Fukushima and PK Maebashi. This mutation does not change an amino acid residue (Ser). We evaluated the existence ...
A Superfamily of S Locus-Related Sequences in
... genes were reported previously (Dwyer et al., 1992; Tobias et al., 1992). To determine the nucleotide sequence of the ARK2 gene, restriction fragments derived from genomic region 2 were cloned into plasmid vectors to generate the subclones shown in Figure 1. Subclone pBL225 contains a 4.2-kb Pstl fr ...
... genes were reported previously (Dwyer et al., 1992; Tobias et al., 1992). To determine the nucleotide sequence of the ARK2 gene, restriction fragments derived from genomic region 2 were cloned into plasmid vectors to generate the subclones shown in Figure 1. Subclone pBL225 contains a 4.2-kb Pstl fr ...
the Acetyl-Coenzyme A
... were less well conserved. On the basis of a recently published overview about regulatory DNA-binding proteins in yeast (Verdier, 1990), no obvious regulatory sequences were found in the 162 nucleotides of the 5' non-coding region. At bases 2286 and 23 11 were the sequences AAGAAA and CATAAA, which a ...
... were less well conserved. On the basis of a recently published overview about regulatory DNA-binding proteins in yeast (Verdier, 1990), no obvious regulatory sequences were found in the 162 nucleotides of the 5' non-coding region. At bases 2286 and 23 11 were the sequences AAGAAA and CATAAA, which a ...
Caenorhabditis elegans unc-60 gene encodes
... from F53E2 were used to probe Southern blots containing D N A from C. elegans and the closely related Caenorhabditis briqgsae. To our surprise, most of the probes hybridized at low stringency to a family of C. eleqans and C. briqgsae fragments. Based on hybridization patterns, there are at least thr ...
... from F53E2 were used to probe Southern blots containing D N A from C. elegans and the closely related Caenorhabditis briqgsae. To our surprise, most of the probes hybridized at low stringency to a family of C. eleqans and C. briqgsae fragments. Based on hybridization patterns, there are at least thr ...
Isolation, Cloning, and Sequencing of the Salmonella typhimurium dd1A Gene with Purification and Characterization of its Product, D-Alanine:D-Alanine Ligase (ADP Forming).
... Figure 1). The temperature-sensitive mutation in ST640, however, was never backcrossed into a nonmutagenized background. Thus, it has not been shown whether or not ddl is an essential structural gene for cell wall synthesis and cell viability in E. coli. The goal of this work, therefore, was 2-fold: ...
... Figure 1). The temperature-sensitive mutation in ST640, however, was never backcrossed into a nonmutagenized background. Thus, it has not been shown whether or not ddl is an essential structural gene for cell wall synthesis and cell viability in E. coli. The goal of this work, therefore, was 2-fold: ...
Real-time polymerase chain reaction
A real-time polymerase chain reaction is a laboratory technique of molecular biology based on the polymerase chain reaction (PCR). It monitors the amplification of a targeted DNA molecule during the PCR, i.e. in real-time, and not at its end, as in conventional PCR. Real-time PCR can be used quantitatively (Quantitative real-time PCR), semi-quantitatively, i.e. above/below a certain amount of DNA molecules (Semi quantitative real-time PCR) or qualitatively (Qualitative real-time PCR).Two common methods for the detection of PCR products in real-time PCR are: (1) non-specific fluorescent dyes that intercalate with any double-stranded DNA, and (2) sequence-specific DNA probes consisting of oligonucleotides that are labelled with a fluorescent reporter which permits detection only after hybridization of the probe with its complementary sequence.The Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines propose that the abbreviation qPCR be used for quantitative real-time PCR and that RT-qPCR be used for reverse transcription–qPCR [1]. The acronym ""RT-PCR"" commonly denotes reverse transcription polymerase chain reaction and not real-time PCR, but not all authors adhere to this convention.