Download Name: Date: Genetic Engineering Notes Selective Breeding: People

Name: __________________________________________
Date: _________________________
Genetic Engineering Notes
Selective Breeding:
 People have been practicing gene manipulation for hundreds of years
 One way we have been practicing genetic engineering is through a process called selective breeding.
 Selective breeding occurs when we choose animals with favorable traits and breed those animals and do
not breed animals with traits we find unfavorable.
 Selective breeding is regulated by two principles”
o Hybridization – crossing two organisms that are not similar to hopefully get the best of both
organisms
o Inbreeding – breeding very similar animals to preserve the traits the are present in that line of
organisms. This can cause recessive alleles present in these lines to show up causing unnecessary
illness.
Increasing Variation:
 Sometimes we want new varieties of an organism, so we induce mutation.
 Mutations are the main source of genetic variation, it’s how new traits form
 Breeders can use radiation and chemicals to force mutations to occur.
 Most of the time these mutations are harmful to the organism, but occasionally a favorable mutation will
appear.
 This is an ethical issue with animals, so we only practice these methods with bacteria and plants
Genetic Engineering:
 Genetic engineering is making changes in the DNA code of a living organism
 We already know that we have read certain organisms DNA sequence, and that we can analyze it using
gel electrophoresis, but we can also transform DNA using recombinant DNA and viruses
Recombinant DNA:
 Restriction enzymes are proteins that cut DNA at specific sites.
 For example BamI cuts DNA wherever it sees at CTAG sequence.
 So, where would BamI cut this strand of DNA?
GTCTAGCGTACACTGCTAGAACGT
CAGATCGCATGTGACGATCTTGCA
 Synthetic DNA can be made in a lab using a machine called a DNA synthesizer.
 The scientists can join natural pieces of DNA to synthesized one using enzymes that splice DNA back
together
 They can also combine DNA from two completely different organisms together
 This is called recombinant DNA because it combines the DNA from two different sources together
Polymerase Chain Reaction:
 This is a process that allows us to make many copies of a strand of DNA very quickly
 The first step is to denature the DNA or separate the two strands
 This is done by heating the DNA up to about 94-96oC
 Then we lower the temperature and add primers that will attach to specific sequences in the DNA
 The polymerase attaches to the DNA strand and replicates a complimentary strand of DNA
 This process is repeated continually creating copies of copies of copies and increasing the amount of
DNA exponentially
 This process allows researchers to make many copies of unique segments of DNA and store them or
share them
 That way if we find a tiny sample of DNA at a crime scene we can replicate it to make as much as we
want, to test many times
Transformation:
 Transformation – when a cell takes DNA from outside the cell and integrates it into the cell’s own DNA
 This can be done three ways
• Natural uptake of DNA from surroundings
• Injection with a needle
• Using a virus to inject the DNA
Bacteria:
 Some bacteria are able to naturally able to pick up DNA and sometimes humans control it
 Scientists create a piece of DNA called a plasmid
 These plasmids need to have a origin for replication and two ends that a specific restriction enzyme
will cut
 Wherever it cuts the bacterial DNA is where the plasmid is inserted
 Sometimes these changes add a gene that make a bacterial cell resistant to antibiotics
Animals Cells:
 DNA can be inserted into larger cells such as egg cells with a needle
 We also use viruses to inject DNA into cells
 A virus naturally injects its own DNA into other cells, so if we replace the harmful virus DNA with
a favorable gene the virus will inject that gene into the cell.
 Sometimes we just randomly insert needed recombinant genes into the DNA, but sometimes we
target specific areas for insertion
 We can target specific genes that are unfavorable and insert the recombinant genes in its place so it
“knocks out” that gene
Why Engineer?
 It allows us to create transgenic organisms that help support our population
• Pest resistant crops
• Crops with added nutrients that taste better
• Cows who produce more growth hormone
• Plants or bacteria that will produce plastics
 We can use small, quickly reproducing organisms to generate medicine cheaply
• Bacteria can contain genes to make insulin or human growth hormone
• Some microorganisms were developed to digest oil
 We can insert some of our DNA into animals to study the affects of disease
Stem Cells:
 Stem cells are cells that have not yet differentiated and can become any type of cell still
 There are adult stem cells, and embryonic stem cells, but adult stem cells can only produce one type of
cell
 So, it is more beneficial to use embryonic stem cells for research, but it requires destroying an embryo.
 Stem cells could possibly be used to produce any other type of cell or structure, they could be used to
cure diseases
Cloning:
 In 1997 we successfully cloned our first mammal, a sheep named Dolly
 They took a cell from one sheep and an egg cell from another.
 They removed the nucleus from the egg cell and then fused it with the other cell using an electric shock.
 They then implanted this egg cell into the uterus of a foster mother who gave birth to Dolly
Ethics:
 Ethics play a big role in genetic engineering because some people think it is wrong, while others think
its benefits outweigh the negatives.
 What do you think about genetic engineering, stem cells, and cloning?
Name: __________________________________________
Date: _________________________
Genetic Engineering Notes
Selective Breeding:
 People have been practicing gene __________________ for ___________________ of years
 One way we have been practicing genetic engineering is through a process called _________________
___________________
 Selective breeding occurs when we ______________ animals with _______________ traits and breed
those animals and do not _____________ animals with traits we find unfavorable.
