* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Protein Synthesis Project - Lin
Survey
Document related concepts
Protein moonlighting wikipedia , lookup
Magnesium transporter wikipedia , lookup
Circular dichroism wikipedia , lookup
Protein phosphorylation wikipedia , lookup
Nuclear magnetic resonance spectroscopy of proteins wikipedia , lookup
List of types of proteins wikipedia , lookup
Protein (nutrient) wikipedia , lookup
Protein structure prediction wikipedia , lookup
Proteolysis wikipedia , lookup
Genetic code wikipedia , lookup
Transcript
Protein Synthesis Project Name____________________________ Date_____________________________ Messenger RNA molecule part: UUUUCUUAUCUUCGUACUGUUGGU CGUGGUUAUACUUCUGUUGGUUUU Construct a chart using the following directions: 1. Decode the above strand of m-RNA using the decoder below. UUU= Phenylaline GGU= Glycine UAU= Tyrosine CUU= Leucine ACU= Threonine UCU= Serine CGU= Argenine GUU= Valine Write out the resulting t-RNA in the space below, remember A-U and C-G. t-RNA : ________________________________________________________________________ _____ ________________________________________________________________________ _____ 2. Now divide the t-RNA into its codons by separating them with a vertical line. 3. Using the amino acid chart found above, determine the name of the amino acid that each codon codes for m-RNA. Write the abbreviation of the amino acids, in their proper order, in the area below. ________________________________________________________________________ _____ ________________________________________________________________________ _____ ________________________________________________________________________ _____ ________________________________________________________________________ _____ ________________________________________________________________________ _____ ________________________________________________________________________ _____ 4. How many molecules of water are lost in the process of creating this entire protein? ( dehydration synthesis). _________. 5. Name the enzymes needed for the following processes to occur: a). t-RNA activation _________________________________________________ b). m-RNA startup __________________________________________________ c). termination of protein synthesis ______________________________________ 6. Explain how the proper amino acid is attached to their correct t-RNA molecule. ________________________________________________________________________ _____ ________________________________________________________________________ _____ ________________________________________________________________________ _____ ________________________________________________________________________ _____ 7. How many amino acids does this complete protein contain? _____________. ©2000 Troy High School Biology