 Selective breeding is regulated by two principles
o _____________ization – crossing two organisms that are ________ similar to hopefully get the
________ of both organisms
o Inbreeding – breeding very ______________ animals to ________________ the traits that are
present in that line of organisms. This can cause ________________ alleles present in these lines
to show up causing unnecessary ______________
Increasing Variation:
 Sometimes we want __________ varieties of an organism, so we induce ____________________
 ________________ are the main source of genetic _________________, it’s how new traits form
 Breeders can use ________________ and ___________________ to force mutations to occur.
 Most of the time these mutations are _____________________ to the organism, but occasionally a
___________________ mutation will appear.
 This is an _______________ issue with animals, so we only practice these methods with
______________ and ____________
Genetic Engineering:
 Genetic engineering is making ____________ in the ____________ code of a living organism
 We already know that we have read certain organisms DNA sequence, and that we can analyze it using
gel ________________________, but we can also transform DNA using ____________________ DNA
and ___________________
Recombinant DNA:
 ______________________ enzymes are proteins that _____________ DNA at specific sites.
 For example BamI cuts DNA wherever it sees at CTAG sequence.
 So, where would BamI cut this strand of DNA?
GTCTAGCGTACACTGCTAGAACGT
CAGATCGCATGTGACGATCTTGCA
 ____________________ DNA can be made in a lab using a machine called a DNA synthesizer.
 The scientists can ___________ natural pieces of DNA to synthesized one using _______________ that
splice DNA back together
 They can also ____________ DNA from two completely _________________ organisms together
 This is called recombinant DNA because it combines the DNA from two different sources together
Polymerase Chain Reaction:
 This is a process that allows us to make many _______________ of a strand of DNA very quickly
 The first step is to ___________________ the DNA or separate the two strands
 This is done by heating the DNA up to about 94-96oC
 Then we lower the temperature and add ______________ that will attach to specific sequences in the
DNA
 The polymerase attaches to the DNA strand and __________________ a complimentary strand of DNA
 This process is __________________ continually creating copies of copies of copies and increasing the
amount of DNA exponentially
 This process allows researchers to make many copies of unique segments of DNA and store them or
share them
 That way if we find a ___________ sample of DNA at a crime scene we can ________________ it to
make as much as we want, to test many times
Transformation:
 Transformation – when a cell takes DNA from _____________ the cell and _______________ it into
the cell’s own DNA
 This can be done three ways
•
_______________ uptake of DNA from surroundings
•
Injection with a ________________
•
Using a _______________ to inject the DNA
Bacteria:
 Some ______________ are able to naturally able to pick up DNA and sometimes humans control it
 Scientists create a piece of DNA called a _____________________
 These plasmids need to have an origin for ________________ and two ends that a specific
__________________ enzyme will cut
 Wherever it cuts the bacterial ___________ is where the plasmid is __________________
 Sometimes these changes add a _____________ that make a bacterial cell ________________ to
__________________
Animals Cells:
 DNA can be inserted into ______________ cells such as ________ cells with a needle
 We also use viruses to inject DNA into cells
 A virus naturally injects its own DNA into other cells, so if we _____________ the harmful
_____________ DNA with a __________________ gene the virus will inject that gene into the
cell.
 Sometimes we just __________________ insert needed recombinant genes into the DNA, but
sometimes we _________________ specific areas for insertion
 We can target specific genes that are unfavorable and insert the recombinant genes in its place so it
“______________ _______” that gene
Why Engineer?
 It allows us to create ____________________ organisms that help support our population
•
__________ resistant crops
•
Crops with added __________________ that taste better
•
Cows who produce more growth ___________________
•
Plants or bacteria that will produce _________________
 We can use small, quickly reproducing organisms to generate _________________ cheaply
•
Bacteria can contain genes to make _________________ or human growth hormone
•
Some microorganisms were developed to digest oil
 We can insert some of our DNA into animals to study the affects of disease
Stem Cells:
 Stem cells are cells that have ________ yet ___________________ and can become any type of cell still
 There are ______________ stem cells, and _______________ stem cells, but adult stem cells can only
produce _____________ type of cell
 So, it is more beneficial to use __________________ stem cells for research, but it requires destroying
an _________________
 Stem cells could possibly be used to produce any other type of cell or structure, they could be used to
cure diseases
Cloning:
 In 1997 we successfully cloned our first ________________, a sheep named ___________
 They took a ___________ from one sheep and an ___________ cell from another.
 They ______________ the _________________ from the egg cell and then ______________ it with the
other cell using an _________________ shock.
 They then ____________________ this egg cell into the uterus of a foster mother who gave birth to
Dolly
Ethics:
 Ethics play a big role in genetic engineering because some people think it is ____________, while
others think its benefits __________________ the negatives.
Critical Thinking Questions:
1: What do you think about genetic engineering, stem cells, and cloning?
2: Will movies like Jurassic Park every come true one day? Explain why or why not?
3: What are two things that you learned from this slide show?
4: Imagine that you were walking to school and got bit by a Radioactive insect!!!! The radiation in the bite was
strong enough to change your DNA and cause a mutation! On a sheet of lined paper (there is some by the
window), describe the mutation or mutations that the bug bite caused you to develop. If you developed any
super powers, did you use them for good or evil?? Draw a picture as well to help bring this mutation to life!